ID: 1034248098

View in Genome Browser
Species Human (GRCh38)
Location 7:149664554-149664576
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034248082_1034248098 9 Left 1034248082 7:149664522-149664544 CCTGCCTCTCCCCCAACCCCTAC No data
Right 1034248098 7:149664554-149664576 GTACTGAGTAAGGGAACGGGAGG No data
1034248083_1034248098 5 Left 1034248083 7:149664526-149664548 CCTCTCCCCCAACCCCTACTCCC No data
Right 1034248098 7:149664554-149664576 GTACTGAGTAAGGGAACGGGAGG No data
1034248088_1034248098 -3 Left 1034248088 7:149664534-149664556 CCAACCCCTACTCCCATCAGGTA No data
Right 1034248098 7:149664554-149664576 GTACTGAGTAAGGGAACGGGAGG No data
1034248090_1034248098 -8 Left 1034248090 7:149664539-149664561 CCCTACTCCCATCAGGTACTGAG No data
Right 1034248098 7:149664554-149664576 GTACTGAGTAAGGGAACGGGAGG No data
1034248081_1034248098 23 Left 1034248081 7:149664508-149664530 CCTTGATACTTAGACCTGCCTCT No data
Right 1034248098 7:149664554-149664576 GTACTGAGTAAGGGAACGGGAGG No data
1034248087_1034248098 -2 Left 1034248087 7:149664533-149664555 CCCAACCCCTACTCCCATCAGGT No data
Right 1034248098 7:149664554-149664576 GTACTGAGTAAGGGAACGGGAGG No data
1034248084_1034248098 0 Left 1034248084 7:149664531-149664553 CCCCCAACCCCTACTCCCATCAG No data
Right 1034248098 7:149664554-149664576 GTACTGAGTAAGGGAACGGGAGG No data
1034248089_1034248098 -7 Left 1034248089 7:149664538-149664560 CCCCTACTCCCATCAGGTACTGA No data
Right 1034248098 7:149664554-149664576 GTACTGAGTAAGGGAACGGGAGG No data
1034248091_1034248098 -9 Left 1034248091 7:149664540-149664562 CCTACTCCCATCAGGTACTGAGT No data
Right 1034248098 7:149664554-149664576 GTACTGAGTAAGGGAACGGGAGG No data
1034248085_1034248098 -1 Left 1034248085 7:149664532-149664554 CCCCAACCCCTACTCCCATCAGG No data
Right 1034248098 7:149664554-149664576 GTACTGAGTAAGGGAACGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034248098 Original CRISPR GTACTGAGTAAGGGAACGGG AGG Intergenic
No off target data available for this crispr