ID: 1034248099

View in Genome Browser
Species Human (GRCh38)
Location 7:149664570-149664592
Sequence CGGGAGGAGACCTCAGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034248082_1034248099 25 Left 1034248082 7:149664522-149664544 CCTGCCTCTCCCCCAACCCCTAC No data
Right 1034248099 7:149664570-149664592 CGGGAGGAGACCTCAGTTGAAGG No data
1034248085_1034248099 15 Left 1034248085 7:149664532-149664554 CCCCAACCCCTACTCCCATCAGG No data
Right 1034248099 7:149664570-149664592 CGGGAGGAGACCTCAGTTGAAGG No data
1034248083_1034248099 21 Left 1034248083 7:149664526-149664548 CCTCTCCCCCAACCCCTACTCCC No data
Right 1034248099 7:149664570-149664592 CGGGAGGAGACCTCAGTTGAAGG No data
1034248087_1034248099 14 Left 1034248087 7:149664533-149664555 CCCAACCCCTACTCCCATCAGGT No data
Right 1034248099 7:149664570-149664592 CGGGAGGAGACCTCAGTTGAAGG No data
1034248090_1034248099 8 Left 1034248090 7:149664539-149664561 CCCTACTCCCATCAGGTACTGAG No data
Right 1034248099 7:149664570-149664592 CGGGAGGAGACCTCAGTTGAAGG No data
1034248095_1034248099 0 Left 1034248095 7:149664547-149664569 CCATCAGGTACTGAGTAAGGGAA No data
Right 1034248099 7:149664570-149664592 CGGGAGGAGACCTCAGTTGAAGG No data
1034248089_1034248099 9 Left 1034248089 7:149664538-149664560 CCCCTACTCCCATCAGGTACTGA No data
Right 1034248099 7:149664570-149664592 CGGGAGGAGACCTCAGTTGAAGG No data
1034248091_1034248099 7 Left 1034248091 7:149664540-149664562 CCTACTCCCATCAGGTACTGAGT No data
Right 1034248099 7:149664570-149664592 CGGGAGGAGACCTCAGTTGAAGG No data
1034248084_1034248099 16 Left 1034248084 7:149664531-149664553 CCCCCAACCCCTACTCCCATCAG No data
Right 1034248099 7:149664570-149664592 CGGGAGGAGACCTCAGTTGAAGG No data
1034248088_1034248099 13 Left 1034248088 7:149664534-149664556 CCAACCCCTACTCCCATCAGGTA No data
Right 1034248099 7:149664570-149664592 CGGGAGGAGACCTCAGTTGAAGG No data
1034248094_1034248099 1 Left 1034248094 7:149664546-149664568 CCCATCAGGTACTGAGTAAGGGA No data
Right 1034248099 7:149664570-149664592 CGGGAGGAGACCTCAGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034248099 Original CRISPR CGGGAGGAGACCTCAGTTGA AGG Intergenic