ID: 1034248096

View in Genome Browser
Species Human (GRCh38)
Location 7:149664550-149664572
Sequence TCAGGTACTGAGTAAGGGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034248081_1034248096 19 Left 1034248081 7:149664508-149664530 CCTTGATACTTAGACCTGCCTCT No data
Right 1034248096 7:149664550-149664572 TCAGGTACTGAGTAAGGGAACGG No data
1034248084_1034248096 -4 Left 1034248084 7:149664531-149664553 CCCCCAACCCCTACTCCCATCAG No data
Right 1034248096 7:149664550-149664572 TCAGGTACTGAGTAAGGGAACGG No data
1034248087_1034248096 -6 Left 1034248087 7:149664533-149664555 CCCAACCCCTACTCCCATCAGGT No data
Right 1034248096 7:149664550-149664572 TCAGGTACTGAGTAAGGGAACGG No data
1034248085_1034248096 -5 Left 1034248085 7:149664532-149664554 CCCCAACCCCTACTCCCATCAGG No data
Right 1034248096 7:149664550-149664572 TCAGGTACTGAGTAAGGGAACGG No data
1034248083_1034248096 1 Left 1034248083 7:149664526-149664548 CCTCTCCCCCAACCCCTACTCCC No data
Right 1034248096 7:149664550-149664572 TCAGGTACTGAGTAAGGGAACGG No data
1034248088_1034248096 -7 Left 1034248088 7:149664534-149664556 CCAACCCCTACTCCCATCAGGTA No data
Right 1034248096 7:149664550-149664572 TCAGGTACTGAGTAAGGGAACGG No data
1034248082_1034248096 5 Left 1034248082 7:149664522-149664544 CCTGCCTCTCCCCCAACCCCTAC No data
Right 1034248096 7:149664550-149664572 TCAGGTACTGAGTAAGGGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034248096 Original CRISPR TCAGGTACTGAGTAAGGGAA CGG Intergenic