ID: 1034265877

View in Genome Browser
Species Human (GRCh38)
Location 7:149780454-149780476
Sequence GGGGTTACACAGCTGGCGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 165}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034265877_1034265893 16 Left 1034265877 7:149780454-149780476 CCGTGCGCCAGCTGTGTAACCCC 0: 1
1: 0
2: 0
3: 11
4: 165
Right 1034265893 7:149780493-149780515 CATGCTGGGGGTTGGTGGCCAGG No data
1034265877_1034265891 11 Left 1034265877 7:149780454-149780476 CCGTGCGCCAGCTGTGTAACCCC 0: 1
1: 0
2: 0
3: 11
4: 165
Right 1034265891 7:149780488-149780510 TGAGCCATGCTGGGGGTTGGTGG No data
1034265877_1034265890 8 Left 1034265877 7:149780454-149780476 CCGTGCGCCAGCTGTGTAACCCC 0: 1
1: 0
2: 0
3: 11
4: 165
Right 1034265890 7:149780485-149780507 CCTTGAGCCATGCTGGGGGTTGG No data
1034265877_1034265885 1 Left 1034265877 7:149780454-149780476 CCGTGCGCCAGCTGTGTAACCCC 0: 1
1: 0
2: 0
3: 11
4: 165
Right 1034265885 7:149780478-149780500 GGTGGGTCCTTGAGCCATGCTGG No data
1034265877_1034265888 4 Left 1034265877 7:149780454-149780476 CCGTGCGCCAGCTGTGTAACCCC 0: 1
1: 0
2: 0
3: 11
4: 165
Right 1034265888 7:149780481-149780503 GGGTCCTTGAGCCATGCTGGGGG No data
1034265877_1034265894 19 Left 1034265877 7:149780454-149780476 CCGTGCGCCAGCTGTGTAACCCC 0: 1
1: 0
2: 0
3: 11
4: 165
Right 1034265894 7:149780496-149780518 GCTGGGGGTTGGTGGCCAGGTGG No data
1034265877_1034265886 2 Left 1034265877 7:149780454-149780476 CCGTGCGCCAGCTGTGTAACCCC 0: 1
1: 0
2: 0
3: 11
4: 165
Right 1034265886 7:149780479-149780501 GTGGGTCCTTGAGCCATGCTGGG No data
1034265877_1034265895 28 Left 1034265877 7:149780454-149780476 CCGTGCGCCAGCTGTGTAACCCC 0: 1
1: 0
2: 0
3: 11
4: 165
Right 1034265895 7:149780505-149780527 TGGTGGCCAGGTGGTGCCCTTGG No data
1034265877_1034265887 3 Left 1034265877 7:149780454-149780476 CCGTGCGCCAGCTGTGTAACCCC 0: 1
1: 0
2: 0
3: 11
4: 165
Right 1034265887 7:149780480-149780502 TGGGTCCTTGAGCCATGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034265877 Original CRISPR GGGGTTACACAGCTGGCGCA CGG (reversed) Intergenic
901008075 1:6181185-6181207 GGGGTTAGAGAGCTGGCGGTCGG - Intergenic
901373683 1:8822076-8822098 GGGGTTACTTACCTGGCCCAAGG - Intergenic
902741446 1:18441337-18441359 GAGGTTAAACAACTGGCCCAGGG - Intergenic
902786161 1:18734002-18734024 GAGGTTACACAGCTGGTAAACGG + Intronic
902798019 1:18811907-18811929 AGGGTAACCCAGCTGGCACATGG - Intergenic
903284398 1:22267943-22267965 GGGGGTTCTCAGCTGGCCCAGGG + Intergenic
903516068 1:23911837-23911859 GTGGTTACAGAGCTGGGGCCAGG + Intronic
904279631 1:29409690-29409712 GAGGTTACGCAGCTGGGACATGG - Intergenic
904868306 1:33600162-33600184 GGTTTTACACAGCTGGCCCAAGG + Intronic
905395952 1:37666681-37666703 GAGGTCACACAGCTGGTACATGG + Intergenic
906062119 1:42955758-42955780 GGGGTGAGACATCTGGGGCAGGG + Intronic
910388827 1:86715590-86715612 TGGCTTACAAAGCTGGAGCATGG + Intronic
912248902 1:107990777-107990799 GCGGTGACTCAGCTGGCCCATGG - Intergenic
915354358 1:155247309-155247331 GGGGTTACATAGCTTGCCCAAGG + Exonic
915927185 1:160031747-160031769 GGGGCTAAGCAGCTGTCGCACGG - Exonic
916691047 1:167190424-167190446 GGGGTCTCACAGGTGGCCCATGG - Intergenic
917188669 1:172390328-172390350 GAGGTTAAACAGCTTGCCCAAGG + Intronic
917637023 1:176947146-176947168 GAGGTTAATCAGCTGGCCCAAGG - Intronic
920213154 1:204343453-204343475 GGGGTCACACAGCTGGTGAGTGG + Intronic
922609447 1:226913707-226913729 GAGGTTACACAGCTAACACATGG - Intronic
924021159 1:239785085-239785107 GAGGTTGCAAAGCTGGCACATGG - Intronic
924037933 1:239955098-239955120 GGGGCTAGACACCTGGCACAAGG - Intergenic
1065766904 10:29038839-29038861 AGGGCTACACAGCTAGCGAAAGG + Intergenic
1067468982 10:46522778-46522800 AAGGTTACACAGCTGGCAAAGGG + Intergenic
1069839505 10:71330355-71330377 GAGGTTACCCAGCTGGGTCAGGG - Intronic
1069996220 10:72343641-72343663 GGTGTCACACAGCTGACCCAAGG - Intronic
1070276681 10:75013821-75013843 GAGGTCACACAGCTGGTACATGG + Intronic
1070790657 10:79187405-79187427 GAGGTTACACAACTCGCCCAAGG - Intronic
1072205642 10:93203045-93203067 GGAATAACACAGCTGGGGCAAGG + Intergenic
1072717897 10:97763528-97763550 GAGGTCACACAGCTTGCACATGG - Intergenic
1073105870 10:101031820-101031842 GGGGTTACAGAGGGGGAGCAGGG + Intronic
1076258780 10:129049626-129049648 GCGGTCACACAGCTGGTGAAGGG + Intergenic
1081683050 11:45022305-45022327 GGGATCACACAGCTGGCGAGGGG + Intergenic
1081750638 11:45508363-45508385 GAGTTTACACAGCTGGTGAATGG - Intergenic
1083226915 11:61291062-61291084 GGGGTCACACAGCTGGTAAATGG - Intronic
1083882298 11:65554592-65554614 AGGGTCGCACAGCTGGCACATGG - Intronic
1084486855 11:69453293-69453315 GGGGATACAAACCTGGCCCAAGG - Intergenic
1084589651 11:70083355-70083377 GGGGTCACACAGCTGGTGAGTGG + Intronic
1084959629 11:72709733-72709755 GGGGCTCCACAGGTGGGGCAGGG + Intronic
1085430241 11:76441832-76441854 GAGGTTAAATAGCTGGCCCAAGG - Intergenic
1087122658 11:94590943-94590965 AGGGTTACACAGCTGGAGCCAGG - Intronic
1089353467 11:117834687-117834709 CAGGTTACACAGCTGGGGGATGG - Intronic
1090425186 11:126602669-126602691 GCGGATCCACAGCTGGGGCAGGG - Intronic
1092989395 12:13880386-13880408 GGGGATGCTCAGCTGGCGCTCGG + Intronic
1096574982 12:52547159-52547181 GGGGTTACACAGCTGGTAAGTGG - Intronic
1099006724 12:77242934-77242956 AGGGTCACATAGCTGGTGCATGG - Intergenic
1101658823 12:106748156-106748178 AAGGTCACACAGCTGGCACATGG + Intronic
1101791445 12:107931263-107931285 AAGGTTACACTGCTGGCACAGGG - Intergenic
1104048964 12:125183925-125183947 AGAGTCACACAGCTGGGGCATGG + Intergenic
1108550795 13:51541999-51542021 GAGATTACCCAGCTGGCACATGG + Intergenic
1113381735 13:109811374-109811396 GGGGACACACAGCTGGTGCAAGG - Intergenic
1113582145 13:111437444-111437466 GGGGAGCCACAGCTGCCGCAGGG + Intergenic
1115175888 14:30560982-30561004 GAGGTTAAACAGCTTGCCCAGGG - Intronic
1119769458 14:77211320-77211342 GAGGTTAAACAACTGGCTCAAGG - Intronic
1121088345 14:91163719-91163741 AGGGTCACACAGCTGCTGCACGG - Intronic
1129111498 15:73339840-73339862 GGGGTTTCCCAGCTGGCCCCAGG - Intronic
1129604743 15:77019374-77019396 GGGGTTCCACAGCAGCTGCAGGG - Intronic
1129879315 15:78996544-78996566 GGGGTCCCGCAGCTGGAGCATGG + Intronic
1130542830 15:84834218-84834240 AGGGTCACACAGCTGGCAAATGG - Intronic
1130885426 15:88088843-88088865 AGGGTCACACAGCTGGAGAACGG - Intronic
1131831641 15:96358699-96358721 AGGGTCACACTGCAGGCGCAGGG - Intergenic
1134233744 16:12449606-12449628 GGAGATGCACAGCTGGAGCACGG - Intronic
1137540874 16:49360752-49360774 GAGGGCACACAGCTGGCACATGG + Intergenic
1137866563 16:51903163-51903185 GAGGTTACACTGCTGGTACATGG - Intergenic
1138417745 16:56880808-56880830 AAGGTCACACAGCTGGCACATGG - Intronic
1138576125 16:57908380-57908402 GGGGGTAGACAGCTGGACCACGG + Intronic
1141340481 16:83199433-83199455 TGGGTTACACAGCTAGTTCAGGG - Intronic
1143882032 17:10037002-10037024 GGGTTCACACAGCTGGGGCCGGG - Intronic
1144642981 17:16948963-16948985 AGGGTCACTCAGCTGCCGCAAGG - Exonic
1150298048 17:64025161-64025183 GAGGTTACACAACTTGCTCAAGG - Intergenic
1150872603 17:68930061-68930083 GGGGTTACAGAGGTTGCCCAAGG - Intronic
1152591792 17:81217183-81217205 GTGGGCACACAGCTGGGGCAAGG + Intronic
1153265229 18:3262546-3262568 GAGGTCACCCAGGTGGCGCAGGG - Exonic
1153275202 18:3360979-3361001 AAGGTTCCACAGCTGGCTCATGG - Intergenic
1153381884 18:4449472-4449494 GGTGTTACACAGCTTTTGCATGG - Intronic
1153513948 18:5887562-5887584 AGGGTTACACAGCTGGTAAATGG - Exonic
1154449073 18:14460012-14460034 GGGGTTCCACCGCTGCTGCAGGG - Intergenic
1160809758 19:1008280-1008302 GCGGTTACAGAGGTGGGGCAGGG + Exonic
1165059001 19:33195703-33195725 AGGCTCACACAGCTGGGGCAAGG - Intronic
1165798168 19:38531299-38531321 GGGATCACACAGCTTGCGCTGGG - Intronic
1166310177 19:41958408-41958430 GCGGTTAGACAGCTGGGGCTGGG + Intronic
1168301951 19:55409949-55409971 GGGGTTCCCCAGCTGGGACAAGG + Intergenic
1168413671 19:56155684-56155706 GAGGTGACACAGCTGGTTCAGGG + Intronic
927785792 2:25973818-25973840 GGGGTAGAACAGCTGGTGCAGGG + Intronic
928417795 2:31111124-31111146 GGGGCTTCACAGCTGCAGCAGGG - Intronic
931190204 2:59992874-59992896 GGGGTTACACCACTGGCCCAGGG - Intergenic
932420465 2:71598466-71598488 GGGGCCACAAAGCTGGAGCAGGG - Intronic
937368300 2:121280949-121280971 GGGGTCACACAGCTGGAAAATGG + Intronic
940534000 2:154915116-154915138 GAGGTTACAGAGCTTGCCCAAGG - Intergenic
946606285 2:221408835-221408857 GGGGCTACACATCTGGCCCTTGG - Intergenic
948830083 2:240594402-240594424 GGGGCTGCAGAGCTGGGGCACGG + Intronic
1172870499 20:38132599-38132621 GGGGTCACACAGCGGGGGAATGG + Intronic
1173201226 20:40956661-40956683 GGGGTTACACAGCTGGTTGGTGG + Intergenic
1174121517 20:48269278-48269300 AAGGTCACACAGCTGGCACAGGG - Intergenic
1174799536 20:53551637-53551659 AAGGTTATAAAGCTGGCGCATGG - Intergenic
1175788777 20:61728543-61728565 GAGGTTCCACCGCTGGGGCATGG - Intronic
1177905174 21:26965757-26965779 GGGGTTTCGCAGCTGGCGCGCGG + Exonic
1178589666 21:33898675-33898697 GGGGTGACACCGCTGGTGGAAGG + Exonic
1181024291 22:20118975-20118997 GAGGTTACACTGCTGGCCTATGG - Intronic
1181579712 22:23821237-23821259 GGGTGGACACAGCTGGCCCAGGG + Intronic
1182357936 22:29730629-29730651 GGGATGGCACAGCTGGGGCATGG - Exonic
1182444127 22:30380375-30380397 GGCGTTCCACAGCTGCTGCAGGG + Exonic
1182758207 22:32698473-32698495 GGGCTTCCACATCTGGGGCAAGG - Intronic
1183014116 22:34971915-34971937 CAGGTCACACAGCTGGCTCATGG - Intergenic
1184200033 22:42962403-42962425 AGTGTCCCACAGCTGGCGCAAGG + Intronic
1184533879 22:45073273-45073295 GGCTTTGCACAGCTGGCCCATGG + Intergenic
1185246510 22:49775932-49775954 GAGGTTCCACAGCTGGCGGGGGG - Intronic
952314547 3:32221234-32221256 GAGGTTGCACAGCTGGTGGATGG - Intergenic
952314613 3:32221800-32221822 GAGGTTGCACAGCTGGCGGATGG + Intergenic
954063554 3:48088678-48088700 TGGGGTACCCAGCTGCCGCAGGG + Intronic
954442393 3:50528834-50528856 GAGGTCACACAGCTGGAGCTTGG - Intergenic
954766471 3:52922073-52922095 GAGGTTATACAGCTTGAGCAAGG - Intronic
955055514 3:55451937-55451959 GGGGTTAAACAGCTAACACATGG + Intergenic
956737053 3:72246019-72246041 GAGGTTAAACAGCCGGCCCAGGG - Intergenic
960516192 3:118605099-118605121 AGGGTTACACAGCTGGATAAAGG - Intergenic
960610531 3:119551225-119551247 GAGGTTACCCAGCTTGCTCAAGG - Intronic
961035853 3:123641126-123641148 AGGATTACACAGCTGGGGTAAGG - Intronic
961314660 3:126026307-126026329 GGGGGCTCACAGCTGGGGCATGG + Intronic
962317596 3:134368493-134368515 AAGGTTAAACAGCTGGAGCAGGG - Intronic
965572924 3:170189650-170189672 GAGGTCACAGAGCTGGTGCATGG - Intergenic
966942411 3:184755364-184755386 TGGGTCACACAGCTGGCGAGTGG + Intergenic
974047285 4:56908397-56908419 CGGGTTACACAGCAGCCGCCCGG + Intronic
975987365 4:80213796-80213818 AAGGTTACACAGCTGGAGAATGG - Intergenic
977069987 4:92373413-92373435 GGGCTGACACAGCTGGGCCATGG - Intronic
982943239 4:161585205-161585227 TGGGTTTCCCAGCTGGAGCATGG + Intronic
984287750 4:177755206-177755228 GAGGTGACACAGCTGGCGGGTGG + Intronic
988615201 5:32768570-32768592 AGGGTCACACAGCTGGCACACGG - Intronic
991371454 5:65925101-65925123 GGGGAGACAAAGCTGGCGCTGGG - Intergenic
991583314 5:68178697-68178719 GGGATGACTCAGCTGGGGCAAGG - Intergenic
997883214 5:137609121-137609143 GAGGTTAAACAGCTTGCACAGGG - Intergenic
1007357470 6:41332071-41332093 GGGGTGACAGAGCTGGAGAAGGG - Intergenic
1010085586 6:71913832-71913854 GGGGCTACACAGCTGGGGTTAGG + Intronic
1019575557 7:1735944-1735966 AAGGTCACACAGCAGGCGCACGG + Intronic
1020005673 7:4782822-4782844 GGGGGTGCACCGCTGGCGCCTGG - Intronic
1022614790 7:31918393-31918415 GGGGTTACAGAGCTGGCCTGAGG - Intronic
1026445467 7:70480889-70480911 TGAGTTACTCAGCTGGGGCAGGG + Intronic
1026646712 7:72177209-72177231 GGGGCTACACAGTTGCAGCAGGG - Intronic
1026946749 7:74321058-74321080 AGGGTCACACAGCAGGAGCAGGG - Intronic
1026964338 7:74429715-74429737 GGGGTCACACAGCTGGCAAGGGG + Intergenic
1031993071 7:128210466-128210488 GAGGCCACATAGCTGGCGCAGGG - Intergenic
1034265877 7:149780454-149780476 GGGGTTACACAGCTGGCGCACGG - Intergenic
1034652792 7:152705320-152705342 GGGGTTAACCAGCTTGCCCATGG + Intergenic
1036206983 8:6812762-6812784 TGGGTTACAAAGCTGGGGGAAGG + Intronic
1036382833 8:8249485-8249507 TGGGTTCCACATCTGGAGCAGGG + Intergenic
1037809659 8:22080084-22080106 GGCCTTCCACAGCTGGGGCAGGG - Intronic
1038479836 8:27894247-27894269 AGGGTCACACAGCTGCCACATGG + Intronic
1039493073 8:37962301-37962323 GGAGTGTGACAGCTGGCGCACGG + Intergenic
1039876445 8:41590432-41590454 GGGGTTACAGAGCAGGGGCCTGG + Intronic
1039888775 8:41670738-41670760 GGGGTCACACAGGTGGGGAAAGG + Intronic
1041748771 8:61236821-61236843 CAGGTCACAGAGCTGGCGCAGGG + Intronic
1043345428 8:79292264-79292286 GGAGTGACACAGCTGCAGCAGGG + Intergenic
1045379391 8:101608227-101608249 GAGGTTGCACAGCTGGCGCCTGG + Intronic
1046024054 8:108700802-108700824 AGGTTTACACAGCTGGAGCATGG + Intronic
1049429223 8:142551419-142551441 AGGGTCACACAGCTGGGGCCTGG + Intergenic
1050076654 9:1872761-1872783 GAGGTGACACAGCTGTGGCAGGG - Intergenic
1051528649 9:18075720-18075742 GGGGTTACACAGCCCTCCCAGGG - Intergenic
1052861204 9:33439004-33439026 GGGGTGACACAGCTGCTGCCTGG + Intergenic
1054708091 9:68483424-68483446 GGGAACACACAGCTAGCGCAAGG + Intronic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1058391385 9:104499109-104499131 GGGGTTACAGAGCAGCAGCATGG + Intergenic
1059422830 9:114203368-114203390 GGGGCTACAAAGTTGGAGCAGGG - Intronic
1060244129 9:121929779-121929801 GGGGTCACACAGCTGGAGAGGGG - Intronic
1060559747 9:124533193-124533215 GGGTTTGCAGAGCTGGCCCAAGG - Intronic
1060807417 9:126586418-126586440 GGGGTCACACAGCTGGCGAGTGG - Intergenic
1062420038 9:136476275-136476297 GGGGTGACACAGCGAGCACAGGG - Exonic
1062562479 9:137147814-137147836 GGGGCCACACAGCAGGTGCACGG + Intronic
1185770852 X:2764572-2764594 GGTTTTACAAAGCTGGCACAGGG - Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1189285281 X:39847837-39847859 AGGGTTACTCAGCTGTCACATGG + Intergenic
1189393375 X:40597579-40597601 GCGATTACGGAGCTGGCGCAAGG - Exonic
1194914913 X:99694277-99694299 GGGGTTACAAAACTTGCTCAAGG - Intergenic
1196054130 X:111336620-111336642 GAAGATACACAGCTGGCTCATGG + Intronic
1198683836 X:139207106-139207128 GAGGTCACACAGCTGGTACATGG + Intronic
1199820307 X:151439036-151439058 GGGGTTAAACAGCTTGTCCATGG + Intergenic
1200090358 X:153633090-153633112 GGGATTCCACAGCAGGCCCATGG + Intergenic
1201299453 Y:12493237-12493259 GGTTTTACAAAGCTGGCACAGGG + Intergenic
1201674875 Y:16569912-16569934 GTGGTTACGGAGCTGGAGCAGGG + Intergenic