ID: 1034267218

View in Genome Browser
Species Human (GRCh38)
Location 7:149787051-149787073
Sequence CAGCCTCGGTGGCGGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 277}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034267218_1034267228 13 Left 1034267218 7:149787051-149787073 CCAGCCTGCCGCCACCGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 277
Right 1034267228 7:149787087-149787109 TCACAGTCCATCCTGGAGTCTGG 0: 1
1: 0
2: 2
3: 10
4: 202
1034267218_1034267226 6 Left 1034267218 7:149787051-149787073 CCAGCCTGCCGCCACCGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 277
Right 1034267226 7:149787080-149787102 CTGGGCCTCACAGTCCATCCTGG 0: 1
1: 0
2: 2
3: 26
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034267218 Original CRISPR CAGCCTCGGTGGCGGCAGGC TGG (reversed) Intergenic
900269875 1:1781562-1781584 CAGAATTGGTGGGGGCAGGCAGG + Intergenic
900289006 1:1915943-1915965 CAGCAGCAGTGGTGGCAGGCAGG + Intronic
900301430 1:1979956-1979978 CTGCTTCGGTGGTGGGAGGCAGG - Intronic
900559790 1:3298360-3298382 CAGCCTCGCTGTCGGGAGGAGGG + Intronic
900599526 1:3497116-3497138 CAGGCTGGGTGGAGACAGGCAGG + Exonic
900715843 1:4142926-4142948 CAGCCTCCTTAGCTGCAGGCAGG + Intergenic
901066652 1:6497469-6497491 CCGCCTCGGGGGCGGGGGGCGGG + Intronic
901261770 1:7876396-7876418 CAGCATTGGTGGCAACAGGCTGG - Intergenic
901284519 1:8066583-8066605 CAGGTCCGGTGGGGGCAGGCTGG - Intergenic
902218420 1:14949495-14949517 CAGCCACTCTGGTGGCAGGCAGG + Intronic
902377173 1:16035275-16035297 CAGCATCGGCGGCGGCTGCCCGG - Intergenic
902382351 1:16058534-16058556 CAGCATCGGCGGCGGCTGCCCGG - Exonic
903059773 1:20661670-20661692 CAGACTAGGGGGCGGGAGGCCGG - Intergenic
903792686 1:25905847-25905869 CAGCGTGGGTGGCGGCAGGTTGG - Intronic
903994985 1:27300089-27300111 CAGCCCATGTGGGGGCAGGCAGG - Intronic
906038343 1:42766997-42767019 CGGCCTTGGTGGCGGGTGGCTGG - Exonic
906039975 1:42781236-42781258 CAGCCTCTGTGGAAGCAGGGAGG - Intronic
906291451 1:44622228-44622250 CGGCATCGGGCGCGGCAGGCAGG - Intronic
906476285 1:46171617-46171639 CAGCCCCTGGGGCGCCAGGCTGG - Intronic
906532868 1:46533435-46533457 CAGCGCCGGCGACGGCAGGCCGG + Intergenic
909464029 1:75952966-75952988 CAGCCTGGGTGACAGCAGCCTGG - Intergenic
910363127 1:86434956-86434978 CAGCCTGGGTGACAGCAGGGAGG - Intronic
911498831 1:98661694-98661716 CGGCGGCGGTGGCGGCCGGCTGG + Intronic
912459155 1:109819634-109819656 CAGCCTGGATGGCTGCAGCCTGG + Intergenic
913939232 1:125086688-125086710 AAGCCGCGGCGGCGGCAGGGGGG + Intergenic
918047336 1:180949435-180949457 CAGCCGCGGTTGAGGCCGGCGGG + Exonic
919752075 1:201044002-201044024 TGGCCTCAGTGGAGGCAGGCAGG + Intronic
920848570 1:209613150-209613172 CTGCCCCGCTGGCAGCAGGCTGG - Exonic
921023350 1:211256848-211256870 CAGTCTCGCTGTCGCCAGGCTGG + Intergenic
923130546 1:231071143-231071165 CAGCCTCCGTGGCGGGAGAAGGG + Intergenic
1062836167 10:637257-637279 CAGCCTAGGTGGACGAAGGCAGG - Intronic
1065390187 10:25175067-25175089 GAGCGGCGGTGGCGGCAGCCGGG + Exonic
1065883841 10:30059555-30059577 CGGCCTCGGCGGCTGCAGGCGGG - Intronic
1067944994 10:50683637-50683659 GGGCCTGGGTGGTGGCAGGCGGG - Intergenic
1069092961 10:64223875-64223897 CAGTGTTGGTGGCGACAGGCTGG - Intergenic
1069386186 10:67884963-67884985 CAGAGGCGGCGGCGGCAGGCGGG + Exonic
1069571845 10:69498912-69498934 CAGCATTAGTGGAGGCAGGCAGG + Intronic
1069581877 10:69572231-69572253 CCTCCACGGGGGCGGCAGGCTGG - Exonic
1069885905 10:71623440-71623462 CAGCCTCATCGGGGGCAGGCAGG + Intronic
1070777921 10:79120844-79120866 CCACCTTGGTGGAGGCAGGCAGG - Intronic
1070866466 10:79710421-79710443 GGGCCTGGGTGGTGGCAGGCAGG - Exonic
1070866497 10:79710508-79710530 GGGCCTGGGTGGTGGCAGGCGGG - Exonic
1070880287 10:79848639-79848661 GGGCCTGGGTGGTGGCAGGCGGG - Exonic
1071565285 10:86668408-86668430 CCGGCTGGGAGGCGGCAGGCTGG + Intergenic
1071633376 10:87232642-87232664 GGGCCTGGGTGGTGGCAGGCAGG - Exonic
1071633407 10:87232729-87232751 GGGCCTGGGTGGTGGCAGGCGGG - Exonic
1071646825 10:87364860-87364882 GGGCCTGGGTGGTGGCAGGCAGG - Exonic
1071646856 10:87364947-87364969 GGGCCTGGGTGGTGGCAGGCGGG - Exonic
1075089626 10:119436482-119436504 CAGCCAAGGAGGCCGCAGGCAGG + Intronic
1075362467 10:121850947-121850969 CAGGCATGGTGGCGGGAGGCTGG + Intronic
1076496856 10:130903256-130903278 CAGCCTCTGTGGTGGCAGATAGG + Intergenic
1076721436 10:132395140-132395162 AAGGCTGGGTGGCGGCGGGCAGG - Intergenic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1077141571 11:1027111-1027133 CAGCAGCGCTGGCCGCAGGCTGG - Intronic
1077235412 11:1479811-1479833 CAGCCTTGGAGGCTGCAGGCAGG - Intronic
1077514115 11:2991700-2991722 GAGCCTCTGTGGGGTCAGGCTGG - Intronic
1078443742 11:11388584-11388606 CAGACTCAGTGGCGTCAGGCTGG - Intronic
1081047684 11:38296443-38296465 CAAGCTCGGTGCGGGCAGGCTGG + Intergenic
1081772506 11:45658727-45658749 CAGCCTGGCTTGCGGTAGGCGGG + Intronic
1082833848 11:57638474-57638496 CAACCTCGGTCCCGGCCGGCGGG + Intergenic
1083748109 11:64746143-64746165 CAGCCTCGCTGGCCGGGGGCGGG - Intergenic
1083891980 11:65600037-65600059 CAGTCCCAGTGGAGGCAGGCTGG + Intronic
1083934434 11:65862984-65863006 CAGCCCAGCTGGGGGCAGGCAGG + Intronic
1084979717 11:72822595-72822617 CAGCCTGGGTCGCCGCAGGCAGG - Intronic
1085013498 11:73157593-73157615 CAGCCCCGGGGTGGGCAGGCGGG - Intergenic
1089169795 11:116504052-116504074 CTGCCTGGATGGAGGCAGGCGGG - Intergenic
1089358318 11:117870210-117870232 CAGCCCCTGTGCTGGCAGGCAGG - Intronic
1089442903 11:118531240-118531262 CCGCCCCGGTGGCGGGGGGCGGG + Intronic
1093894522 12:24562063-24562085 CATCCCCGGGGGCGGCTGGCCGG - Intergenic
1096100865 12:48969876-48969898 CTGCCTCGCTGGCAGCACGCAGG + Intronic
1096195082 12:49644510-49644532 CAGCCTGGGTGGCAGAGGGCAGG + Exonic
1098180263 12:67839998-67840020 CAGTCACGGTGATGGCAGGCTGG + Intergenic
1102951416 12:117033928-117033950 CAGCCTCGTTAACTGCAGGCAGG + Intergenic
1104846506 12:131849875-131849897 CAGCGTCGATGCCGCCAGGCGGG - Exonic
1105038176 12:132941617-132941639 CAGCTTCGGTGGCTGCTGGGAGG + Intronic
1106407678 13:29488014-29488036 CAGCCTCGTGTGCAGCAGGCAGG + Intronic
1107017176 13:35716871-35716893 AGGCCTCGGTGGCTGCTGGCTGG - Intergenic
1108540793 13:51442839-51442861 CAGCCTCTTTGGCACCAGGCTGG - Intronic
1110008143 13:70297511-70297533 CAGCCTCGGTGGTAGCGGCCTGG + Intergenic
1117029355 14:51652327-51652349 CAGCGGCGGGGGCGGGAGGCTGG + Intronic
1118159743 14:63276201-63276223 CAGCTTCGGTGGGGGGGGGCGGG + Intronic
1120835713 14:89036899-89036921 CAGGCAAGGTGGGGGCAGGCAGG - Intergenic
1121275152 14:92662347-92662369 CAGCCTCGGGGAGAGCAGGCAGG + Intronic
1121352594 14:93185142-93185164 CAGCCTTGGTCGCGGCGTGCCGG + Exonic
1122009851 14:98737079-98737101 CAGCCTGGGAGGAGGCAGGCAGG + Intergenic
1122659726 14:103287306-103287328 CAGCGACGGTGGTGGCAGGAGGG + Intergenic
1122883681 14:104701135-104701157 CAGCAACCGAGGCGGCAGGCAGG - Intronic
1123045756 14:105513117-105513139 CAGCCTGAGCGGCGGCAGCCGGG + Intergenic
1123086850 14:105720804-105720826 TAGCCTCGCTGGAGGCAGGGTGG + Intergenic
1124373732 15:29117524-29117546 CAGCCAAGGGGGCGGGAGGCAGG - Exonic
1129172445 15:73816508-73816530 CAGCCTAGGTGTGGGCAGCCTGG - Intergenic
1131257555 15:90872035-90872057 CAGCCCCGGTGGCGGCGGGGAGG - Intronic
1131480041 15:92772962-92772984 GAGCCTCTGTGGCCGCAGTCTGG - Intronic
1132519182 16:379562-379584 CGGCCTCTGCGGGGGCAGGCAGG + Intronic
1132673013 16:1109462-1109484 CAGCCTCTGAGGCTGCATGCAGG + Intergenic
1132729768 16:1355692-1355714 CTGCCTCGGTGGCGGTGGGAGGG + Intronic
1133784422 16:8963591-8963613 CGGCCCCGGCGGCGGGAGGCGGG - Intronic
1133933722 16:10252390-10252412 CAGCCGCCGCGGCGGCAGCCCGG - Intergenic
1134131117 16:11650915-11650937 GAGCCTAGGTGGCCCCAGGCAGG - Intergenic
1136188910 16:28603986-28604008 CAGCCCAGATGGTGGCAGGCAGG - Intergenic
1137572337 16:49575008-49575030 CATCCTTGGTGGTGGCAGGAGGG - Intronic
1138161437 16:54758524-54758546 CAGCCTGGGTGGACACAGGCTGG + Intergenic
1139576911 16:67847466-67847488 AAGCCCCGGCTGCGGCAGGCGGG - Intronic
1140893906 16:79308405-79308427 CAGCCTGTGTGGCTGCAGGCAGG + Intergenic
1141092096 16:81137409-81137431 GTGCCTCGGTGGCTGGAGGCAGG - Intergenic
1141096872 16:81169163-81169185 CAGCCTTGCTGGCTTCAGGCTGG + Intergenic
1142112901 16:88341615-88341637 GAGCCAGGGTGGCAGCAGGCAGG + Intergenic
1142113766 16:88345825-88345847 CAGCCTCGGTGGGGCCTGGCGGG - Intergenic
1142130344 16:88429197-88429219 TACCCTCGGTGGGGGCAGGCTGG - Exonic
1203070916 16_KI270728v1_random:1073773-1073795 CAGCGGCGGTGGCGGCGGGGGGG + Intergenic
1142855083 17:2724632-2724654 CGGCCTCGTGGGCAGCAGGCGGG + Intergenic
1143125634 17:4639653-4639675 CAGCCCCGGTGGGGCCTGGCGGG + Intronic
1143402843 17:6657170-6657192 CAGCCCCGGTGGGGCCTGGCGGG - Intergenic
1143783962 17:9243328-9243350 CTGCCTCAGTCGCGGCATGCTGG + Exonic
1144022590 17:11250531-11250553 CAGACTCAGTGTCTGCAGGCAGG + Intronic
1144250101 17:13407751-13407773 CACCCTCTGTGGCTGCTGGCAGG + Intergenic
1145045750 17:19614226-19614248 CAGCCTCGGTGGGGGGAAGCAGG + Intergenic
1146062129 17:29613096-29613118 CTGCCTCCGAGGCGGCAGGCAGG + Intronic
1146219836 17:31008724-31008746 CAGCGGCGGAGGCGGCGGGCAGG - Intergenic
1146947421 17:36883469-36883491 CAGCCTCTGTGGTGGGAGGGTGG + Intergenic
1147179101 17:38673829-38673851 GAGCCTCGGGGGCGGCCGGCGGG + Exonic
1147187482 17:38720517-38720539 CAGGGCCGTTGGCGGCAGGCAGG - Exonic
1147258781 17:39197008-39197030 CACGCTCGGGGGCGCCAGGCGGG - Intronic
1148543740 17:48501208-48501230 CAGCCCTGGTGGCGTCAGGTTGG + Intergenic
1150427367 17:65087070-65087092 CAGCCACGCTGGCCCCAGGCGGG + Intergenic
1150508572 17:65724876-65724898 CAGCCTTGGGGGCAGCAGGAGGG - Intronic
1151892188 17:76957356-76957378 AATCTTGGGTGGCGGCAGGCTGG - Intergenic
1152242911 17:79169504-79169526 CAGCCCTGGCGGAGGCAGGCGGG - Intronic
1152296734 17:79471747-79471769 GAGCCTGGGTGGACGCAGGCAGG + Intronic
1152748200 17:82050926-82050948 CAGCCTCGGTGGCACCAGCAGGG - Intronic
1152755981 17:82087248-82087270 CAGCCACTGTGGGGACAGGCTGG + Exonic
1153942531 18:9990404-9990426 CTTCCTCGGAGGCGGCACGCGGG + Intergenic
1156034840 18:32754687-32754709 CAGCCTGGTTGGCAGGAGGCTGG - Intronic
1156224906 18:35094963-35094985 CAGCTTCTGTGGTGGGAGGCAGG + Intronic
1157384313 18:47248362-47248384 CGGCCGCGGTGGCCGGAGGCGGG - Intronic
1157602270 18:48901594-48901616 CAGCCTTGGTGGAGGAAGACAGG - Intergenic
1160790245 19:919740-919762 CAGCCTCGCTGGCCCTAGGCAGG - Intronic
1161645643 19:5451674-5451696 CAGCCAAGGTGGGGGCTGGCGGG + Intergenic
1162145554 19:8610828-8610850 CAGGCCGGGCGGCGGCAGGCGGG - Intergenic
1163320477 19:16571907-16571929 CGGCCTCGGGGGCGGCGGCCGGG - Intronic
1163765367 19:19160715-19160737 CAGCCTGGGTTGCGTGAGGCGGG - Intronic
1164055028 19:21615006-21615028 CAGACGGGGTGGCGGCCGGCCGG - Intergenic
1164157879 19:22607492-22607514 CTGCCTCGGTGGGGCCAGGTAGG + Intergenic
1164431709 19:28194465-28194487 CAGCCTGGGTGGAGGCTGCCTGG + Intergenic
1164534713 19:29076528-29076550 CAGCCTGGGTCGAGGCAGGGCGG - Intergenic
1165961645 19:39539855-39539877 CAGCCCCGGCGGCGGCAGCCAGG - Exonic
1166102105 19:40577012-40577034 CATCCTCGGGGGCGGGAAGCGGG + Intronic
1167526739 19:49988929-49988951 CAGCCTCAGTGGGGGAGGGCGGG + Intronic
1168721908 19:58558819-58558841 CAGCTGCGGTGACGGCGGGCGGG + Exonic
925376244 2:3388172-3388194 CAGCTTCGGTGGCGCCAGCGAGG + Exonic
925397406 2:3545204-3545226 CAGCCAGGGTCGCCGCAGGCAGG + Exonic
926682421 2:15674094-15674116 CAGCCCCGCTGGGAGCAGGCAGG + Intergenic
927694348 2:25230232-25230254 CAGACTGGGGGGCCGCAGGCGGG - Exonic
927786249 2:25977240-25977262 GAGCCTGGGAGGTGGCAGGCAGG + Intronic
929778616 2:44943574-44943596 CAGCCTCGTTGCCGGCAAGTTGG + Intronic
931176379 2:59858931-59858953 CTGCCTTGGTGGTGCCAGGCTGG - Intergenic
932467047 2:71930562-71930584 GAGACTCGGTGGAGTCAGGCAGG + Intergenic
932699872 2:73985136-73985158 CCGCCCCGGAGGCGGCGGGCAGG + Intergenic
932927564 2:75994416-75994438 CAGCCTCAGTGGCCACAGCCTGG + Intergenic
934079118 2:88452460-88452482 CGGCGGCGGTGGCGGCGGGCGGG + Exonic
934503133 2:94874294-94874316 CAGCCTGGCTGCCGGCAGACAGG + Intronic
936713808 2:115162089-115162111 CAGCCTGGGAAGCGGGAGGCGGG - Intronic
937315362 2:120928565-120928587 CTTCATAGGTGGCGGCAGGCGGG - Intronic
938139612 2:128784854-128784876 CAGCCAAGGTAGGGGCAGGCCGG + Intergenic
938875823 2:135530944-135530966 CAGCTTCAGTGGCGGAGGGCGGG - Intronic
940918879 2:159286531-159286553 CAGCGGCGGTGGCGGCAGGTGGG - Exonic
941165126 2:162075623-162075645 CAGCCTCGGTGAAGGAAGTCTGG + Intergenic
942453393 2:176122344-176122366 CGGCCGCGGGGGCGCCAGGCCGG - Intergenic
942497876 2:176558759-176558781 CAGCCTCTCTGCCGGCTGGCCGG - Intergenic
945879617 2:215312218-215312240 CCGCCTTGGCGGCGGCCGGCGGG + Intronic
947585793 2:231355861-231355883 CAGCCTCGTGAGCGGCTGGCAGG - Intronic
948111725 2:235461691-235461713 CAGCATAGGTGGCAGCAGGGTGG - Intergenic
948590992 2:239050040-239050062 CTGCCTCGGCGTCTGCAGGCGGG - Exonic
1168891134 20:1295976-1295998 AAGACTCGGTGCCGGCAGTCAGG + Intronic
1170091519 20:12594188-12594210 CAGCCTCTGTGGGAGCAGCCAGG + Intergenic
1170606439 20:17878360-17878382 CAGCAGCCGTGGAGGCAGGCGGG + Intergenic
1171185214 20:23120050-23120072 AAGCCTGGGCTGCGGCAGGCAGG - Intergenic
1171207324 20:23291073-23291095 CTGCCTCTGTGGAGGCAGGGAGG - Intergenic
1172853148 20:37981165-37981187 CAGTCTCGGTGGCGGCAGCCTGG - Intergenic
1173873789 20:46357352-46357374 CAGGCTCGGTGTCTGCTGGCAGG + Intronic
1174177232 20:48652731-48652753 CAGCCATGGTGCCGGCAGGTAGG + Intronic
1175442749 20:59002707-59002729 CAGGCTGGGTGGCGGCAGGATGG - Intronic
1175795356 20:61767328-61767350 CAGCCCCGGTGGGGGCAGCAGGG - Intronic
1179667662 21:42923714-42923736 CTGCCTCTGTGCCAGCAGGCTGG + Intergenic
1181006482 22:20016171-20016193 CAGCCCGAGGGGCGGCAGGCCGG - Intronic
1181009093 22:20029775-20029797 CAGCCTCTGTGCAGGGAGGCCGG - Intronic
1181265390 22:21628219-21628241 CAGCCTTCTTGGCTGCAGGCAGG - Exonic
1182045506 22:27270992-27271014 CAGCAGCGGGGGAGGCAGGCAGG - Intergenic
1183407868 22:37639419-37639441 CAGCCCCGGTGGCGGGAAGCAGG - Intronic
1183542482 22:38437452-38437474 CTCCCTCAGTGGCGGCAGGTGGG + Intronic
1183600246 22:38835758-38835780 CAGCCTCTGTGGCTGTGGGCAGG + Intronic
1184190992 22:42894268-42894290 CAGTCTCGCTGTCGTCAGGCTGG + Intronic
1184937530 22:47735937-47735959 TAGCCTAGGTGGAGACAGGCAGG + Intergenic
1185212325 22:49577318-49577340 CAGGCTCCGTGGGGGCACGCTGG - Intronic
1185212336 22:49577368-49577390 CAGGCTCCGTGGGGGCACGCTGG - Intronic
950015029 3:9749428-9749450 CAGCAGCTGTGGCGGCCGGCGGG + Intergenic
952326290 3:32323178-32323200 CAGCCTGGCTGGGGGCAGGAAGG + Intronic
953404658 3:42654473-42654495 GAGCCTCGGGCGCGGCGGGCGGG - Intronic
954347650 3:50013636-50013658 GAGCCTCGCTGTCGCCAGGCTGG - Intronic
954843465 3:53533666-53533688 CAGCCGTGGAGGAGGCAGGCTGG - Intronic
961683341 3:128613484-128613506 CAGCCTCAGTGGAGGGAGGGAGG - Intergenic
962827950 3:139113844-139113866 CAGCCTCCCTGACGGCAGGCAGG - Intronic
963015951 3:140823969-140823991 CTGCCTCAGTGGTGGCAGACAGG - Intergenic
966734625 3:183179255-183179277 GAGCCTCGGCGGCGGCAGAAAGG - Exonic
973292366 4:48483406-48483428 CGGCGTCGGGGGCGGCGGGCCGG - Exonic
976221372 4:82759228-82759250 CAGCCACAGTGGCAGCTGGCGGG + Intronic
978490066 4:109302788-109302810 CAGCAGCGGGAGCGGCAGGCCGG - Intergenic
980993356 4:139757901-139757923 CAGCCACGGTGATGGCAGGGAGG - Intronic
982170313 4:152655555-152655577 CAGCGCTGGTGGCTGCAGGCAGG - Intronic
983216621 4:165008107-165008129 CAGCCCCAGTGGGGGCAGGTGGG + Intergenic
984880727 4:184407937-184407959 CAGCCTCCGTGGAAGAAGGCTGG - Intronic
985142942 4:186861895-186861917 CAGCCTCAGAGGTGGAAGGCTGG - Intergenic
985719432 5:1481487-1481509 CAGCCTCAGTGCCGCCGGGCAGG + Intronic
985986774 5:3522658-3522680 TGGCCTTGGTGGCAGCAGGCAGG - Intergenic
987193274 5:15500465-15500487 CACCCCCGGTGGCTCCAGGCGGG - Exonic
988066162 5:26230316-26230338 CAGCCTCGGTGTCCCCACGCTGG + Intergenic
989451137 5:41587894-41587916 CAGCCCCTGTGGCGTCATGCGGG - Intergenic
992164036 5:74031081-74031103 CAGCCCCGGTGGGGGGAGACTGG - Intergenic
998142972 5:139710129-139710151 CAGCCTGGGGCGCGGCGGGCGGG - Intergenic
1002047316 5:176549381-176549403 TCGCCACGGAGGCGGCAGGCAGG - Intronic
1003152984 6:3568530-3568552 CCCCCTCGGGGGAGGCAGGCAGG + Intergenic
1003566869 6:7229718-7229740 CAGGGGCGGTGGCGGCAGGCTGG - Exonic
1006079470 6:31557014-31557036 CTGCCTTGGTGGCTGGAGGCAGG + Intronic
1006372259 6:33652376-33652398 CAGACTCGGGGTGGGCAGGCTGG - Intronic
1006472513 6:34236751-34236773 CAGCGGCGGCGGCGGCTGGCGGG + Intergenic
1007585162 6:42984831-42984853 CAGCCGCGGGGGCGGAGGGCTGG - Intronic
1010141923 6:72622254-72622276 CAGCGGCGGCGGCGGCGGGCGGG + Exonic
1012199935 6:96393428-96393450 CAGCCTTGGTGGAGGAAGGGGGG - Intergenic
1014272563 6:119349919-119349941 CAGCCTCGGCGGGGCCCGGCCGG + Intergenic
1015499506 6:133917955-133917977 GAGCCTCTGTGGCCTCAGGCAGG - Intergenic
1015625928 6:135181173-135181195 CAGCCCCGCGGGCGGCAGCCAGG + Intergenic
1015919031 6:138248327-138248349 CAGCCTCGCCGGTGGCAGCCAGG + Intronic
1017177501 6:151518569-151518591 CAGCCTCGAGGGCTGCTGGCTGG + Intronic
1018762541 6:166904402-166904424 CAGCAGCCGTGGGGGCAGGCGGG - Intronic
1018826917 6:167415464-167415486 CAGGCACGGAGGGGGCAGGCAGG + Intergenic
1018920041 6:168166110-168166132 CAGCCTGGGTGGCTGTGGGCAGG + Intergenic
1019230307 6:170554715-170554737 CTGGCTGGGCGGCGGCAGGCGGG + Intronic
1019289927 7:245438-245460 CAGCCTTGGTGGAGGAAGCCTGG + Intronic
1019304874 7:328556-328578 CAGCCTGGGTGGGGACAGGTGGG - Intergenic
1019496101 7:1341323-1341345 CAGCTGCAGTGGGGGCAGGCAGG + Intergenic
1019620546 7:1989777-1989799 CAGCCTCAGTGTAGGCCGGCTGG + Intronic
1019733388 7:2639163-2639185 CAGCATCCGTGGAGGCAGGTGGG + Intronic
1023940919 7:44767966-44767988 CAGGCTGGGTGGGGGCAGGCAGG - Exonic
1023999270 7:45180232-45180254 CACCCTGGGTGGAGGCAGCCTGG + Intronic
1026786284 7:73303702-73303724 AGGCCTCGGTGGGGCCAGGCAGG + Exonic
1026841272 7:73671157-73671179 CAGCCGAGGTGGGGGCCGGCTGG - Exonic
1026879203 7:73897952-73897974 GAGCCTGTGTGGCAGCAGGCTGG - Intergenic
1026922484 7:74166405-74166427 CATCTTCCATGGCGGCAGGCAGG + Intergenic
1026923729 7:74174525-74174547 CAGCCGGGGCGGCGGGAGGCGGG + Intronic
1027390276 7:77696898-77696920 CAGCGGCGGCGGCGGCGGGCAGG - Exonic
1028585558 7:92447860-92447882 CAGGCTCGGGGGCGGCTGGAGGG + Exonic
1030370798 7:108696861-108696883 CAGTCTCGCTGTCGCCAGGCTGG - Intergenic
1030754695 7:113273219-113273241 CAGCCTCTGTGGCTCCAGCCGGG - Intergenic
1031934391 7:127721360-127721382 CAGCCTCGGTGGTCGGATGCTGG - Exonic
1032163728 7:129529722-129529744 CTGCCTCTATGGCTGCAGGCAGG + Intergenic
1032455542 7:132070682-132070704 CAGCCTGGGTGGCGGAGGGGAGG - Intergenic
1034267218 7:149787051-149787073 CAGCCTCGGTGGCGGCAGGCTGG - Intergenic
1035225767 7:157431288-157431310 CAGCCTCGCTGCCCCCAGGCTGG - Intergenic
1035680336 8:1483107-1483129 CACGCTCGGTGCCGGCAGGAAGG + Intergenic
1035787735 8:2275613-2275635 CAGCCTCTGTGGGGCGAGGCCGG - Intergenic
1035805076 8:2446103-2446125 CAGCCTCTGTGGGGCGAGGCCGG + Intergenic
1037902084 8:22694364-22694386 CAGCCTCTGTGGCCACAGGATGG + Intergenic
1037928752 8:22865211-22865233 CAGCCTGGGGGGCGGCGGGAGGG + Intronic
1040486682 8:47879604-47879626 CAGCCTCACTGGAGGCAGTCTGG - Exonic
1042325149 8:67520550-67520572 CAGTCAGGGTGGTGGCAGGCAGG + Intronic
1044738270 8:95301042-95301064 CAGCCTAGGTGAGGACAGGCGGG + Intergenic
1045367947 8:101493653-101493675 CCACCTCGGACGCGGCAGGCGGG + Intronic
1046754951 8:117963257-117963279 CAGGCTCAGTGGCAGCAAGCTGG - Intronic
1049046847 8:140159134-140159156 CAGGCTTGGCGGCGGCGGGCGGG - Intronic
1049410469 8:142471755-142471777 CCGCCTCTGTGGCGGGAGGAAGG + Intronic
1049435801 8:142585686-142585708 GAGCCTCGCTGGGGGGAGGCGGG + Intergenic
1049550377 8:143255101-143255123 CAGCCTCTCTAGCAGCAGGCAGG + Intronic
1049555085 8:143277642-143277664 CAGCCTCGGAGGAGCCAGGCTGG - Intergenic
1049815064 8:144595394-144595416 CAGCCTCGGGCACGGCGGGCCGG - Intronic
1051196206 9:14565150-14565172 CAGCCCCAGTGGTGGGAGGCAGG + Intergenic
1055754483 9:79543218-79543240 GAACCTGGGTGGAGGCAGGCAGG + Intergenic
1056975160 9:91246048-91246070 CAGATTCGGTGGAGGCAGCCTGG + Intronic
1057287102 9:93765533-93765555 CTGCCTCAGTAGCAGCAGGCAGG - Intergenic
1057353982 9:94320532-94320554 GGGCCTGGGTGGTGGCAGGCAGG + Exonic
1057605018 9:96492841-96492863 CAGCCTGGGAAGAGGCAGGCTGG + Intronic
1057653783 9:96937103-96937125 GGGCCTGGGTGGTGGCAGGCAGG - Exonic
1057805804 9:98218926-98218948 CCGCCTGGCTGGGGGCAGGCAGG + Intronic
1060208910 9:121698901-121698923 CAAGCTCGGAGGCGGCAGGGAGG + Intronic
1060602412 9:124886993-124887015 CTGCCTCCATGGCTGCAGGCAGG + Intronic
1060666208 9:125433550-125433572 CAGCATCGGTGCCTGCAGCCGGG - Intergenic
1060950483 9:127599016-127599038 CAGCCTACTTGGCGGCAGACTGG - Intergenic
1061361138 9:130143102-130143124 GAGCCTGGGTGGGGGCAGGGAGG - Intergenic
1061464704 9:130768489-130768511 CAGCCTAGCTGGGGGCAGGGTGG - Intronic
1061950371 9:133932745-133932767 CAGGCTCGGTGGAGCCAGGCGGG - Intronic
1062333013 9:136052770-136052792 CAGCCTGTGTGGCCGCAGCCAGG - Intronic
1062416920 9:136455851-136455873 CAAGCGCGGTGGTGGCAGGCGGG - Intronic
1062518523 9:136947734-136947756 CGGCCTGGGTGGGGGCAGGGAGG + Intronic
1186739076 X:12498105-12498127 CAGCTTCGGTGGTGCCAGCCTGG + Intronic
1187688466 X:21839882-21839904 CAGCCCGGGAGGCGCCAGGCAGG - Intronic
1189114282 X:38327306-38327328 CCGCGCCGGTGGCGGAAGGCCGG - Intronic
1189291064 X:39886444-39886466 CAGCCTCTGTGTTGGCTGGCTGG + Intergenic
1192140060 X:68639302-68639324 TAGCCACTGTGGCGGGAGGCAGG + Intergenic
1194764885 X:97838183-97838205 CAGCCTGGGTGACGTGAGGCAGG - Intergenic
1194807285 X:98344954-98344976 CAGTGTCAGTGGCTGCAGGCAGG + Intergenic
1195485068 X:105395287-105395309 CAGCCTCAGAGGGGGCAGACTGG - Intronic
1195884427 X:109624675-109624697 CAGCCTCGGCGTCGGCGGTCAGG + Exonic