ID: 1034267437

View in Genome Browser
Species Human (GRCh38)
Location 7:149788042-149788064
Sequence GCTTCTCCTGTCCCACAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034267432_1034267437 23 Left 1034267432 7:149787996-149788018 CCAATGCTAAATCCTGCCACTGC No data
Right 1034267437 7:149788042-149788064 GCTTCTCCTGTCCCACAAGACGG No data
1034267430_1034267437 25 Left 1034267430 7:149787994-149788016 CCCCAATGCTAAATCCTGCCACT No data
Right 1034267437 7:149788042-149788064 GCTTCTCCTGTCCCACAAGACGG No data
1034267436_1034267437 1 Left 1034267436 7:149788018-149788040 CCACAGGCTCAGCTTCTTGAAAG No data
Right 1034267437 7:149788042-149788064 GCTTCTCCTGTCCCACAAGACGG No data
1034267434_1034267437 11 Left 1034267434 7:149788008-149788030 CCTGCCACTGCCACAGGCTCAGC No data
Right 1034267437 7:149788042-149788064 GCTTCTCCTGTCCCACAAGACGG No data
1034267431_1034267437 24 Left 1034267431 7:149787995-149788017 CCCAATGCTAAATCCTGCCACTG No data
Right 1034267437 7:149788042-149788064 GCTTCTCCTGTCCCACAAGACGG No data
1034267435_1034267437 7 Left 1034267435 7:149788012-149788034 CCACTGCCACAGGCTCAGCTTCT No data
Right 1034267437 7:149788042-149788064 GCTTCTCCTGTCCCACAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034267437 Original CRISPR GCTTCTCCTGTCCCACAAGA CGG Intergenic
No off target data available for this crispr