ID: 1034262304

View in Genome Browser
Species Human (GRCh38)
Location 7:149764732-149764754
Sequence CGGCGCCACCTCGGGGGGAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034262293_1034262304 12 Left 1034262293 7:149764697-149764719 CCTCGTGAGAACTAGGCTCAGAA 0: 1
1: 0
2: 3
3: 22
4: 132
Right 1034262304 7:149764732-149764754 CGGCGCCACCTCGGGGGGAGCGG 0: 1
1: 0
2: 0
3: 9
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034262304 Original CRISPR CGGCGCCACCTCGGGGGGAG CGG Exonic
901056002 1:6448879-6448901 CAGCGCCGCCTGCGGGGGAGCGG - Exonic
901066646 1:6497464-6497486 CGGCCCCGCCTCGGGGGCGGGGG + Intronic
901086112 1:6613457-6613479 CGGCTCGGCCGCGGGGGGAGGGG - Intronic
902142096 1:14365353-14365375 CCCCCCCACCCCGGGGGGAGGGG - Intergenic
902478391 1:16699760-16699782 CTGCGCCGCCTGCGGGGGAGCGG + Intergenic
903034789 1:20486447-20486469 CGAGGGGACCTCGGGGGGAGTGG + Intergenic
903270460 1:22185254-22185276 CTGAGCCCCCTCGGGGAGAGAGG - Intergenic
903555124 1:24187416-24187438 CAGCCCCGCCGCGGGGGGAGGGG + Intronic
903703416 1:25267543-25267565 CAGCTCCACCTCTGGGAGAGGGG - Intronic
903712683 1:25337872-25337894 CAGCTCCACCTCTGGGAGAGGGG - Intronic
904062953 1:27725749-27725771 GGGCGCCACCTGGAGGGGACAGG - Intergenic
912900096 1:113638822-113638844 AGGCTCCACCTCTGGGGGCGGGG - Intronic
915334096 1:155130448-155130470 TGGCTCCACCTTGGGAGGAGGGG + Intronic
915355975 1:155255351-155255373 CGGGGCCGCCTGGTGGGGAGAGG + Exonic
919654713 1:200185908-200185930 AGGCTCCACCTCTGGGGGAAGGG + Intergenic
920379858 1:205529119-205529141 CGGCGCCCCCTGGTGGTGAGAGG - Intronic
922648780 1:227318658-227318680 CTGCGCCAGCCCGAGGGGAGGGG + Intergenic
924527139 1:244863275-244863297 CGGCGCCACCGCGGGCCGACCGG + Intronic
924803206 1:247342925-247342947 GGGCGGCACCTCCCGGGGAGAGG + Intergenic
1069709276 10:70478683-70478705 CGGCCCCACCGCGAGGGGCGGGG - Intergenic
1073297675 10:102450878-102450900 CGGCGCGGCCTCGGGTGGCGCGG + Exonic
1075975433 10:126689940-126689962 CAGCCCCACCTTGGAGGGAGGGG + Intergenic
1076358201 10:129867992-129868014 CGCGGCCACCGCGGGAGGAGAGG + Intronic
1077241571 11:1513092-1513114 CAGTGTCACCTCGTGGGGAGAGG - Intergenic
1077322261 11:1947652-1947674 CGGTGCCCCCGCGTGGGGAGTGG + Intronic
1080540270 11:33257911-33257933 CGCCGCCACCCCGGGGTGGGGGG + Intronic
1080869358 11:36223812-36223834 GGGAGCCACCTCTGGGGGATGGG - Intronic
1081873115 11:46392062-46392084 CGGCGCCCCCTCGCGGGCTGGGG + Intergenic
1082123248 11:48402886-48402908 AGGCTCCACCTCTGGGGGAAGGG + Intergenic
1083617966 11:64035779-64035801 CGCCGCCGCCGCGAGGGGAGAGG + Intronic
1083659757 11:64246643-64246665 CAGCGGCACCGCGGGGGGCGCGG - Exonic
1083667830 11:64285233-64285255 CCGCGCCATCTCGGGGGCACTGG + Intronic
1085047235 11:73360646-73360668 CGGCTCCACCTGGTGGGGAGGGG + Intronic
1085395122 11:76203349-76203371 TGGCCCCACCTCCGTGGGAGTGG + Intronic
1085643741 11:78209510-78209532 CGGGGGCTCCTCGGGCGGAGAGG - Exonic
1086481731 11:87247444-87247466 AGGCTCCACCTCTGGGGGAATGG - Intronic
1088309534 11:108445161-108445183 AGGCTCCACCTCTGGGGGAAGGG + Intronic
1088585623 11:111357829-111357851 CAGCACCACCTAGAGGGGAGAGG + Exonic
1089499141 11:118922575-118922597 CGGCCCCACCCCAGGGAGAGCGG + Intronic
1090817791 11:130314453-130314475 CGGCGGCGGCCCGGGGGGAGGGG + Exonic
1091000924 11:131910524-131910546 CGGTGCCGCCTCGGAGCGAGCGG - Intronic
1091108488 11:132943978-132944000 CGGTGCCGCCTCGGAGCGAGCGG + Intronic
1091220078 11:133925522-133925544 CGGGGCCAGCTCTGGGGCAGCGG - Intronic
1202805279 11_KI270721v1_random:2965-2987 CGGTGCCCCCGCGTGGGGAGTGG + Intergenic
1093781886 12:23146385-23146407 AGGCGCCACCTCTGGGGGCAGGG + Intergenic
1094155500 12:27333300-27333322 CGGCGCGTCCTCCCGGGGAGCGG + Intronic
1094561220 12:31555635-31555657 AGGCGCCACCTCTGGGGGCAGGG - Intronic
1094779413 12:33773408-33773430 AGACGCCACCTCGGGGGGCAGGG + Intergenic
1097264414 12:57737508-57737530 CGCCGCCGCCGCCGGGGGAGGGG - Exonic
1101297086 12:103434928-103434950 AGGCTCCACCTCGGGGGGCAGGG + Intronic
1104917123 12:132271532-132271554 CGGCGTCACCTCGGGGGACAGGG - Intronic
1104957735 12:132474647-132474669 CGGGGTCACCGCGGAGGGAGGGG - Intergenic
1104957872 12:132474968-132474990 CGGGGTCACCGCGGAGGGAGGGG - Intergenic
1104958044 12:132475362-132475384 CGGGGTCACCGCGGAGGGAGGGG - Intergenic
1104958055 12:132475386-132475408 CGGGGTCACCGCGGAGGGAGGGG - Intergenic
1113670986 13:112175942-112175964 CGGCAGCACCTCGGGGGGACAGG + Intergenic
1113671042 13:112176123-112176145 TGGCAGCACCTCGGGGGGACAGG + Intergenic
1113671132 13:112176430-112176452 CGGCAGCACCTCGGGGGGACAGG + Intergenic
1113671150 13:112176490-112176512 CAGCAGCACCTCGGGGGGACAGG + Intergenic
1113758738 13:112832984-112833006 CAGCGCCACCTCGTCGGGCGAGG - Exonic
1116094318 14:40348600-40348622 AGGCTCCACCTCTGGGGGCGGGG + Intergenic
1119430895 14:74567443-74567465 CCGGGCCACCTCAGGGGCAGAGG + Intronic
1121703204 14:95971889-95971911 CGGGGCCCCCACGGGGGGACTGG + Intergenic
1123023693 14:105413743-105413765 CGGCACCACCTCTGTTGGAGAGG - Exonic
1202916093 14_GL000194v1_random:174023-174045 AGGCTCCACCTCGGGGGGCAGGG - Intergenic
1126493467 15:49265161-49265183 AGGCTCCACCTCTGGGGGAAGGG - Intronic
1126777503 15:52112435-52112457 CGGCCCCACCTGGGGCAGAGTGG - Exonic
1128416738 15:67453808-67453830 AGGCGCCACCTCTGGGGGCAGGG - Intronic
1131061486 15:89407399-89407421 AGGCGCCACCTCTGGCGGTGCGG - Intergenic
1132203977 15:99973961-99973983 CGGCGACACCATGGAGGGAGGGG - Exonic
1133802141 16:9092415-9092437 CGGCGCCATCTTGCGGGGAGGGG - Intronic
1134014711 16:10879882-10879904 CTGTGCCACCTAGGGTGGAGAGG - Intronic
1136628843 16:31477594-31477616 GGGCGCGGCCTCCGGGGGAGAGG - Exonic
1138360805 16:56425614-56425636 CGGCGCGACCGCTGGGGGCGGGG - Intergenic
1140686130 16:77435176-77435198 CGGCTCCAGCTCTGAGGGAGGGG + Intergenic
1141315732 16:82961100-82961122 TGGCGCCAGCTCAGGGGGTGTGG - Intronic
1142350100 16:89575835-89575857 CGGCGCCGACTCGCGGGCAGCGG + Exonic
1142859045 17:2749761-2749783 CGGCGCGCGGTCGGGGGGAGGGG + Intergenic
1143165763 17:4896613-4896635 CGGGGCCACCTCGGGGCATGTGG - Intronic
1143447899 17:7019627-7019649 CGTCTCCAACTCGGCGGGAGAGG + Intergenic
1145997698 17:29113940-29113962 GGGCTCCACCACGGGGAGAGGGG + Intronic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1146762404 17:35490048-35490070 CGGCGCCGCTTTGGAGGGAGAGG - Intronic
1148079449 17:44959802-44959824 GCGCGCCACCCCGGAGGGAGCGG + Exonic
1151718316 17:75842694-75842716 CTGAGCCTCCTCCGGGGGAGAGG + Intronic
1152363106 17:79841422-79841444 CAGCTCCACCGCGGAGGGAGAGG + Intergenic
1152608270 17:81303687-81303709 CGGAGCCACCTGGGGAGGGGAGG - Intergenic
1152924552 17:83081051-83081073 CGGAGCCTCCCCGGGGGAAGGGG + Intronic
1155053819 18:22169038-22169060 CGCCGCCGCCGCGGCGGGAGGGG - Intergenic
1156275932 18:35582278-35582300 CGGGTCCTCCTCGGGGGCAGCGG - Intronic
1156843098 18:41632281-41632303 AGGCTCCACCTCTGGGGGCGGGG + Intergenic
1157338274 18:46756852-46756874 GGCCGCCACCTCGGCGGGAGGGG - Exonic
1161852726 19:6746043-6746065 CGGGGCCCCCCAGGGGGGAGAGG - Intronic
1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG + Intergenic
1162954296 19:14089954-14089976 GTGCGCTACCTCGGGGGCAGCGG - Exonic
1163360191 19:16841071-16841093 CAGCTCCTCCTCTGGGGGAGTGG + Intronic
1165914271 19:39248188-39248210 CGGCTCCAGGTCGGGGCGAGGGG - Intergenic
1166809694 19:45507839-45507861 CGGAGCTAGCTGGGGGGGAGGGG - Intronic
1167151556 19:47713305-47713327 TGGCGCCCCCTTGTGGGGAGTGG - Intergenic
1202670369 1_KI270709v1_random:44365-44387 AGGCTCCACCTCGGGGGGCAGGG + Intergenic
1202712410 1_KI270714v1_random:25591-25613 CTGCGCCGCCTGCGGGGGAGCGG + Intergenic
925609889 2:5693618-5693640 CGGCGCGACCTCGGGCGCCGGGG + Exonic
926216940 2:10911765-10911787 CGGCCCCTCCTCGGGCGCAGCGG - Intergenic
926338836 2:11887042-11887064 AGGCTCCACCTCTGGGGGAAGGG - Intergenic
927472117 2:23384923-23384945 GGGGGCCACCGCGGGGGGCGGGG + Intergenic
936156133 2:110048460-110048482 CAGCTCCACCTTGGGGGAAGGGG + Intergenic
936188554 2:110322968-110322990 CAGCTCCACCTTGGGGGAAGGGG - Intergenic
938273902 2:129999012-129999034 AGGCTCCACCTCTGGGGGCGGGG + Intergenic
938534950 2:132231866-132231888 AGGCTCCACCTCTGGGGGAAGGG + Intronic
941020878 2:160407368-160407390 CCGCGCCTCCTCGGAGGGACCGG - Intronic
941905580 2:170714679-170714701 CGGCCCCACCGCGGCGGGCGGGG + Intergenic
941922209 2:170862634-170862656 CAGTGCCAGATCGGGGGGAGGGG - Intergenic
942410479 2:175704320-175704342 AGGCTCCACCTCTGGGGGAAGGG - Intergenic
945429825 2:209751646-209751668 AGGCTCCACCTCTGGGGGAAGGG - Intergenic
946322134 2:218960299-218960321 CGGCGCCACCTGCGGGGCTGGGG - Exonic
948235761 2:236389126-236389148 AGGCTCCACCTCTGGGGGCGGGG - Intronic
948824204 2:240566549-240566571 CGGGGCCTCCTCGGGCGGGGCGG + Intronic
948941092 2:241196952-241196974 TGGGGCCACCACGTGGGGAGTGG - Intronic
948941399 2:241198620-241198642 CGGCCCCACCTTGGGCGAAGTGG - Intronic
1172539233 20:35698526-35698548 TGGCCCCACCTCCGGGGCAGCGG + Exonic
1172951538 20:38726057-38726079 CTGCGCCGCCTGGTGGGGAGTGG - Intronic
1174606835 20:51767734-51767756 CGGGTCCACCCCGGGCGGAGGGG + Intronic
1176635445 21:9188669-9188691 AGGCTCCACCTCGGGGGGCAGGG - Intergenic
1180404792 22:12541680-12541702 AGGCTCCACCTCTGGGGGCGGGG + Intergenic
1181083647 22:20429429-20429451 CGGGGCCACGTCCGGGGCAGGGG + Intronic
1182475538 22:30574636-30574658 CGGCGGCACCTGGCCGGGAGCGG - Intergenic
1182576518 22:31276698-31276720 CAGCGGCACCGCGGGGGGCGCGG + Intronic
1185069506 22:48648313-48648335 CGGAGCCCCCACAGGGGGAGTGG - Intronic
1185139308 22:49091513-49091535 GGCCGCCACCTCGTGGGGCGTGG + Intergenic
1185172486 22:49301957-49301979 CGGGGTCACCTCTGGAGGAGGGG + Intergenic
952744410 3:36764125-36764147 GGGCGCCACCTTGGCGGGGGCGG - Intergenic
952906230 3:38140743-38140765 CGGCGGCACCTAGGGGAGAGTGG - Exonic
954148423 3:48645733-48645755 CAGCCCCACCTCACGGGGAGAGG + Exonic
955427487 3:58807120-58807142 AGGCTCCACCTCTGGGGGCGGGG + Intronic
961375463 3:126462604-126462626 CGGTGGCACCTAGAGGGGAGAGG - Intronic
962080842 3:132137406-132137428 AGGCTCCACCTCTGGGGGAAGGG + Intronic
963061850 3:141232206-141232228 CGGCGCCAGCTCTGGGAGAAGGG - Intronic
966662178 3:182426631-182426653 AGGCTCCACCTCTGGGGGAAGGG + Intergenic
967287896 3:187890741-187890763 AGGCTCCACCTCTGGGGGCGGGG + Intergenic
967565289 3:190964977-190964999 AGGCTCCACCTCTGGGGGCGGGG - Intergenic
968965530 4:3767439-3767461 CGGCTCCACGTCGGCGGGCGGGG - Exonic
970611535 4:17729304-17729326 AGGCTCCACCTCTGGGGGCGGGG + Intronic
973984422 4:56336823-56336845 AGGCGCCACCTCTGGGGGCAGGG - Intergenic
977678188 4:99770906-99770928 AGGCTCCACCTCTGGGGGAAGGG - Intergenic
980923901 4:139115344-139115366 CAGCGGCACCGCGGGGGGCGCGG - Intronic
986379672 5:7171091-7171113 AGGCTCCACCTCTGGGGGAAGGG + Intergenic
988646539 5:33101484-33101506 AGGCTCCACCTCTGGGGGAAGGG - Intergenic
989186426 5:38631186-38631208 AGGCTCCACCTCTGGGGGCGGGG - Intergenic
989972486 5:50541617-50541639 AGGCGCCACCTCTGGGGGTAGGG + Intergenic
990179214 5:53141608-53141630 AGGCGCCACCTCTGGGGGCAGGG + Intergenic
992336446 5:75775077-75775099 AGGCTCCACCTCTGGGGGAAGGG - Intergenic
992889667 5:81192519-81192541 CGGCGCCACCTTGGGGCAACAGG - Intronic
996181597 5:120426675-120426697 AGGCTCCACCTCTGGGGGAAGGG - Intergenic
1000540289 5:162531118-162531140 AGGCTCCACCTCTGGGGGAAGGG - Intergenic
1002539919 5:179899876-179899898 CTGCCCCACCTAGGAGGGAGGGG + Intronic
1006197585 6:32255256-32255278 CGGCGACACCTAGGGCGGCGCGG - Intergenic
1006950683 6:37819471-37819493 CAGCGCAGCCTCCGGGGGAGGGG + Intergenic
1013685003 6:112570454-112570476 CGGTGCCATCACGGGGGGTGGGG - Intergenic
1013803380 6:113971126-113971148 CGGCACCAACTCGCGAGGAGGGG + Exonic
1014120713 6:117721837-117721859 AGGCTCCACCTCTGGGGGAAGGG + Intergenic
1017021454 6:150143261-150143283 CGGCGCCACCCCGGGGGCTTTGG - Exonic
1019923514 7:4177856-4177878 CGGTCCCATCTTGGGGGGAGGGG + Intronic
1024628998 7:51231902-51231924 AAGCAGCACCTCGGGGGGAGGGG + Intronic
1025658235 7:63539744-63539766 AGGCGCCACCTCTGGGGGCAGGG - Intergenic
1026840588 7:73668235-73668257 CGGAGCCACCCCCGGGGGAGGGG + Intronic
1027960510 7:84940026-84940048 CGGCGCCTCCTCCGGGGCCGGGG + Intergenic
1029037049 7:97533102-97533124 AGGCTCCACCTCTGGGGGCGGGG + Intergenic
1029730087 7:102433377-102433399 CGGCGCCTCCTCGGAGAGTGGGG - Intronic
1029896531 7:103989793-103989815 CGGCGGCACCTCGCGCGGCGAGG + Intergenic
1030269125 7:107651918-107651940 AGGCTCCACCTCTGGGGGAAGGG - Intergenic
1031579163 7:123450650-123450672 AGGCTCCACCTCTGGGGGAAGGG - Intergenic
1034262304 7:149764732-149764754 CGGCGCCACCTCGGGGGGAGCGG + Exonic
1038041378 8:23726925-23726947 CGGCGCCACCCGGCTGGGAGCGG - Intergenic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1045305180 8:100951815-100951837 CGCCGCCACCGCGGGGCGAGTGG + Intronic
1048594556 8:135852983-135853005 AGGCTCCACCTCTGGGGGCGGGG - Intergenic
1049816303 8:144604201-144604223 CAGCTGCACCTCGGGGGGTGCGG + Intronic
1051287391 9:15510770-15510792 CGACGCCACCGAGGGGGGGGCGG + Intronic
1051987275 9:23105638-23105660 AGGCTCCACCTCTGGGGGAAGGG + Intergenic
1053029971 9:34767293-34767315 GGGCTCCACCTCTGGGGGAAGGG - Intergenic
1055611774 9:78031576-78031598 CGGCGGCGGCTCGGGGGGCGAGG - Intergenic
1057596119 9:96417654-96417676 CGCCGCCGCCTCGGGAGGTGAGG - Exonic
1059617003 9:115962410-115962432 AGGCTCCACCTCTGGGGGCGGGG - Intergenic
1060465820 9:123903899-123903921 AGGCTCCACCTCTGGGGGAAGGG + Intronic
1060555235 9:124504572-124504594 GGGAGCGACCTCGGGCGGAGAGG + Intronic
1061080115 9:128364953-128364975 GGCCCCCTCCTCGGGGGGAGGGG - Intergenic
1061272022 9:129549217-129549239 CGGCGCCACCTCATGGGGCTAGG - Intergenic
1061458159 9:130713574-130713596 GGGAGCCACCTTGGGGGAAGGGG - Intergenic
1061663859 9:132148825-132148847 AGGGGCCAGGTCGGGGGGAGGGG - Intergenic
1062526024 9:136978452-136978474 CGGGGCCATCTCCGGGGGAGGGG + Intronic
1062526050 9:136978516-136978538 CGGGGCCACCTCCCGGGGCGGGG + Intronic
1062531156 9:137001025-137001047 CGGCGAGACCTCGGGGGCGGCGG + Intergenic
1062531164 9:137001042-137001064 CGGCGGGACCTCGGGGGCGGCGG + Intergenic
1062609959 9:137369195-137369217 CGGGGCCACCACATGGGGAGGGG + Intronic
1187116832 X:16360617-16360639 AGGCTCCACCTCTGGGGGAAGGG + Intergenic
1201051618 Y:9941669-9941691 AGGCTCCACCTCTGGGGGAAGGG + Intergenic
1201359955 Y:13135961-13135983 AGGCTCCACCTCTGGGGGCGGGG - Intergenic
1201614872 Y:15885974-15885996 AGGCTCCACCTCTGGGGGAAGGG + Intergenic
1201627121 Y:16026591-16026613 AGGCTCCACCTCTGGGGGAAGGG + Intergenic