ID: 1034259934

View in Genome Browser
Species Human (GRCh38)
Location 7:149748700-149748722
Sequence TTGGGCTGGGTTCCCTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034259929_1034259934 -9 Left 1034259929 7:149748686-149748708 CCAACTGGCCCAGCTTGGGCTGG No data
Right 1034259934 7:149748700-149748722 TTGGGCTGGGTTCCCTCTCCTGG No data
1034259926_1034259934 2 Left 1034259926 7:149748675-149748697 CCTGGGGAAGGCCAACTGGCCCA No data
Right 1034259934 7:149748700-149748722 TTGGGCTGGGTTCCCTCTCCTGG No data
1034259923_1034259934 16 Left 1034259923 7:149748661-149748683 CCAAAGTTCAAAATCCTGGGGAA No data
Right 1034259934 7:149748700-149748722 TTGGGCTGGGTTCCCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034259934 Original CRISPR TTGGGCTGGGTTCCCTCTCC TGG Intergenic
No off target data available for this crispr