ID: 1034255448

View in Genome Browser
Species Human (GRCh38)
Location 7:149722399-149722421
Sequence CTGTTGCAGGAGAAGACAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 282}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034255448_1034255455 14 Left 1034255448 7:149722399-149722421 CCTCTTGTCTTCTCCTGCAACAG 0: 1
1: 0
2: 1
3: 18
4: 282
Right 1034255455 7:149722436-149722458 CCGTGGCCTACAAGGAAGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 122
1034255448_1034255459 29 Left 1034255448 7:149722399-149722421 CCTCTTGTCTTCTCCTGCAACAG 0: 1
1: 0
2: 1
3: 18
4: 282
Right 1034255459 7:149722451-149722473 AAGGAAGGCCCAGGAGCCCTGGG 0: 1
1: 0
2: 2
3: 42
4: 472
1034255448_1034255458 28 Left 1034255448 7:149722399-149722421 CCTCTTGTCTTCTCCTGCAACAG 0: 1
1: 0
2: 1
3: 18
4: 282
Right 1034255458 7:149722450-149722472 GAAGGAAGGCCCAGGAGCCCTGG 0: 1
1: 0
2: 5
3: 68
4: 561
1034255448_1034255457 20 Left 1034255448 7:149722399-149722421 CCTCTTGTCTTCTCCTGCAACAG 0: 1
1: 0
2: 1
3: 18
4: 282
Right 1034255457 7:149722442-149722464 CCTACAAGGAAGGAAGGCCCAGG 0: 1
1: 0
2: 3
3: 18
4: 243
1034255448_1034255452 6 Left 1034255448 7:149722399-149722421 CCTCTTGTCTTCTCCTGCAACAG 0: 1
1: 0
2: 1
3: 18
4: 282
Right 1034255452 7:149722428-149722450 CCGACAAACCGTGGCCTACAAGG 0: 1
1: 0
2: 0
3: 0
4: 45
1034255448_1034255453 10 Left 1034255448 7:149722399-149722421 CCTCTTGTCTTCTCCTGCAACAG 0: 1
1: 0
2: 1
3: 18
4: 282
Right 1034255453 7:149722432-149722454 CAAACCGTGGCCTACAAGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 73
1034255448_1034255450 -3 Left 1034255448 7:149722399-149722421 CCTCTTGTCTTCTCCTGCAACAG 0: 1
1: 0
2: 1
3: 18
4: 282
Right 1034255450 7:149722419-149722441 CAGAAACTGCCGACAAACCGTGG 0: 1
1: 0
2: 0
3: 1
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034255448 Original CRISPR CTGTTGCAGGAGAAGACAAG AGG (reversed) Intronic
900924203 1:5692755-5692777 CTGTGGCTGGAAAAGACCAGTGG + Intergenic
902162986 1:14547096-14547118 CTGATGCAGGAAAAGACACCTGG - Intergenic
906719397 1:47994595-47994617 CTGCTGCAGGAGTAGAGAAGAGG + Exonic
907148340 1:52257822-52257844 CTGAGGCAGGAGAACCCAAGAGG - Intronic
910925678 1:92396082-92396104 CTATTCCATGAGAAGAGAAGTGG + Exonic
911097124 1:94063914-94063936 CTCTTCCAGGAGAAGAAAAGAGG - Intronic
914297846 1:146346737-146346759 CTTTTGGAGGACAAGACAGGTGG - Intergenic
914527609 1:148485257-148485279 CTTTTGGAGGACAAGACAGGTGG - Intergenic
915038713 1:152949677-152949699 CAGGTGCAGGAGAAGGCACGGGG + Intergenic
915214429 1:154330387-154330409 TTGTTGCAGAAGAAGAAAGGAGG + Exonic
915791085 1:158672058-158672080 CAGTTGGATGAGTAGACAAGAGG - Exonic
916425219 1:164673873-164673895 CTTTTGTAGCAGAGGACAAGGGG - Intronic
919110533 1:193213962-193213984 CTGGAGCAGGGGAAGAAAAGGGG - Intronic
919985178 1:202668888-202668910 CTCTTGAAGTAGAAGCCAAGAGG + Intronic
920546303 1:206821650-206821672 CTGCTGCAGTGGAAGACAATAGG - Intronic
920751650 1:208683566-208683588 CTGTTCCAGGAGCACTCAAGGGG - Intergenic
921806604 1:219462282-219462304 AGCTTGCAGGATAAGACAAGGGG + Intergenic
923017591 1:230138943-230138965 CAGTCACAGGATAAGACAAGAGG - Intronic
923118945 1:230972061-230972083 GAGTTGCAAGAGAAGACAACTGG + Intronic
923125488 1:231030864-231030886 CTGTGGGAGGACAAGACAGGTGG + Intronic
924127615 1:240871889-240871911 CTGATGCAGGAGGACACAGGAGG - Intronic
1064035831 10:11912734-11912756 TTGTTGCAGCAGAAGCCCAGAGG - Intergenic
1064057264 10:12107900-12107922 CTTTTCCAGGAGAGGCCAAGTGG + Exonic
1064506235 10:16033586-16033608 CTTTGGCTGGAGAAGATAAGAGG - Intergenic
1064715076 10:18168109-18168131 CTTTTGCAGGAGAAGTAAAAAGG - Intronic
1064841543 10:19597915-19597937 TTGTTGCAGGAGCAGAGAACAGG + Intronic
1065658967 10:27985250-27985272 TTGTTGTACTAGAAGACAAGTGG - Intronic
1066465997 10:35650761-35650783 CTGTTGCACCACATGACAAGAGG + Intergenic
1069828765 10:71270249-71270271 CTGATGCAGGAGAACCCAGGAGG + Intronic
1070321772 10:75359841-75359863 CTCTCCCAGGTGAAGACAAGAGG - Intergenic
1070656751 10:78276867-78276889 CTGTTGGAGGAGAAGGGAAGGGG - Intergenic
1071079866 10:81798257-81798279 CTGTTGCAGCAGCAGAAAACAGG + Intergenic
1071085638 10:81865785-81865807 CTGCTTCAGAAGCAGACAAGAGG - Intergenic
1073633178 10:105169445-105169467 CTGCTGCAGGAGATGACATGAGG - Intronic
1074422869 10:113324820-113324842 CAAATGCTGGAGAAGACAAGTGG - Intergenic
1075454049 10:122573475-122573497 CTGTGGCAGCAGAGGACATGGGG + Intronic
1075719308 10:124575690-124575712 CTGGTGCAGGAGTGGACAAAGGG - Intronic
1078206674 11:9235995-9236017 CTTTGGGAGGACAAGACAAGAGG + Intronic
1078514982 11:12014315-12014337 CTGTTGCAGGGGCAGACAGAGGG + Intergenic
1081073766 11:38642756-38642778 CTGTTTAAGGAGACGAGAAGGGG - Intergenic
1081662351 11:44895828-44895850 ATGCAGCAGGAGAAGAGAAGCGG + Intronic
1082862442 11:57868811-57868833 CATTTTCAGGAGAAGCCAAGAGG - Intergenic
1083226988 11:61291440-61291462 CTGCTGGAGGAGAAGACTTGGGG + Intronic
1083915139 11:65737901-65737923 TTTTTGCAGTGGAAGACAAGTGG - Intergenic
1085486478 11:76868000-76868022 CTGCTGCAGCACAAGACAAAAGG + Intronic
1086045205 11:82524435-82524457 CTGTACCAGGAGAAGAGAAATGG + Intergenic
1086499143 11:87434349-87434371 TTGTTGAAGGAGAAGAGAGGAGG + Intergenic
1086768067 11:90724047-90724069 CTGTACTTGGAGAAGACAAGTGG - Intergenic
1087194809 11:95294639-95294661 CTGTTACAGAAGAAGAGCAGAGG + Intergenic
1089703309 11:120258887-120258909 CTGTTGCATGGGAAGCCCAGAGG + Intronic
1089928163 11:122281034-122281056 TTGTAGCAGGAGCAGTCAAGGGG - Intergenic
1090490915 11:127159893-127159915 CTTTTTCAGGAGAATTCAAGTGG - Intergenic
1090656444 11:128849568-128849590 GTGTTGGAGGAGAAGACCATAGG + Intronic
1090721124 11:129474180-129474202 CAGTTGCAGGAGGAGAAATGAGG - Intergenic
1091574601 12:1721457-1721479 CTGTGGCAGGCCAAGGCAAGCGG - Intronic
1093161778 12:15755343-15755365 CTGTTGTTGGAGGAGAAAAGGGG + Intronic
1093163162 12:15773027-15773049 CTGATGTAGGAGAAGTGAAGAGG + Intronic
1094253840 12:28399369-28399391 GTGTTGCAGGAGAAACCCAGTGG - Intronic
1094736471 12:33240428-33240450 CAGTGGCAGGAGAGAACAAGGGG - Intergenic
1095662179 12:44749741-44749763 CTGTGACATGAGAAGAGAAGAGG + Intronic
1096317671 12:50582713-50582735 AGGGTGCAGGAGAAGAAAAGTGG - Intronic
1097155651 12:57010372-57010394 CTGTGGCAGCAGGAGAGAAGGGG + Intronic
1098316338 12:69197457-69197479 CACTTGCAGCAGAAGGCAAGGGG + Intergenic
1098850122 12:75586112-75586134 CTGTTGCTGGAAAAGGGAAGGGG + Intergenic
1099203252 12:79699893-79699915 GTGTTGCATGAGAAGAAAAGAGG - Intergenic
1101377733 12:104185200-104185222 CTGATGCAGATGAAGAAAAGGGG + Intergenic
1102834989 12:116047861-116047883 CTATTGAAAGAGAAAACAAGAGG - Intronic
1103374425 12:120444517-120444539 CTTTTGCAGCAGAAATCAAGAGG + Exonic
1103990690 12:124797343-124797365 CAGTTTCAGGAGCAGAAAAGTGG + Intronic
1109720568 13:66270255-66270277 CTGCTAAAGGAGAAGCCAAGAGG + Intergenic
1109875867 13:68404016-68404038 CTGTTGCTGGAGCAGGCAACTGG - Intergenic
1113031091 13:105994462-105994484 CTGTTGAGGGATAAGACATGTGG - Intergenic
1113667910 13:112153698-112153720 CTGTGGCAGGAGAAAAGAGGAGG + Intergenic
1113668594 13:112159478-112159500 CTGTTTCCCGAGAGGACAAGTGG + Intergenic
1114773236 14:25452790-25452812 GTGTTCCAGGTGATGACAAGAGG - Intergenic
1115203504 14:30877050-30877072 CTTTAGCAGGCCAAGACAAGAGG - Intronic
1116261495 14:42634107-42634129 GTATTGCAGGAGAACACGAGAGG + Intergenic
1118937438 14:70300550-70300572 GTGTTGCAGAAGAAAATAAGGGG + Intergenic
1118970057 14:70628613-70628635 CTGAGGCAGGAGAACCCAAGAGG + Intergenic
1120105876 14:80493819-80493841 CTATAGCAGGAGAAGCCAATAGG + Intronic
1120182080 14:81354076-81354098 GGGTTGCAGGAGAAGCCCAGAGG - Intronic
1121291878 14:92782694-92782716 CTGTGGGAGGAGAATACAGGAGG - Intergenic
1121978166 14:98425691-98425713 CTGTTGCAGGAGAAGAATGAAGG - Intergenic
1122993765 14:105251438-105251460 CTGTTGCAGGAGTGGACTATAGG + Intronic
1123435565 15:20251608-20251630 CTGTTGCATGAGAAGAAGAAAGG - Intergenic
1124617483 15:31252083-31252105 TATTTGCTGGAGAAGACAAGGGG - Intergenic
1124625725 15:31306564-31306586 CGGGTGCAGGAGAGGACAATGGG + Intergenic
1124903026 15:33842194-33842216 CTGTTGGAGGAAAAGAAAAGGGG + Intronic
1125294702 15:38190222-38190244 GTGATGCAGGAGAAGGAAAGGGG - Intergenic
1125716870 15:41824334-41824356 CCGTTGGAAGAGAAGCCAAGAGG + Intronic
1126379793 15:48034659-48034681 GTGTTGCAAGACAAGACATGCGG + Intergenic
1126574002 15:50180548-50180570 CTGTTCAAGGAAAAGAGAAGAGG + Intronic
1126856835 15:52847153-52847175 CAGTTGTAAGAGAAGAGAAGGGG + Intergenic
1126963946 15:54030056-54030078 CTGCTGCAGCAGCAGACAATAGG - Intronic
1127823930 15:62686632-62686654 CTGTTTCAGGAGAAGATGAAAGG + Exonic
1127948401 15:63779625-63779647 CTGTTGTAAGAATAGACAAGTGG - Intronic
1129258484 15:74348242-74348264 CTGCTGAAGGACAAGACAATAGG + Intronic
1131535234 15:93231999-93232021 CTGTTTAGAGAGAAGACAAGAGG + Intergenic
1132387741 15:101412161-101412183 CTGTTGCTGCAGAGGACAAGGGG - Intronic
1133634935 16:7656364-7656386 AGGTTGCAGGAGATGGCAAGGGG + Intronic
1134337455 16:13314066-13314088 CCTTTGCAGTAGAAGAGAAGAGG - Intergenic
1135037391 16:19089608-19089630 CTGCTGCAGGAGTAGCCATGTGG - Intergenic
1136849041 16:33599387-33599409 CTGTTGCATGAGAAGAAGAAAGG + Intergenic
1138144490 16:54596388-54596410 CTGTTGATGGGGAAGCCAAGGGG - Intergenic
1138421319 16:56901137-56901159 CTGATGCAGGAGGAAACCAGTGG - Intronic
1138572165 16:57882647-57882669 CTGTTGCAGGTGGAAACAAATGG + Exonic
1139312742 16:66041018-66041040 TTGTGGAAGGAGAAGAGAAGGGG - Intergenic
1141853832 16:86667404-86667426 CTGCTGCATGAGATGAGAAGGGG - Intergenic
1142133031 16:88439429-88439451 CAGTTGCACAAGAAGTCAAGTGG - Exonic
1203110748 16_KI270728v1_random:1448037-1448059 CTGTTGCATGAGAAGAAGAAAGG + Intergenic
1142842648 17:2645701-2645723 CTGAGGCAGGAGAACCCAAGAGG - Intronic
1143743338 17:8970952-8970974 CTGAGGAAGGAGAAGACAAAAGG + Intergenic
1144222623 17:13113737-13113759 CTCTGCCAGGATAAGACAAGAGG + Intergenic
1145108542 17:20141069-20141091 CAGTGGCAGGAGGAGAGAAGGGG - Intronic
1145241188 17:21241825-21241847 CTGTTGCTGGAGAAGGAATGTGG + Exonic
1145820831 17:27833586-27833608 ATGTTGCGGGAGAAAACCAGTGG - Intronic
1146704451 17:34990705-34990727 TACTTGCAGGAGAAGACAGGAGG - Intronic
1147181833 17:38691349-38691371 CTCTTCCAGGGGAAGCCAAGCGG + Intergenic
1147878690 17:43639848-43639870 CTGAGGCAGGAGAACCCAAGAGG + Intergenic
1148862290 17:50610710-50610732 CTGTTGGAGGAGATGATAACTGG - Intronic
1149393519 17:56215880-56215902 GTGTTGCCGGAGAAGCCTAGAGG + Intronic
1149571250 17:57673987-57674009 CTCCTGCAGGAGAAGGAAAGGGG - Intronic
1152108857 17:78346024-78346046 CTGGATCAGGAGAGGACAAGTGG - Intergenic
1153861890 18:9219600-9219622 CTGTTGAAGGAGAAGAGGAGAGG - Intronic
1154086649 18:11312137-11312159 CTCTTGCAGGATAAGAAAATAGG - Intergenic
1156796229 18:41049435-41049457 CTGAGGCAGGAGAACACAGGAGG + Intergenic
1157499035 18:48177293-48177315 CTTTTGCAGGTGAGGGCAAGTGG - Intronic
1159152871 18:64542729-64542751 GTGTTGGAAGAGAAGAAAAGAGG - Intergenic
1159621669 18:70645805-70645827 TTGTAGCAGGAGAGGAAAAGGGG - Intronic
1160139003 18:76302524-76302546 CTGTTGCACCAGAAGGAAAGGGG + Intergenic
1160916838 19:1500801-1500823 CTGTGGCTGGAGCAGAGAAGGGG + Intergenic
1162807973 19:13148776-13148798 CTGTTGCAGGAGAGGGCTGGGGG - Intronic
1164088343 19:21924697-21924719 ATGTCACAGGATAAGACAAGAGG - Intergenic
1164191415 19:22920727-22920749 ATGTCACAGGATAAGACAAGAGG - Intergenic
1164499015 19:28796747-28796769 CTGTTGGAGGTGCAGACATGAGG + Intergenic
1166927285 19:46277715-46277737 GTGTTGCAGAAGAAAACAAGGGG + Intergenic
1167099275 19:47394031-47394053 GTGTTGCAGAAGAAAACAAGGGG - Intergenic
1167608040 19:50492286-50492308 CTGTGTCAGAAGGAGACAAGGGG - Intergenic
1168439505 19:56351771-56351793 CTGTCGCAGAACAAGAAAAGTGG + Intronic
1168562995 19:57398781-57398803 CTGGTGCTGGAGAAGGCATGAGG - Exonic
1168678287 19:58294950-58294972 CAGGTGCAGGAAAAGGCAAGTGG - Exonic
927905362 2:26851509-26851531 CTATGGCAGGAGAAGAGACGTGG - Intronic
930248806 2:49012611-49012633 CTGAAGCAGGAGATTACAAGGGG - Intronic
930905705 2:56564285-56564307 ATGTTGCAGGAAAAGATATGAGG + Intergenic
931549254 2:63424460-63424482 CTCTTGCAGGAGTGGCCAAGCGG - Intronic
931753325 2:65349888-65349910 CTGTTGCCGGAGGAGACAAAGGG - Intronic
931900872 2:66786384-66786406 ATATTACAGGAGAAAACAAGTGG + Intergenic
932211997 2:69939278-69939300 CTGTTGCAGGTGAACAGGAGAGG + Exonic
933075524 2:77920670-77920692 CTTTTGCAAGTGAAGAGAAGTGG + Intergenic
933245219 2:79967367-79967389 CTTTTGAAGGAGAAGACTACAGG - Intronic
933557045 2:83843631-83843653 CAAGTGCAGGAGAAGATAAGAGG - Intergenic
933731426 2:85459194-85459216 CAGCTGCAGGAAAAAACAAGTGG + Intergenic
934774399 2:96927943-96927965 CTGTGCCAGGAGGAGGCAAGTGG + Intronic
937242656 2:120472327-120472349 CTGTGGCAGGGGAAGAGAAAAGG - Intergenic
937288498 2:120767815-120767837 CTTTTCCAGATGAAGACAAGAGG - Intronic
937360887 2:121229315-121229337 CTATTCCAGGAGAAAAGAAGGGG + Intronic
939072614 2:137561175-137561197 CTGCTGCAGGTGCAGACAACTGG + Intronic
939475436 2:142680701-142680723 CAGTTGCAGGAGAAAGGAAGGGG - Intergenic
940112434 2:150169511-150169533 CTAGGGCAGGAGAAGAAAAGGGG + Intergenic
941203353 2:162541877-162541899 GTGTTGCAGGCTAAGAGAAGAGG + Intronic
942184711 2:173414032-173414054 AAGTTGCAAGAGAAGACATGAGG - Intergenic
942234625 2:173891884-173891906 ATGTTACAGGAGAATAGAAGAGG - Intergenic
942284590 2:174402682-174402704 CTGTTGAAAGAAAAGAAAAGAGG + Intronic
945763447 2:213943768-213943790 ATGTTGCAGGGGAACACAAGGGG + Intronic
946046893 2:216828822-216828844 CTGTTGCAGGAAAAAAAAACAGG - Intergenic
946679893 2:222202382-222202404 CAGTTGCAGAAGAAGGAAAGGGG + Intronic
947311005 2:228802137-228802159 CAATTGGATGAGAAGACAAGTGG - Intergenic
947953200 2:234165399-234165421 CTCCTGGAGGGGAAGACAAGTGG - Intergenic
948240584 2:236429743-236429765 CTGTGGCAGGAGCAGTCATGTGG + Intronic
1169029436 20:2396378-2396400 CTGGGGCAGGAGAGGTCAAGAGG - Intronic
1170308239 20:14963530-14963552 CTGTTTCAGCACAACACAAGTGG - Intronic
1170465560 20:16619447-16619469 CTGCTGAACGAGGAGACAAGAGG - Intergenic
1171435184 20:25116744-25116766 CAGGTGGAGGACAAGACAAGGGG + Intergenic
1173175878 20:40764449-40764471 CAGTGGCTGGAGAGGACAAGTGG + Intergenic
1174066038 20:47866772-47866794 CTGCAGCGGGAGAAGACAGGAGG - Intergenic
1174335812 20:49859785-49859807 CTGTAGCTGGAGAAAACAAAAGG - Intronic
1179286496 21:39982260-39982282 CTGTTACTGGAGAAGGGAAGAGG + Intergenic
1179561135 21:42216959-42216981 CTGTTGCAGGATAAGTGAAAGGG - Intronic
1179646869 21:42781669-42781691 CTGTTCCTGGTGAAGACAGGAGG - Intergenic
951097912 3:18653150-18653172 ATGTTGGAGGAGAAGAGAATGGG - Intergenic
951402057 3:22244989-22245011 CTGATGCAAGAGCAGACAAAAGG - Intronic
952454390 3:33458866-33458888 CTTTTGCAAGAGAACACAATTGG - Intergenic
952498625 3:33938055-33938077 CTGAAGTAGGAGAGGACAAGAGG + Intergenic
952962751 3:38603025-38603047 CTGTTGGAGGAGATGCCACGAGG - Intronic
955061574 3:55496951-55496973 CTGTTGAAGGAGCAAACAACGGG - Intergenic
956015362 3:64876407-64876429 CAGTTGCAGGAGGTGACACGGGG + Intergenic
956747175 3:72319337-72319359 CCGTTGAAAGAGAAGATAAGAGG - Intergenic
957997151 3:87705250-87705272 ATGATACAGCAGAAGACAAGTGG + Intergenic
959880655 3:111441285-111441307 CTGTTGCAGGGGGAGGCTAGGGG - Intronic
962767528 3:138579460-138579482 CTTCTGCTTGAGAAGACAAGAGG + Intronic
963172487 3:142265089-142265111 CTGTTGTGGGAGAAGCCCAGTGG + Intergenic
964666388 3:159178780-159178802 CAGTTGTAGGAGAAAACAGGAGG + Intronic
967166946 3:186789172-186789194 TTGTTACTGAAGAAGACAAGAGG + Exonic
967832560 3:193933005-193933027 CTGTTGCAGGAGGAGAAGAGGGG + Intergenic
967951246 3:194842528-194842550 CTATTGCAGTAGAAGCAAAGAGG + Intergenic
969295642 4:6269538-6269560 CTGTTACAGGAGAAGGCGAGCGG + Intergenic
973153889 4:46923944-46923966 CTGAGGCAGGAGAAGAGATGAGG - Exonic
973690092 4:53419317-53419339 CTGTTGAAGAAGAAGGGAAGGGG + Intronic
974001137 4:56511810-56511832 CTGTGTAAAGAGAAGACAAGAGG - Intronic
974019964 4:56684390-56684412 CTGGCACAGGAGAAGACAAGAGG - Intergenic
974482406 4:62462736-62462758 CTGTTGGAGGAGGAGCCTAGTGG + Intergenic
975293197 4:72701542-72701564 CTGTTGGGGGAGAGGAAAAGAGG - Intergenic
979460289 4:120974649-120974671 CTGTTGCAGATGAAGACAATGGG + Intergenic
979779016 4:124625802-124625824 CTGCTGCAGGAGATGAAGAGTGG + Intergenic
979969893 4:127121627-127121649 AAGTTGCAAGAGAAGATAAGAGG - Intergenic
981430998 4:144659939-144659961 ATCTTGCAGGAGAAAATAAGGGG + Intronic
981747194 4:148063256-148063278 CAGTAGCAGGAGGAGAAAAGGGG - Exonic
982400063 4:154956309-154956331 CTGTTGAAGAAAAAGAGAAGGGG - Intergenic
982643846 4:157997418-157997440 CTGTAGCTAGAGAAGACAAAAGG + Intergenic
984202497 4:176742892-176742914 CAGGTGCTGGAGAAGACAAGTGG + Intronic
985763490 5:1764209-1764231 ACATTGCAGGAGAAGACAACAGG - Intergenic
986302181 5:6486424-6486446 CTGTGGTGGGAGAGGACAAGGGG - Intronic
986668046 5:10120083-10120105 GTATTGCAGGAGAAGACAGAGGG + Intergenic
988085905 5:26475506-26475528 CTGTTTTATGAGAAGACAAAGGG - Intergenic
990280188 5:54242121-54242143 GTGATGCAGGAGAAGAAGAGGGG - Intronic
990674978 5:58173904-58173926 CTAGTGGAGGAGGAGACAAGAGG - Intergenic
990978611 5:61581152-61581174 CTGTAGCATGAGCAGAGAAGAGG + Intergenic
993812094 5:92493128-92493150 GTGTAGGAGGTGAAGACAAGAGG - Intergenic
994078003 5:95674775-95674797 TTGTTGAAGGAGAAGAAAATGGG - Intronic
995695389 5:114873338-114873360 ATGTTGCAGGAATAGAAAAGAGG - Intergenic
995723487 5:115162141-115162163 CAGTTACAGGAGATGAGAAGGGG - Intronic
996821961 5:127639248-127639270 ATGTTGCAAGAGAAAACAACTGG + Intergenic
996833217 5:127763043-127763065 CTATAGAAGGAGCAGACAAGAGG - Intergenic
997126307 5:131230536-131230558 CTGCTGCAGAAGAAAACAAATGG + Intergenic
997588951 5:135061324-135061346 CTGTAGAAAGAGAAGAGAAGAGG - Intronic
997759904 5:136434978-136435000 CTGTTGCTGGAAAAGACCTGAGG - Intergenic
998884776 5:146682908-146682930 TTGAGGCAGGAGGAGACAAGAGG + Intronic
1000128066 5:158266941-158266963 CTGTTGTAGGAGATGAGAAAAGG - Intergenic
1000338320 5:160258269-160258291 CTGTTGCAGCATCAGGCAAGTGG + Intronic
1000859817 5:166443898-166443920 CAGTAGCAGCAGAAGGCAAGAGG - Intergenic
1001110735 5:168894043-168894065 CTTTTTCAGGAAAAGATAAGAGG - Intronic
1001223468 5:169924053-169924075 GGGTGGCAGGAGGAGACAAGGGG - Intronic
1001583892 5:172819820-172819842 GAGCTGCAGGACAAGACAAGGGG - Intergenic
1002091282 5:176808044-176808066 CTGTAGCAGGAGAAAAGATGAGG + Intergenic
1002365335 5:178705438-178705460 TTTTTGCAGGGGAAGACACGGGG - Intergenic
1006614084 6:35312822-35312844 CAGGGGCATGAGAAGACAAGGGG + Intronic
1007553413 6:42746782-42746804 CTAGGGCAGGAGAAGGCAAGGGG + Intergenic
1007618418 6:43196405-43196427 TTGTTGGAGGAGAACCCAAGTGG + Intronic
1009981889 6:70735845-70735867 ATGTTGCAGGGAAAGACAAAGGG - Intronic
1010670679 6:78682634-78682656 CTTTTGCAGCAGAACACAATTGG - Intergenic
1011101956 6:83731999-83732021 CTGTTTCTGGGGAAAACAAGGGG + Intergenic
1012807253 6:103909738-103909760 GTGTTACAGGAGAGGAAAAGAGG - Intergenic
1013586150 6:111580965-111580987 CTGTAGCAGGAGAGGACCAAGGG - Intronic
1013602546 6:111718625-111718647 ATGATGCAGGAGAAAAAAAGAGG - Intronic
1014311719 6:119812097-119812119 CTGTGACTGGAGAAGACAGGAGG - Intergenic
1016064105 6:139661373-139661395 CTTTTGCAGATGAAAACAAGTGG - Intergenic
1016628015 6:146195516-146195538 CTGTTGGAGGAGAAGAGAAGAGG - Intronic
1017054573 6:150425491-150425513 ATGTTGCAAGTGAAGAGAAGGGG + Intergenic
1017628413 6:156371431-156371453 ATGGTGTAGGAGAAGCCAAGCGG - Intergenic
1019797781 7:3064506-3064528 CTGTTGCAGGCAAAGGGAAGAGG + Intergenic
1019881378 7:3864446-3864468 CTGTTGAAGAATAAGACAAAAGG + Intronic
1020017109 7:4837463-4837485 CTGTTGCAGGAGCAGGCCATCGG - Intronic
1021222263 7:17988138-17988160 CTGTTGAAGAAGAAGACGAAAGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022230035 7:28405769-28405791 CTGATGACGGAGAAGAAAAGAGG - Intronic
1026165697 7:67907287-67907309 CTATTGAAGAGGAAGACAAGAGG + Intergenic
1026731250 7:72913627-72913649 CTGGTGCAGGAGAAGAGAGAAGG - Intronic
1033594532 7:142847783-142847805 TTGTGGCAGGAGAAGGGAAGGGG + Intergenic
1033794499 7:144831585-144831607 CTGAGGCAGGAGAAGCCAGGAGG + Intronic
1033880730 7:145880314-145880336 CAGTTTCAGGAGAATAAAAGGGG - Intergenic
1034255448 7:149722399-149722421 CTGTTGCAGGAGAAGACAAGAGG - Intronic
1035674211 8:1443469-1443491 CTCTTGCAGGAGAAGACTGAGGG - Intergenic
1035764364 8:2093909-2093931 CTGCTGCAGGAGAGAAAAAGTGG + Intronic
1035950314 8:4012826-4012848 GTGTTGCACGAGAAGACACACGG + Intronic
1038772033 8:30491675-30491697 CTGGTGCAGAAGAAAAAAAGAGG - Intronic
1039036761 8:33368124-33368146 CTGTTCCAGGAGGATACAAAGGG + Intergenic
1039182818 8:34885418-34885440 CTGTTGAATGAGGAGACAGGAGG - Intergenic
1041302126 8:56422861-56422883 CTTTGGCAGGTGAAAACAAGAGG - Intergenic
1042184018 8:66119291-66119313 CTGATGAAAGAGAAAACAAGAGG - Intergenic
1043741794 8:83823362-83823384 CTTTTGCATGAGAAGAAATGTGG + Intergenic
1044998298 8:97858056-97858078 GTGTTGCAGCAGCAGACAGGAGG - Intergenic
1048070998 8:131020855-131020877 TTATTGCTGGAGAAGACTAGTGG - Intronic
1049558172 8:143294007-143294029 CTGTGGCAGCAGAGGAGAAGCGG - Intronic
1051388744 9:16540269-16540291 TTGTTTCAGGAGAATACTAGGGG + Intronic
1051408920 9:16768937-16768959 CAGTGGCAGGAGAATAGAAGAGG + Intronic
1051997040 9:23229981-23230003 CTGTTGGAGGAAACCACAAGAGG + Intergenic
1052044225 9:23775801-23775823 CTGTTGCAGGTGGAGAAAACAGG - Intronic
1053852394 9:42301951-42301973 CTGTTGCAGGAGAACAATATGGG - Intergenic
1054707672 9:68479545-68479567 CTATTGCAGGTGAGGAGAAGGGG + Exonic
1054916155 9:70497020-70497042 CAGTTGCTGAAGAACACAAGGGG - Intergenic
1055869526 9:80857511-80857533 ATGTTGCTGGAGAAGACAAAAGG + Intergenic
1056637026 9:88339673-88339695 CCGTTGCAGGAGAGGACGTGAGG - Intergenic
1057153756 9:92820389-92820411 ATGTTGCAGGAAGAGAGAAGAGG + Intergenic
1057559776 9:96118094-96118116 CTCATCCAGAAGAAGACAAGTGG + Intergenic
1057569194 9:96190954-96190976 GTGTGGCTGGAGAGGACAAGTGG - Intergenic
1057681680 9:97193356-97193378 ATGTTGCAGGAAGAGAGAAGAGG - Intergenic
1057957231 9:99420440-99420462 CACTTGCAGGAGAAATCAAGGGG - Intergenic
1058168582 9:101650457-101650479 GTGTTGGAGGATAAGACATGTGG + Intronic
1058782481 9:108352293-108352315 ATGTTGGAGGAGAGGACATGTGG - Intergenic
1061292091 9:129656259-129656281 ATGTGGGAGGAGAAGAAAAGGGG + Intergenic
1062281347 9:135753254-135753276 CAGTTGAAAGAAAAGACAAGAGG + Intronic
1186663301 X:11691756-11691778 ATGTTGGAGGAGGAGCCAAGTGG - Intergenic
1187491754 X:19758696-19758718 CTCTTGGAGGAGAAAAAAAGAGG + Intronic
1190058423 X:47195556-47195578 CTACTGCAGTAGAAAACAAGAGG - Intronic
1190234113 X:48602917-48602939 CTGTGGCAGGAGGAGGCCAGAGG - Intronic
1190681845 X:52832774-52832796 TTGTTACTGAAGAAGACAAGAGG - Intergenic
1196184432 X:112730909-112730931 CTGCAGAATGAGAAGACAAGTGG + Intergenic
1196505017 X:116431710-116431732 CTGTGGCAGGAAAAGACAGAAGG - Intergenic
1196594772 X:117532516-117532538 CTGTTTCAGTAAAAGAAAAGGGG - Intergenic
1198329460 X:135608446-135608468 CTGTTGGAGCAGTTGACAAGGGG - Intergenic
1199719519 X:150532470-150532492 CTGTTCCAGGAGCAGAGAACAGG + Intergenic
1200826070 Y:7642865-7642887 CTGTTGGATGTGAAGAGAAGAGG - Intergenic