ID: 1034264177 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:149773307-149773329 |
Sequence | TGCAAGGGAGGAGGGACCGA GGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 547 | |||
Summary | {0: 1, 1: 0, 2: 3, 3: 28, 4: 515} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1034264170_1034264177 | -8 | Left | 1034264170 | 7:149773292-149773314 | CCGGGAAACGGCGCCTGCAAGGG | 0: 1 1: 0 2: 0 3: 4 4: 106 |
||
Right | 1034264177 | 7:149773307-149773329 | TGCAAGGGAGGAGGGACCGAGGG | 0: 1 1: 0 2: 3 3: 28 4: 515 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1034264177 | Original CRISPR | TGCAAGGGAGGAGGGACCGA GGG | Exonic | ||