ID: 1034264177

View in Genome Browser
Species Human (GRCh38)
Location 7:149773307-149773329
Sequence TGCAAGGGAGGAGGGACCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 547
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 515}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034264170_1034264177 -8 Left 1034264170 7:149773292-149773314 CCGGGAAACGGCGCCTGCAAGGG 0: 1
1: 0
2: 0
3: 4
4: 106
Right 1034264177 7:149773307-149773329 TGCAAGGGAGGAGGGACCGAGGG 0: 1
1: 0
2: 3
3: 28
4: 515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034264177 Original CRISPR TGCAAGGGAGGAGGGACCGA GGG Exonic