ID: 1034266349

View in Genome Browser
Species Human (GRCh38)
Location 7:149782925-149782947
Sequence CTGCCTTTCTGCTGCTGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 306}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034266344_1034266349 20 Left 1034266344 7:149782882-149782904 CCCTGGATTGGCGCTGAGGGCCT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1034266349 7:149782925-149782947 CTGCCTTTCTGCTGCTGCGCTGG 0: 1
1: 0
2: 1
3: 26
4: 306
1034266345_1034266349 19 Left 1034266345 7:149782883-149782905 CCTGGATTGGCGCTGAGGGCCTC 0: 1
1: 0
2: 0
3: 11
4: 120
Right 1034266349 7:149782925-149782947 CTGCCTTTCTGCTGCTGCGCTGG 0: 1
1: 0
2: 1
3: 26
4: 306
1034266346_1034266349 0 Left 1034266346 7:149782902-149782924 CCTCAGTGTGCGCCGAGCTTCCT 0: 1
1: 0
2: 1
3: 9
4: 70
Right 1034266349 7:149782925-149782947 CTGCCTTTCTGCTGCTGCGCTGG 0: 1
1: 0
2: 1
3: 26
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034266349 Original CRISPR CTGCCTTTCTGCTGCTGCGC TGG Intergenic
900226130 1:1534406-1534428 CTGCCTGGCTCCTGCTGCCCCGG - Exonic
900403054 1:2480521-2480543 CTGCCTCTTTGCAGCTGGGCCGG + Intronic
900609901 1:3540133-3540155 TTGTCTTTCTGTTGCTGGGCTGG + Intronic
900935609 1:5764626-5764648 CTGCCTTGCAGCGGCTGCTCGGG - Intergenic
900972873 1:6001149-6001171 CTTCCTCTGTGCTGCTGAGCTGG + Intronic
901022183 1:6261070-6261092 CCGCCGCTCCGCTGCTGCGCCGG + Intergenic
901622682 1:10601396-10601418 CTGCCTAGCTGCAGCTGAGCTGG - Intronic
901636611 1:10673498-10673520 CTGCCTCTCTCCTGCTGGGGAGG + Intronic
901928427 1:12581787-12581809 CTGCCTTTCTCCCTCTGTGCTGG - Intronic
902772251 1:18652087-18652109 CAGCCTTTCCGCTGCTGCCCGGG - Intronic
903056228 1:20638047-20638069 CTGCCCTTCTCCTGGTGCACTGG - Exonic
903431884 1:23310689-23310711 CGGCCTCTCTGCTGTTGAGCAGG + Exonic
903943310 1:26946311-26946333 CAGCCTTTCTCCTGATGCCCCGG - Exonic
905029244 1:34870474-34870496 CAGCCTTTCTCTTGCTGCCCAGG + Intronic
905108342 1:35577139-35577161 CCCCTTTGCTGCTGCTGCGCGGG - Intronic
905678434 1:39847366-39847388 CTGACTTTTTCCTGCTGGGCTGG - Intronic
905853538 1:41291569-41291591 CTGCCTTTCTGCCTCTGGCCCGG + Intergenic
906284940 1:44581096-44581118 CTGCCTGTCTGGTGCTGATCGGG + Intronic
906689741 1:47784765-47784787 CTTCCTTTCTCCTGCTTTGCAGG + Intronic
907544365 1:55246636-55246658 ATCCCTCTCTGCTGCTGCACAGG - Intergenic
909035750 1:70592424-70592446 CTGCTATTCTACTGCTCCGCAGG + Intergenic
911409805 1:97488884-97488906 CTGCCTCTCAGCTGCTGCTCTGG + Intronic
912392391 1:109313016-109313038 CTGCCTATCTGCTGCTTCTTAGG - Exonic
912449222 1:109759117-109759139 CTGCCTGACTGCTGCTTCCCAGG - Exonic
912550642 1:110483280-110483302 GTGCCATTCTGCAGCTGCCCAGG + Intergenic
912753929 1:112308796-112308818 CTGCCTTTCTCCATCTGAGCTGG + Intergenic
914171896 1:145233211-145233233 GTGCTTTTCTGCTGCGGAGCCGG + Intergenic
915287515 1:154862395-154862417 CTGCCTTTCTCCTCCAGCACTGG - Intronic
917928405 1:179807456-179807478 CTGGCTTTCTCCTGCTCCACTGG - Intronic
919842577 1:201619878-201619900 CTGCCCTTCTTCTGCTGGGTAGG + Intergenic
922463291 1:225829049-225829071 CTGCTTTTCCTCTGCTGGGCAGG + Intronic
922616665 1:226964922-226964944 CTGCCTGTCCCCTGCTGCCCAGG - Intronic
924266816 1:242291019-242291041 CTGCCTCTCTGCAGCTTCACTGG + Intronic
924880194 1:248152574-248152596 CTGGCTTTCTGCTACTTCTCTGG - Intergenic
1063321851 10:5058703-5058725 TAGCGTTTCTGCTGCTGCGTCGG - Intronic
1063381211 10:5587470-5587492 CTGCCTTTCATGTGCTGAGCTGG - Intergenic
1064313531 10:14234094-14234116 CTGCCTGTCTGTGGCTGAGCAGG - Intronic
1064769529 10:18710229-18710251 CTCCTTCTCTGCGGCTGCGCGGG + Intergenic
1064818108 10:19290374-19290396 CTCCCTTTCTCCTGCTCAGCAGG + Intronic
1065034571 10:21624828-21624850 CGGCCTCTCTGCTGTTGTGCAGG + Intronic
1066718005 10:38307484-38307506 CTGCCTCTCTGCAGCTTCACTGG - Intergenic
1067171011 10:43905820-43905842 CTGCATTCCAGCTGCTGTGCTGG + Intergenic
1067265793 10:44743896-44743918 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1068527886 10:58151728-58151750 CAGCTTTTCTGCTTCTGCCCAGG + Intergenic
1073650205 10:105350913-105350935 CTGCAATTCTGCTGCTGAGCAGG + Intergenic
1075056146 10:119220036-119220058 TTGCCTTTCTGCTCATGGGCAGG + Intronic
1075343787 10:121667539-121667561 CTTCCCTTCTTCTGCTGCTCAGG - Intergenic
1075399229 10:122149577-122149599 CTGCCCTTCCCCTCCTGCGCAGG - Intronic
1076121556 10:127940573-127940595 CTGCACCTCTGCTGCTGGGCAGG + Intronic
1076766387 10:132636608-132636630 CTGCCCTTGCGCTGCTGAGCAGG + Intronic
1077065829 11:640586-640608 CTGCGTGCCTGCTGCTGAGCCGG + Exonic
1077113378 11:871837-871859 CCACCTTTCTGCTCCTGCCCAGG + Intronic
1078084068 11:8223329-8223351 CTGCCTGTCTGCTGCAGTTCTGG + Intergenic
1078090076 11:8259594-8259616 CCGCCTTCCTGCTGATGGGCTGG + Intronic
1080690403 11:34552568-34552590 GTGCCTTTCTGCTTCTGTGCAGG - Intergenic
1081789401 11:45772147-45772169 CTGGCTTTCTCCTGCTCCCCAGG + Exonic
1083164537 11:60875398-60875420 CTGCCTTTCTGCAGATGAGGTGG - Intronic
1083221305 11:61254563-61254585 CTGCCTTTCTGCTTGTCCCCAGG - Intergenic
1083400365 11:62419129-62419151 CTGGCTCTCTGCTGCAGCTCCGG + Exonic
1083900497 11:65641071-65641093 CTGCATCGCTGCCGCTGCGCAGG - Exonic
1083938286 11:65881728-65881750 CTTCCCTGCAGCTGCTGCGCTGG - Intronic
1084142186 11:67239970-67239992 CAGCCGTTCTGCTGCAGAGCCGG - Intronic
1084449813 11:69229818-69229840 CCCCCTCTCTGCTGCTGGGCTGG + Intergenic
1085649213 11:78252205-78252227 AGGCATTTCTGCTGCTGGGCAGG + Intronic
1089407119 11:118207038-118207060 GTGCATTTCTCCTGCTGGGCAGG - Intronic
1089775326 11:120831773-120831795 GTGCCTTCCTGCTTCTGCCCAGG + Intronic
1090077155 11:123586754-123586776 CTGCCTTGCCTCTGCTGGGCTGG + Intronic
1090713836 11:129412532-129412554 CTGCCTTTGAGCTGCTGCTCTGG - Intronic
1090988361 11:131793839-131793861 CTACCTTCCAGCTGCTGTGCTGG + Intronic
1091705404 12:2690085-2690107 CTGCCTTGCTTCTGCTGGGAAGG - Intronic
1093966127 12:25328232-25328254 TTGCATTTCTGCTTCTGAGCAGG - Intergenic
1094476727 12:30846208-30846230 CTGCTTTTCAGCTGCTGTGAGGG - Intergenic
1096519967 12:52179442-52179464 CTGCCTTCCTGCTGCTCCCAAGG + Intronic
1099307134 12:80971444-80971466 CTGCCTCTCAGCTGCTACTCTGG - Intronic
1101796052 12:107975285-107975307 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
1102231657 12:111266738-111266760 GTGCTTTTCTACTGCAGCGCTGG + Intronic
1103930063 12:124445316-124445338 CTGCCCCTCTGCGGCTGCCCCGG + Intronic
1103975037 12:124696933-124696955 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1104345385 12:127991864-127991886 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1104621127 12:130313601-130313623 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1104962898 12:132496623-132496645 CTGCTTCCCTGCGGCTGCGCTGG + Intronic
1105443627 13:20435017-20435039 CTAGCTTTCTGCTGCTGCTGTGG - Intronic
1107840117 13:44449161-44449183 CTTCCTTTCTGAGGCTGGGCAGG + Intronic
1108725600 13:53177061-53177083 CAGCCTCTCTGCTGCTGCTCTGG - Intergenic
1111225332 13:85263827-85263849 CTGCCTTTGAGCTGCTACTCTGG + Intergenic
1114639105 14:24207125-24207147 CAGCCTTTCTGCTGCTGGTAGGG + Exonic
1115292957 14:31793585-31793607 GTGCCTTTCTGCAGCTACTCAGG + Intronic
1116186587 14:41606886-41606908 CCGCCTTCATGCTGCAGCGCAGG + Intergenic
1117974116 14:61281020-61281042 CTGCCGCTCTTCTTCTGCGCGGG - Exonic
1118241291 14:64060978-64061000 CTGCCATGCTGCTGCTGCTGGGG + Intronic
1118681949 14:68250849-68250871 CTGCATCACTGCTGCTGCACTGG - Intronic
1120445060 14:84585121-84585143 CTGCCTCTATGTTGCTGCGAAGG - Intergenic
1120769053 14:88358699-88358721 CTGCTTCTCTGATGCTGAGCTGG - Intergenic
1121535362 14:94687034-94687056 CTCCCTTTCAGCTGCAGTGCTGG - Intergenic
1121787454 14:96673197-96673219 CTGCCTCTCTGCTGCAGCCAGGG + Intergenic
1122002695 14:98674801-98674823 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
1122361463 14:101169342-101169364 CTGCCTGTTTGCTGCTGAGTGGG + Intergenic
1122361504 14:101169558-101169580 CGGCCTTGCTGCTGCTGGGTGGG + Intergenic
1122436459 14:101704451-101704473 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1122773620 14:104107776-104107798 CTCCGTCTCTGCTGCTGCTCTGG - Intronic
1122813970 14:104303303-104303325 CTGCCTGTCTGGGGCTGGGCCGG - Intergenic
1122927098 14:104909358-104909380 TTGCCTTTCTGCTTCTGCAGGGG - Intergenic
1202899753 14_GL000194v1_random:28285-28307 CTGACTTTCTGCACCTGCTCCGG + Intergenic
1202860972 14_GL000225v1_random:80604-80626 CTGCCTTTGTGAGACTGCGCTGG - Intergenic
1124075264 15:26438059-26438081 CTGCCTTACTCCAGCTGGGCTGG + Intergenic
1124611920 15:31215208-31215230 ATGCCCTTCTGCTCCTGTGCAGG + Intergenic
1124935504 15:34166357-34166379 CTGCCAGGCTGCTGCTTCGCAGG - Intronic
1129193052 15:73948547-73948569 CTGCTTTTCTGCTTCTGAGTGGG - Intronic
1130236702 15:82141823-82141845 CTGCCTGACTGCTGCTGCATGGG + Intronic
1131298240 15:91171448-91171470 CTGCCTCTCTGCTGCTGCGGTGG + Intronic
1132568514 16:634122-634144 CTGGCTTGCTGCTGCTGGTCGGG + Intergenic
1132959626 16:2614596-2614618 CTGCCTGTGTGCTGCGGTGCTGG + Intergenic
1132972687 16:2696571-2696593 CTGCCTGTGTGCTGCGGTGCTGG + Intronic
1135040786 16:19115201-19115223 CTGCTACTCTGGTGCTGCGCTGG + Exonic
1135457782 16:22613596-22613618 CTGTCTTTCTGCAGCTGCTGGGG + Intergenic
1135603513 16:23802984-23803006 CTGAGTTTCTGCAGCTGCCCTGG + Intergenic
1136022132 16:27446999-27447021 CTGTCTGCCTGGTGCTGCGCTGG + Intronic
1137721178 16:50628364-50628386 CTGCCTGGCTGGGGCTGCGCTGG + Intronic
1138507561 16:57485919-57485941 CTGCCTTCCTGCTCCTCCCCGGG - Intronic
1138579043 16:57927667-57927689 CTGGCTTTCTGCTTGTGAGCTGG - Intronic
1142623107 17:1177410-1177432 CTACCCTCCTGCTGCTGCCCTGG - Intronic
1142782312 17:2190721-2190743 CTGCCTTCTAGCTGCTGCCCTGG - Intronic
1143158572 17:4854122-4854144 GTCCCTTTCTGATGCTGAGCCGG - Intronic
1144299066 17:13906137-13906159 CTGGCCTCCTGCTGCTGGGCTGG + Intergenic
1145969736 17:28949935-28949957 CTGACTTTCTGCAGCTGCCGGGG - Intronic
1145994951 17:29099801-29099823 CTGCCTTTCCTCTGCTGGGCTGG - Intronic
1146066455 17:29639530-29639552 CTGCCTGTCTGCTGCTTGGGTGG + Intronic
1146409645 17:32571383-32571405 CTGCCTTTCTTCTGCTCCCCTGG + Intronic
1146653491 17:34621652-34621674 CTGCCTTCCTGCTGATGACCTGG - Intronic
1148487986 17:48003553-48003575 CTGCCGGGCTGCTGGTGCGCAGG + Intergenic
1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG + Intronic
1151658914 17:75508448-75508470 CTGCCCTCATGCTGCTGGGCCGG - Intronic
1152313150 17:79563043-79563065 CGCCCGCTCTGCTGCTGCGCAGG - Intergenic
1152957752 18:53791-53813 CTGATTTCCTGCTGCTGAGCAGG + Intronic
1153946612 18:10023583-10023605 CTTCCTTTTTGCTCCTGCCCTGG - Intergenic
1153972469 18:10238985-10239007 CTGCCTGCCTCCTGCTGCCCGGG - Intergenic
1155630131 18:27883375-27883397 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
1156180745 18:34601195-34601217 CTGCCTCTCAGCTGCTACTCTGG - Intronic
1156697527 18:39784721-39784743 CTGCCTTTCATCTGCTGGGCTGG - Intergenic
1157479518 18:48044504-48044526 CTGCCTTTGGGCAGCTGGGCTGG + Intronic
1157897062 18:51479205-51479227 CTGCCTTTTAGCTGCTACTCTGG - Intergenic
1158014087 18:52763746-52763768 CTCCCCTTCTGCTCCTGCTCTGG + Intronic
1160152211 18:76404000-76404022 CAGCCTGTCCGCTGCTGCTCTGG - Intronic
1160354582 18:78216181-78216203 CTGTCTTTCAGCTCCTGCACTGG + Intergenic
1164779844 19:30883499-30883521 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1165414533 19:35684183-35684205 CTGCCTCTGTCCTGCCGCGCAGG - Intergenic
1165923902 19:39315262-39315284 TGCCCTTTCTGCTGCTGCTCTGG - Exonic
1166482833 19:43187731-43187753 CTGCCTGCCTGCTGCAGCCCAGG - Intronic
1168291947 19:55361410-55361432 CTGCATGTCTGCTGATGGGCTGG + Exonic
1202647681 1_KI270706v1_random:157253-157275 GGGCCTCTCTGCTCCTGCGCCGG - Intergenic
926164821 2:10514894-10514916 CTGCGTTTCAGCGGCTCCGCAGG + Intergenic
927231111 2:20825073-20825095 CTGCCTTTCAGATGCTACTCTGG + Intergenic
927961713 2:27244338-27244360 CTGCCCTTAGGCTGCTGCCCTGG - Intergenic
928377780 2:30789991-30790013 CTGGGTGTCTGCTGCTGCGGAGG + Intronic
929020873 2:37551963-37551985 ATGCATTTCTGATGCTGAGCAGG - Intergenic
930153768 2:48084390-48084412 CTGCCAGTCTCCTGCTGAGCTGG - Intergenic
931972126 2:67600438-67600460 CTGCCTTTGAGCTGCTACTCTGG - Intergenic
933698757 2:85239290-85239312 CTGCTTCTCTGCTGCTGTGAGGG + Intronic
934890437 2:98063659-98063681 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
935591846 2:104852338-104852360 CTGCCTGGCTGCGGCTGGGCAGG + Intergenic
935672046 2:105564285-105564307 CCGCTGTGCTGCTGCTGCGCTGG - Intergenic
936097789 2:109546296-109546318 CCGCCTTTGTGTTGCTGAGCTGG - Intronic
937332137 2:121038290-121038312 CTGCCTTTCTGCTGCTGAAAGGG + Intergenic
937347612 2:121136258-121136280 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
937948230 2:127361550-127361572 CTGCCTTTCTGAGGATGTGCAGG - Intronic
938133052 2:128733627-128733649 CTGCCTTGATGCTGGTGCCCAGG + Intergenic
940322410 2:152390765-152390787 CAGCCTTTCTCCTGATGCCCTGG - Intronic
942533880 2:176942328-176942350 CTCCCTTTCTGTTGCTGCTCAGG + Intergenic
942678854 2:178455558-178455580 CAGCCTTTCTCCTGATGCCCTGG - Intronic
943261175 2:185665595-185665617 CTGCCTCTGTGCTGCTACTCTGG + Intergenic
944921310 2:204415917-204415939 CTGTCATCCTGCTGCTTCGCAGG + Intergenic
945321198 2:208425523-208425545 CTGCCTTTGAGCTGCTACTCTGG + Intronic
945739754 2:213645340-213645362 CTGCCTTCCTGTGGCTGTGCTGG + Intronic
947078739 2:226371915-226371937 CTATCTTTCTGCTGGTGAGCAGG + Intergenic
947727371 2:232408785-232408807 CTGCCCTGCTCCTGCTGAGCAGG + Exonic
948392956 2:237625954-237625976 CTGCCTGCCAGCTGCTGAGCTGG - Intergenic
948596654 2:239083732-239083754 GTGCCTTCCTGCTGCTGTGTGGG - Intronic
948640936 2:239375671-239375693 CTGCCCTTCTGCTGCGCCACTGG - Intronic
1169980401 20:11378290-11378312 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
1170593168 20:17786625-17786647 CTGCCTTTCTGTTGGTGCTATGG - Intergenic
1171172483 20:23027706-23027728 CTGCCGTGCTGCTCCTGGGCTGG - Intergenic
1171899581 20:30845099-30845121 CTGACTTCCTGCTGTTGAGCAGG - Intergenic
1173103340 20:40107979-40108001 CTTCCTTTGTGCTACTGCACTGG + Intergenic
1174079158 20:47958638-47958660 CTGGCTCTCTGCTGGTGAGCTGG + Intergenic
1174138502 20:48397133-48397155 CTGGCTCTCTGCTGGTGAGCTGG - Intergenic
1175435743 20:58946331-58946353 CTGCAATTCAGCTGCTGCACAGG + Intergenic
1175951098 20:62583793-62583815 CTGCCTCGGTGCTGCTGTGCAGG - Intergenic
1176246371 20:64099154-64099176 TGGCCTCTCTGCTGCTGCGTTGG + Exonic
1176604155 21:8815390-8815412 CTGCCTCTCTGCGTCTGCGCCGG + Intergenic
1176604179 21:8815507-8815529 GGGCCTCTCTGCTCCTGCGCCGG + Intergenic
1176619128 21:9043059-9043081 CTGACTTTCTGCACCTGCTCCGG + Intergenic
1178128126 21:29538310-29538332 CTGCCTTTGTCCTCCTGTGCTGG - Intronic
1178883135 21:36464390-36464412 CTGTTTTTCTGCTGCTGCTTTGG + Intronic
1179480082 21:41671456-41671478 CAGCCTTGCTGCTGCTTCTCTGG - Intergenic
1179889919 21:44330294-44330316 CTGCCATCCTGCTGCTGCTGCGG - Exonic
1180346439 22:11706968-11706990 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180346470 22:11707114-11707136 GGGCCTCTCTGCTCCTGCGCCGG + Intergenic
1180354208 22:11825121-11825143 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180384038 22:12167205-12167227 CTGCCTCTCTGCGCCTGCGCCGG - Intergenic
1181166718 22:20987851-20987873 CTGCCTGTCTGCCTCTGTGCTGG - Intronic
1183098842 22:35570972-35570994 CAGCCTTGCTGCTGCTTCCCTGG + Intergenic
1183337802 22:37260613-37260635 CTGCCTTTCTCCTGGAGCCCTGG + Intergenic
1183636873 22:39069401-39069423 CTGCCTGTCTTCTGCTGGGGAGG - Intronic
1185006974 22:48285054-48285076 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1185199710 22:49494212-49494234 CTGCCTCTCTGCATCTGCCCTGG - Intronic
952163443 3:30719689-30719711 GTTCCTTTCTGCTGATGGGCTGG - Intergenic
952433556 3:33249340-33249362 CTTTCTTTCTGCTTCTGCTCTGG - Intergenic
952452877 3:33448154-33448176 TAGCGTTTCTGCTGCTGCGTCGG + Intergenic
953460171 3:43075954-43075976 CTGGCTTTATGCTGCTGCTGTGG + Intergenic
953656148 3:44856332-44856354 CTGCTATTCTGCTACTCCGCAGG - Intronic
953796821 3:45992304-45992326 CTGCCTCTCTGCACCTACGCTGG - Intronic
953929203 3:46997588-46997610 CTGCTTTTCTGCTGATGCTGCGG + Exonic
953999247 3:47542992-47543014 CTCCCTTTCTTCTGCAGCGAAGG + Intergenic
954109433 3:48425732-48425754 CTGCCTGTCTGCTGAAGCGCTGG - Intronic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
956848024 3:73201912-73201934 CTGCCATTCTGCAGCTGGGAAGG - Intergenic
957415356 3:79895207-79895229 CTGCCTTTGGGCTGCTACTCTGG + Intergenic
957501731 3:81066640-81066662 CTGGCTTTCTCCTGCTACCCAGG + Intergenic
960387337 3:117035986-117036008 CTGCCTCTCTGCTCCTCCCCTGG - Intronic
961027653 3:123573532-123573554 CAGCCCATCTGCTGCTGCTCAGG + Intronic
961372761 3:126441390-126441412 CTGCCCTTCTTCTGCAGGGCTGG - Intronic
961503568 3:127355238-127355260 CTGCCTCTGAGCTGCTGCTCTGG - Intergenic
961685835 3:128630119-128630141 CATCCTTCCTGCTGCTGCCCAGG - Exonic
962172877 3:133121166-133121188 CTGCCTTTCTTTTGCTGGTCTGG + Intronic
962695819 3:137946090-137946112 CTGGCTTTCAGATGCTGCTCTGG + Intergenic
963236614 3:142963196-142963218 CTGCCAAGCCGCTGCTGCGCTGG - Exonic
963260443 3:143186700-143186722 CTGCCTTCCTTCTGCTGCAGTGG - Intergenic
968055602 3:195689580-195689602 CTTCCCTTCAGCTGCTGCTCAGG - Intergenic
968100188 3:195959018-195959040 CTTCCCTTCAGCTGCTGCTCAGG + Intergenic
968577883 4:1376373-1376395 GAGCCTTTCTGCTGCTGTGTCGG + Intronic
969537471 4:7765537-7765559 CTGCCTCTGTGCAGCTGCACTGG - Intronic
969698964 4:8755256-8755278 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
970066590 4:12102048-12102070 CTGCATCTGTGTTGCTGCGCAGG - Intergenic
970368503 4:15385136-15385158 CTGCCTCTCTGTTACTGTGCTGG - Intronic
970817878 4:20179209-20179231 CTGGCTCTCGGGTGCTGCGCTGG - Intergenic
972169923 4:36333611-36333633 CTGCCCTACTGCTGCTCTGCTGG - Intronic
973373962 4:49275530-49275552 CTGCCTCTCTGCGCCTGCGCCGG - Intergenic
973383450 4:49334709-49334731 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
973387057 4:49519723-49519745 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
973754856 4:54064577-54064599 CTGAGTTGCTGCTGCTGCGGCGG - Exonic
975066326 4:70069084-70069106 CTGCCTTTTGGCTGTTGCTCTGG + Intergenic
975895859 4:79089391-79089413 CTGTCTTTATGCTGCTAGGCAGG - Intergenic
977077846 4:92480647-92480669 CTGCCTTTCTTTGGCTGCACTGG + Intronic
977883946 4:102236833-102236855 TAGCGTTTCTGCTGCTGCGTCGG + Intergenic
980173021 4:129312248-129312270 CTGCCTCTCTGCTGCATCCCAGG + Intergenic
980712692 4:136591124-136591146 CTGCCCTACTGTTGCTGAGCTGG - Intergenic
980988716 4:139719525-139719547 CTGGGTATCTGCTGCTGTGCTGG + Exonic
981811361 4:148779544-148779566 CTGCTTTTCTGCTGATGCTATGG - Intergenic
982346594 4:154367102-154367124 CTTCCTTGCTGCGGCTGAGCAGG - Intronic
983279413 4:165661684-165661706 TAGCCTTTCTACTGCTGCACTGG + Intergenic
984285905 4:177728556-177728578 CTGCCCTGCTGATGCTGTGCAGG + Intergenic
985038965 4:185869441-185869463 CTGTCTTTATGCTGCTACCCTGG + Intronic
985503514 5:264357-264379 CTTCCCTTCAGCTGCTGCTCAGG - Intergenic
985754797 5:1707160-1707182 CTGCTTTTCTGCAGGTTCGCTGG + Intergenic
985853958 5:2410691-2410713 CTGCCCTTCTGTGGCTGAGCTGG - Intergenic
986251168 5:6059749-6059771 GTGCCTTTTTGTTGCTGCGTGGG + Intergenic
987911709 5:24155226-24155248 CTGCCTTCCTGTGGCTGAGCTGG - Intronic
991524179 5:67538007-67538029 CTGCCTTTCTCCTGCTGACTCGG - Intergenic
995999650 5:118343575-118343597 CTGCTTTTATGCTGCTGATCAGG + Intergenic
996767726 5:127051414-127051436 CTGCATTCCTGCTGCTGCCCCGG - Intronic
996906699 5:128609021-128609043 CTGCCATGCAGCTGCTGCGGGGG + Intronic
998628088 5:143868333-143868355 CTGCCTGTCTTCTGCTGCAGCGG + Intergenic
999443365 5:151620068-151620090 CTGCCCTCCTGCTGCTGGGGAGG - Intergenic
1000478637 5:161744155-161744177 CTACCTTTCTGTGGCTGTGCTGG + Intergenic
1000775130 5:165410206-165410228 CTGCCTTCGTGCTGCTACTCTGG - Intergenic
1004064897 6:12234320-12234342 GTGTCTTTCTGCTGCTTCTCTGG + Intergenic
1005198298 6:23314386-23314408 CTTCCTTTCTGCTCCTGCATGGG + Intergenic
1006330077 6:33384001-33384023 GTGCCCTGCTGCTGCTGCTCAGG + Intergenic
1007505675 6:42333545-42333567 AAGCCTTTCTCCAGCTGCGCAGG - Intronic
1007809761 6:44477428-44477450 AGGCCTGTCTGCTGCTGGGCTGG - Intergenic
1009349925 6:62661519-62661541 CTGCCATTCTTCTGCTCCTCTGG + Intergenic
1009893796 6:69721715-69721737 CTGCCTTACTGTGGCTGAGCTGG - Intronic
1016239158 6:141908313-141908335 CTGCCTTTCAGCTGCTACTCTGG - Intergenic
1017321966 6:153105011-153105033 CTTCCTTTCTGATTCTGCTCTGG - Intronic
1018273855 6:162108996-162109018 CTGCCTCTGAGCTGCTGCCCTGG - Intronic
1018430140 6:163715760-163715782 CCCCTTTTCTGCTGCTGCCCTGG + Intergenic
1018536368 6:164824961-164824983 CTGCCTTCGAGCTGCTGCTCTGG + Intergenic
1019745648 7:2699271-2699293 TTGCCTAGCTGCTGCTGCTCCGG + Intronic
1020138310 7:5598743-5598765 CATCCTTTCTGCTGCTGGGGTGG + Intronic
1021382448 7:19984145-19984167 CTGTCTTTCTGTGGCTGAGCTGG + Intergenic
1021894380 7:25220344-25220366 CTCCCATCCTGCTGCTGCACCGG - Intergenic
1022716688 7:32905342-32905364 CTGCCTTTGAGCTGCTACTCTGG - Intergenic
1023032684 7:36104521-36104543 CTGCCCATCTGCTGCTGAGGTGG - Intergenic
1024975959 7:55113858-55113880 CTGCCTTCCTGCAGCAGCCCTGG + Intronic
1025022699 7:55492377-55492399 GTGCTTTTCTGCTGCGGAGCCGG - Exonic
1025026369 7:55519664-55519686 CTGTCTTTCTGCAGCTGCAGAGG + Intronic
1026009494 7:66625838-66625860 CTGCCTCTGAGCTGCTACGCTGG + Intergenic
1026222940 7:68416041-68416063 CTGCCTTTGAGCTGCTACTCTGG + Intergenic
1026595495 7:71731203-71731225 CTCCCTTTCTCCTTCTGGGCTGG + Intergenic
1027250599 7:76396441-76396463 CTGCCTCTCAGCTGCTACTCTGG + Intronic
1030246291 7:107387349-107387371 CTGCTTTTCTGCTGCTGGCTGGG - Intronic
1032376551 7:131425313-131425335 CTGCCTTCCTGCTGGTGCATAGG + Intronic
1034266349 7:149782925-149782947 CTGCCTTTCTGCTGCTGCGCTGG + Intergenic
1036442471 8:8793683-8793705 TTGCCTTTGTGCTGCAGAGCAGG + Intronic
1037696301 8:21227214-21227236 CTGCTTTACTGATGCTGGGCTGG - Intergenic
1039888853 8:41671146-41671168 CTGCTTTTCTGCTGCGGCACAGG + Intronic
1041384145 8:57280458-57280480 CTTGCTTTCTGGTGCTGGGCCGG + Intergenic
1041840671 8:62266890-62266912 CTGCCTTTGAGCTGCTCCTCTGG + Intronic
1042743301 8:72075523-72075545 CTGCCTGTGAGCTGCAGCGCGGG - Exonic
1047358521 8:124145801-124145823 CTTGCTTTCTGCTGATGCGGTGG + Intergenic
1047783672 8:128132760-128132782 CTGCCTGACTGCTGCTGACCCGG - Intergenic
1047996193 8:130338792-130338814 CTGACTTCCTACTGCTGCTCTGG + Intronic
1048142519 8:131808434-131808456 ATTCATTTCTGCTGCTGCCCTGG + Intergenic
1049052672 8:140210908-140210930 CAGCCATTCTGCTGCTCCCCAGG + Intronic
1049647135 8:143740536-143740558 CTGCCCTCCTGCTTCTGCGCTGG + Intergenic
1053596500 9:39566999-39567021 CTTCCTTCCTGCTGCTCCACAGG + Intergenic
1053643285 9:40107485-40107507 CTGTCTCTCTGCACCTGCGCCGG - Intergenic
1053762867 9:41358005-41358027 CTGTCTCTCTGCACCTGCGCCGG + Intergenic
1053854465 9:42323639-42323661 CTTCCTTCCTGCTGCTCCACAGG + Intergenic
1054324143 9:63704714-63704736 CTGTCTCTCTGCGCCTGCGCCGG - Intergenic
1054350964 9:64016540-64016562 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054541470 9:66269118-66269140 CTGTCTCTCTGCACCTGCGCCGG + Intergenic
1054569759 9:66798019-66798041 CTTCCTTCCTGCTGCTCCACAGG - Intergenic
1056278393 9:85015696-85015718 CTCCCTTCCTGCTGCAGCTCAGG - Intronic
1056283155 9:85062157-85062179 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1057566891 9:96172778-96172800 CTGCTTTTCTGATGGTGCACAGG + Intergenic
1058104520 9:100955309-100955331 CTGCCTGTCTTCTCCTGAGCTGG - Intergenic
1060219891 9:121758930-121758952 CTGCCGGTCTGCAGCTGAGCGGG + Exonic
1061010803 9:127953591-127953613 CCGCCTTTCAGCTCCTGCACAGG + Exonic
1061012663 9:127964564-127964586 CTGACTTTCTGCTCCTGTGAGGG - Intronic
1062131233 9:134894536-134894558 CTGCCTCTGAGCTGCTGCTCTGG + Intergenic
1203551562 Un_KI270743v1:167545-167567 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1187558245 X:20373847-20373869 CTGCATTTCTGGTGCTGCATAGG + Intergenic
1187759179 X:22561096-22561118 CTGCCATTCTTATGCTGCTCTGG - Intergenic
1188578997 X:31687324-31687346 CTGCCTTTCTGTGGCTGAGCTGG - Intronic
1191675200 X:63785516-63785538 CTGCCTGCCTCCCGCTGCGCTGG + Intronic
1192197335 X:69037180-69037202 CTGCCTTCCTGCTCCTGCAGGGG - Intergenic
1192510945 X:71720005-71720027 GTGTCTTTCTGCTGGTGCGGGGG + Intergenic
1192515752 X:71761548-71761570 GTGTCTTTCTGCTGGTGCGGGGG - Intergenic
1192870206 X:75177306-75177328 TAGCGTTTCTGCTGCTGCGTCGG - Intergenic
1196871188 X:120115333-120115355 CTGCCTTTGTGCTGGTGTGGAGG - Intronic
1200267961 X:154655976-154655998 CTGCCTCTCGGCTGCTGGGGTGG + Intergenic
1201152835 Y:11103151-11103173 CTGACTTTCTGCACCTGCTCCGG + Intergenic
1201520753 Y:14870927-14870949 CTTCCTTTCTGTTACTGAGCTGG + Intergenic