ID: 1034255162

View in Genome Browser
Species Human (GRCh38)
Location 7:149720780-149720802
Sequence TGTGAGTGCTGAGCAGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034255162 Original CRISPR TGTGAGTGCTGAGCAGCCGC AGG Intronic
900468431 1:2837521-2837543 TGTGAGTGTTGGGCAGTGGCTGG + Intergenic
900528186 1:3139435-3139457 TGTGGGTGCTGAGCACCCTTGGG + Intronic
900880467 1:5377765-5377787 TCTGAGAGCTGAGCACTCGCAGG + Intergenic
901107424 1:6767860-6767882 TGTGAGTGCAGAGCATACCCTGG - Intergenic
901624215 1:10614519-10614541 TGTCAAGGCTGAGCAGACGCTGG - Intronic
902386518 1:16079024-16079046 TGTGAGTGTGAGGCAGCCGCTGG + Intergenic
904199749 1:28812150-28812172 TGTGAGCCAGGAGCAGCCGCAGG - Exonic
905482508 1:38271301-38271323 AGTGAGGGCAGAGCAGCCTCAGG - Intergenic
905923464 1:41733921-41733943 TGTGAGTTCTGTGCAGGGGCTGG - Intronic
906245046 1:44267536-44267558 TGTGATTGCTGAGCTGCCTATGG - Intronic
907247613 1:53117970-53117992 AGGGAGAGGTGAGCAGCCGCGGG + Intronic
907585352 1:55612005-55612027 TGAGAGTGATGAGGAGCCTCTGG - Intergenic
912420292 1:109538034-109538056 TGTGGGTGCTGAGCAGGGACAGG + Intergenic
912468007 1:109887193-109887215 TGTGAGTGGTGAGCATCCCTAGG - Intergenic
919776191 1:201195439-201195461 TGTGAGTTCCGGGCAGGCGCAGG - Intronic
920688895 1:208130845-208130867 TGTGAGTTCTGGCCAGCCACTGG - Intronic
921800770 1:219399690-219399712 TTTGTGTGCAGAGCAGCCTCGGG - Intergenic
922499183 1:226083968-226083990 GGTTAGTGCTCAGCAGCCTCCGG + Intergenic
923488732 1:234462984-234463006 TTTGTTTGCTGAGCAGCAGCAGG - Intronic
1065174503 10:23063572-23063594 AGGGAGTACGGAGCAGCCGCTGG - Intergenic
1067178787 10:43969727-43969749 TGCGGGTCCTGTGCAGCCGCGGG + Intergenic
1071903566 10:90147201-90147223 GGTGAGTGCTGAGGAGCCTTTGG - Intergenic
1075050017 10:119176666-119176688 TGTGAGTGGTGGGCAGCCTGTGG - Intronic
1076046080 10:127295197-127295219 TCTGAGAGCTGAGCAGATGCTGG - Intronic
1077056899 11:598186-598208 TGGGAGTGCTTGGCAGCCTCTGG + Intronic
1081545051 11:44065973-44065995 TGCGCGTGCTGGGCCGCCGCCGG - Intronic
1082081831 11:48018404-48018426 TGTGAGTGGTGTGAAGCCCCGGG + Intronic
1084288365 11:68146326-68146348 TGTGAGGTCTGAGCAGCGTCTGG - Intergenic
1085456349 11:76667585-76667607 GGTGAGAGCAGAGCAGCTGCAGG - Intronic
1085457593 11:76674074-76674096 TGTGGGTGCTGGGCAGAAGCAGG - Intergenic
1085696634 11:78710388-78710410 TCTGAGTGCTGAGAACCTGCTGG + Intronic
1087177366 11:95108017-95108039 TGTGTGTGATGAGCAGCCAGAGG + Intronic
1088894538 11:114067830-114067852 AGTGAGGGCTGAGCACACGCAGG - Intronic
1089773594 11:120820572-120820594 TGTGGGTGCACAGCTGCCGCCGG - Intronic
1090398926 11:126436062-126436084 TGAGAGCTCTGAGCAGACGCTGG + Intronic
1090799113 11:130159781-130159803 TGTGAGAGCGGAGCTGCAGCCGG + Exonic
1091828892 12:3535381-3535403 GGGGAGTCCTGATCAGCCGCTGG + Intronic
1101672539 12:106889475-106889497 TGTTAGTGCTGAAGAGCAGCAGG + Intergenic
1101839218 12:108315956-108315978 GGTGAGTGAGGAGCAGACGCAGG + Intronic
1102949247 12:117018445-117018467 TTTGAGTGCTGAGCTGACGACGG + Intronic
1103318912 12:120079027-120079049 TGTGTGTGCTGGGTAGCTGCAGG + Intronic
1104710166 12:130980042-130980064 TGTGAGTGCAGAACAGCGGTCGG + Intronic
1104856791 12:131905911-131905933 GCTGAGGGCTGAGCAGCTGCTGG + Intronic
1106050603 13:26186623-26186645 TGTGAGAGCTGAGAAGACGACGG - Intronic
1106176439 13:27336377-27336399 TGTGGATGCTGGGCAGCTGCTGG - Intergenic
1106418001 13:29561846-29561868 TGTGTCTGCAGAACAGCCGCTGG - Intronic
1108523518 13:51265380-51265402 AGTGAGAGCTGAGCAGCTGCAGG + Intronic
1111403823 13:87776003-87776025 TTTGACTGCTGAGCAGTCGAAGG - Intergenic
1116669337 14:47821264-47821286 TGTGTGTGCTGAGCTGCCTGGGG + Intergenic
1116716741 14:48436926-48436948 TGTGAGAGCTGGGCAGTCTCTGG + Intergenic
1117057024 14:51922804-51922826 TGTGTTTCCTGAGCAGCCGGGGG + Intronic
1118683721 14:68269750-68269772 TGTGTTTACTGAGCAACCGCTGG - Intronic
1119205705 14:72792049-72792071 AGTGACTGCTGAGCAGCCAGGGG + Intronic
1121267845 14:92615856-92615878 TGTGATTACTAAGCAGCTGCTGG + Intronic
1122269207 14:100560836-100560858 TGTCTGTCCTGAGCAGCAGCAGG - Intronic
1122676557 14:103419565-103419587 TGTGAATGCAGAGCAGACACAGG - Intronic
1123043369 14:105499597-105499619 TGAGCTTGCTGAGCAGCCTCTGG - Intergenic
1125426136 15:39551576-39551598 TGTGAGTGCGGAGCAGTGGTTGG - Intergenic
1125521622 15:40351039-40351061 TGAGAGTGCAGAGCAGGGGCAGG - Exonic
1128699587 15:69794632-69794654 GATGATTGCTGAGCAGGCGCAGG - Intergenic
1130560915 15:84958294-84958316 GGTGACAGCTGAGCAGCAGCAGG - Intergenic
1132054727 15:98641732-98641754 TGTGACTGATGAGCTGCCGAAGG - Intergenic
1132938833 16:2496907-2496929 GGTGAGGGCCGGGCAGCCGCTGG + Exonic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1134006768 16:10823149-10823171 TGAGGGTGATGAGCAGCTGCTGG - Intergenic
1136418373 16:30117079-30117101 TGTGTGAGCCCAGCAGCCGCTGG - Intronic
1136915565 16:34191420-34191442 TTGGAGTGCTTTGCAGCCGCTGG - Intergenic
1138184171 16:54963630-54963652 TGTGAGTGACAAGCAGCCGCAGG - Intergenic
1138233679 16:55361096-55361118 TGTGCTTGCTGGGCAGCCTCTGG + Intergenic
1139834933 16:69830622-69830644 TGTGAGTGTTGGGGGGCCGCGGG + Intronic
1142190352 16:88714538-88714560 TGTGGGGGCTCAGCAGCCCCAGG + Intronic
1142379615 16:89723851-89723873 TGGATGTGGTGAGCAGCCGCAGG - Intronic
1142670332 17:1485084-1485106 TGAGAGTCCTGAGAAGCCTCAGG + Intronic
1142780389 17:2176951-2176973 TTTGAGTGCAGTGCAGCTGCTGG + Intronic
1143179156 17:4973545-4973567 GGTGAGGGCTGGGCAGCCTCTGG - Intronic
1147038731 17:37701070-37701092 GGTGAGGGCTGTGCAGCTGCTGG + Exonic
1147638109 17:41976260-41976282 TGTGAGTGCTAGGCAGGCCCCGG - Exonic
1149544456 17:57493036-57493058 TGTGGGTGCTGAGAAACCTCAGG + Intronic
1152045356 17:77931466-77931488 TGTGTCCGCTGAGAAGCCGCCGG - Intergenic
1152163980 17:78689518-78689540 TGTGAGTGATGGGGAGCAGCTGG + Intronic
1152230825 17:79113206-79113228 TGTGAGTGCCGGGCAGCCTCTGG + Intronic
1153959402 18:10127813-10127835 TGTGAGGGGTCAGCAGCTGCTGG - Intergenic
1154023269 18:10683919-10683941 TGTGAGGGCTGAGCAGAAGGAGG - Intronic
1155955391 18:31952586-31952608 TGTGAATGCTGAGAAGCCAATGG - Intronic
1160834735 19:1119354-1119376 TGGGAGTGCTGGGCAGCCCGAGG + Intronic
1161466421 19:4433152-4433174 TGTGGTTGCTGAGCAGTCCCCGG - Exonic
1161772316 19:6237403-6237425 GGGGAATGCTGAGCAGCCGCTGG - Intronic
1162421570 19:10568703-10568725 TGTCAGCGCGGAGCAGCCGGCGG + Exonic
1162943862 19:14030949-14030971 TTTGAGGGCTGGGCAGCCGTGGG + Exonic
1163723028 19:18907220-18907242 TGGGGGTGCAGAGCAGCAGCAGG + Intronic
1164742227 19:30584230-30584252 TGCAAGTGGTGAGCAGCAGCTGG + Intronic
1166783783 19:45355779-45355801 CGTGAGTGCTGACCACCTGCTGG + Intronic
1167238724 19:48330638-48330660 TCTGAGGGCTGAGCAGCTGGCGG - Intergenic
925444269 2:3914421-3914443 GCTGAGCGCTGAGCAGCCCCGGG - Intergenic
925922055 2:8644944-8644966 TTTGAGAGCTGAGAACCCGCAGG + Intergenic
927849439 2:26489656-26489678 GGTGAGTGGGGAGCAGCCCCTGG - Exonic
928368503 2:30721813-30721835 GGTCAGTGGTGAGCAGCCCCAGG - Intergenic
930155862 2:48107087-48107109 TGGGAGTGCTCAGGAGACGCGGG - Intergenic
931629309 2:64284980-64285002 GGTGAGTGCTGAACAGCGGGAGG + Intergenic
931649448 2:64454656-64454678 CTGGGGTGCTGAGCAGCCGCAGG + Intronic
933866312 2:86521341-86521363 TGTGAGTGCTGAGCTATCGTGGG - Intronic
935342923 2:102074042-102074064 TGTGAGTGATGAGCAGCACGTGG + Intronic
937320866 2:120959964-120959986 TGTGAGCTCTGTGCAGGCGCAGG + Intronic
938058711 2:128235790-128235812 TGGCAGTGCTGGGCAGCCGCAGG + Intergenic
938654856 2:133420877-133420899 CGTGACTGCTGAGCAGCAGTGGG - Intronic
939003548 2:136761868-136761890 TGTGAGTGTTGAGCGTCTGCTGG + Intergenic
940009066 2:149036625-149036647 TGTGCTTGCTGAGCAGCCTTGGG - Intergenic
947815700 2:233034784-233034806 GGTGAGTGTAGAGCAGCCACTGG - Exonic
948231154 2:236350645-236350667 TGTGGGTGCTGGGCAGACCCAGG - Intronic
1170884785 20:20330652-20330674 TTTAAGTGCTCAGAAGCCGCTGG + Intronic
1171909860 20:30939285-30939307 TTGGAGTGCTTTGCAGCCGCTGG - Intergenic
1175345162 20:58267888-58267910 TGTGGGTGCTGAGTAGCAGCTGG - Intergenic
1175632778 20:60556213-60556235 TGTGAGTGATGGGAAGCCACTGG + Intergenic
1175635615 20:60580349-60580371 TGTGAGTCCTGAGCCACCCCTGG + Intergenic
1178443570 21:32618315-32618337 AGTGAGTGCTGAGGGACCGCTGG + Intergenic
1180259444 21:46658681-46658703 TGAGAGGCCTGTGCAGCCGCGGG + Intronic
1182623846 22:31631885-31631907 TCTCAGTGGTGAGAAGCCGCTGG - Intronic
1182891288 22:33820827-33820849 TGTGTCTCCTGAGCAGCAGCAGG - Intronic
1183500760 22:38177395-38177417 TGTGGGTGCTGGGCAGCAGTGGG - Intronic
1183819031 22:40329659-40329681 TGTGGGTGCTGAGCTGCTGGAGG - Exonic
1184226653 22:43132670-43132692 TGTGAGTGCTGAGAACATGCTGG - Exonic
1185226201 22:49654567-49654589 GATGAGTGCTGAGCTGCCTCTGG - Intronic
953577966 3:44128401-44128423 TGTGAGTGCAGTGCAGCCCTGGG + Intergenic
954192107 3:48970716-48970738 TGTGAGTGCTGAGCAGCCCTGGG + Intronic
954709592 3:52498790-52498812 CTTGAGGGCTGAGCAGCTGCTGG - Intronic
955763962 3:62319892-62319914 TGAGAGTGCTTAGCAGCCAGGGG + Intronic
957184866 3:76928919-76928941 TGTGAGTACTGAGCAACCCACGG - Intronic
957278133 3:78115375-78115397 TTTCAGTGCTGATCAGCTGCAGG + Intergenic
958989385 3:100824769-100824791 TGTCAATGCTGAGCAGCAACAGG - Intronic
960820421 3:121724889-121724911 GGTTAGTGCAAAGCAGCCGCAGG + Intronic
962828764 3:139121525-139121547 GGTGATTGCTGAGCAGCCTGAGG + Intronic
963291395 3:143493490-143493512 CGTAAGTGCTGAGCAACAGCAGG - Intronic
966241144 3:177756624-177756646 TGTGAATGCTGAGGGGCTGCAGG - Intergenic
968022072 3:195401213-195401235 TGTGATTGTTGAGCAGCCTGTGG - Intronic
968028873 3:195465867-195465889 TGTGTGAGCTGGGGAGCCGCTGG + Intergenic
968744401 4:2352281-2352303 TGTCTGTGCTGAGCACCCCCAGG - Intronic
969323048 4:6424641-6424663 TGTGCCTGCTGAACAGCTGCTGG + Intronic
976105419 4:81612234-81612256 TGGCAGTGCTGAGCAGGCACTGG + Intronic
976680022 4:87745943-87745965 TGTGAGATCTGAGCAGGCGCTGG + Intergenic
977254584 4:94726718-94726740 TGTGAATGCAGATCAGCCTCTGG - Intergenic
978194954 4:105960357-105960379 TGTGATTGCAGAGCAGCTGAGGG + Intronic
978671018 4:111247206-111247228 TGTGAGTGATGAGGAGCGGCTGG - Intergenic
981485458 4:145281360-145281382 GGTGAGCACTGAGCAGCCACTGG + Intergenic
981533621 4:145776647-145776669 GGTGAGTGCTGAGCAGGGGAGGG + Intronic
982836984 4:160131280-160131302 TGTTAGTGGTGAGGAGCAGCTGG - Intergenic
983891281 4:173032943-173032965 TGTGAGTGCTGAGACGGTGCTGG - Intronic
984954463 4:185031740-185031762 TAAGAGTGCAGAGCAGCCACTGG + Intergenic
987158422 5:15114804-15114826 GGTGACTTCTGAGCAGCAGCAGG + Intergenic
988191542 5:27943206-27943228 TATGGCTGCTGAGCAGCAGCTGG - Intergenic
988283167 5:29175897-29175919 TGTGAATGCTGAAGAGCAGCAGG - Intergenic
991458330 5:66828740-66828762 TGTAAGTGTTTAGCAGCTGCCGG + Intronic
998290242 5:140907858-140907880 TGTGAGTGCTCACCAACGGCTGG - Intronic
1002279386 5:178121752-178121774 AGACAGTGCTGAGCAGCTGCGGG + Exonic
1003331507 6:5133096-5133118 TGTGTGTGCTGGGCAGCCTGAGG + Intronic
1004278645 6:14259754-14259776 TTTGTGTGCTCAGAAGCCGCTGG - Intergenic
1004794501 6:19066341-19066363 AGTGTGTGCTGAGCAGGTGCAGG - Intergenic
1005216169 6:23531223-23531245 TGTGAATGCTGAGGAGTCCCTGG + Intergenic
1007337017 6:41161452-41161474 TGTGCGTGCTGACCACACGCTGG + Exonic
1011027198 6:82882016-82882038 TGTAAGTGGAGAGCAGCAGCAGG - Intergenic
1012039893 6:94190659-94190681 TGTGTGTGATGAGCAGCTGCTGG - Intergenic
1012815632 6:104018781-104018803 TCTGACTGCTGAGCAGGCCCTGG + Intergenic
1018060181 6:160084128-160084150 TGAGAGAGGAGAGCAGCCGCAGG - Exonic
1018391827 6:163346692-163346714 AGTGAGTCCTGGGCAGCCTCAGG - Intergenic
1018702984 6:166441968-166441990 TGTAAGTGCTGAGCGGCAGCCGG - Intronic
1018995749 6:168709434-168709456 TGTGAGAGCAAAGGAGCCGCTGG + Intergenic
1027151244 7:75735247-75735269 TCTGAGTACTGAGCAGATGCTGG - Intronic
1032155723 7:129466032-129466054 AGTGTTTGCTGAGCAGCAGCAGG + Intronic
1034255162 7:149720780-149720802 TGTGAGTGCTGAGCAGCCGCAGG + Intronic
1034987164 7:155523515-155523537 GGTCACTGCTGAGCAGCTGCAGG - Intronic
1035381908 7:158445859-158445881 TGTCAGTGCTCAGAAGCCTCCGG + Intronic
1037920130 8:22800129-22800151 GGTGAGAGCTGAGCAGCCCAGGG + Intronic
1039470075 8:37807985-37808007 TGTGGGCTCTGGGCAGCCGCAGG - Intronic
1041628421 8:60057837-60057859 TGTGAGTGCTATCCAGCCACTGG + Intergenic
1049253514 8:141601918-141601940 TGTGACTGCTGAACTGCCGTGGG + Intergenic
1049617708 8:143582938-143582960 TGGGAGTGCTCAGCAGACACTGG - Intronic
1050533267 9:6608928-6608950 TCTGATTCCTGAGCAGCCGTTGG - Intronic
1052407784 9:28084320-28084342 TGTGAGAGCTCAGCACCTGCAGG - Intronic
1053757157 9:41323224-41323246 TGTGGGAGCAGAGCAGCCCCAGG + Intergenic
1056475103 9:86945927-86945949 CGCGGGTGGTGAGCAGCCGCTGG - Exonic
1056578078 9:87870877-87870899 AGGGAGAGCAGAGCAGCCGCAGG + Intergenic
1057213966 9:93218135-93218157 TGTGGGGGCAGGGCAGCCGCAGG + Intronic
1058167105 9:101632680-101632702 TGTGACTGCTGAGTAGCCCATGG - Intronic
1059417028 9:114168603-114168625 TGTGATGGTTGAGCGGCCGCAGG - Exonic
1060297730 9:122354771-122354793 TGTGGGCCCTGAGCAGCAGCAGG + Intergenic
1061723342 9:132567291-132567313 GGTGTGTGCTTAGCAGCTGCTGG + Intronic
1062040902 9:134403849-134403871 TGTGGGTGAGGAGCAGACGCGGG + Intronic
1062434956 9:136542918-136542940 TGTGAGTGCCCATCAGCCGTGGG - Intronic
1062551470 9:137089426-137089448 TCTGAGGGCTGAGAAGCTGCTGG + Intronic
1062558488 9:137128274-137128296 TCTGAGGGCTGAGAAGCTGCTGG - Intergenic
1062668094 9:137688954-137688976 TGGGAGTGGTGAGCTGCTGCAGG + Intronic
1195708010 X:107752100-107752122 TGAGAGTCCTAAGCAGCGGCGGG + Intronic
1200154877 X:153970132-153970154 AGGGAGAGCTGAGCAGGCGCAGG + Intronic