ID: 1034248609

View in Genome Browser
Species Human (GRCh38)
Location 7:149670048-149670070
Sequence CAGAAGAAGGAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034248609_1034248616 10 Left 1034248609 7:149670048-149670070 CCCTCCTCCTCCTCCTTCTTCTG No data
Right 1034248616 7:149670081-149670103 TTTGAAAGAAGATAGAGTGGAGG No data
1034248609_1034248617 11 Left 1034248609 7:149670048-149670070 CCCTCCTCCTCCTCCTTCTTCTG No data
Right 1034248617 7:149670082-149670104 TTGAAAGAAGATAGAGTGGAGGG No data
1034248609_1034248615 7 Left 1034248609 7:149670048-149670070 CCCTCCTCCTCCTCCTTCTTCTG No data
Right 1034248615 7:149670078-149670100 TTTTTTGAAAGAAGATAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034248609 Original CRISPR CAGAAGAAGGAGGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr