ID: 1034255162

View in Genome Browser
Species Human (GRCh38)
Location 7:149720780-149720802
Sequence TGTGAGTGCTGAGCAGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034255162 Original CRISPR TGTGAGTGCTGAGCAGCCGC AGG Intronic