ID: 1034260526

View in Genome Browser
Species Human (GRCh38)
Location 7:149752667-149752689
Sequence GAACCATGACAGCTTAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034260518_1034260526 19 Left 1034260518 7:149752625-149752647 CCCAACAACTGCAGGCGACATCT No data
Right 1034260526 7:149752667-149752689 GAACCATGACAGCTTAAAGGAGG No data
1034260519_1034260526 18 Left 1034260519 7:149752626-149752648 CCAACAACTGCAGGCGACATCTG No data
Right 1034260526 7:149752667-149752689 GAACCATGACAGCTTAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034260526 Original CRISPR GAACCATGACAGCTTAAAGG AGG Intergenic
No off target data available for this crispr