ID: 1034267515

View in Genome Browser
Species Human (GRCh38)
Location 7:149788415-149788437
Sequence CCTCCACACAGGCCACCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 311}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034267515_1034267526 29 Left 1034267515 7:149788415-149788437 CCAGGTGGTGGCCTGTGTGGAGG 0: 1
1: 0
2: 4
3: 18
4: 311
Right 1034267526 7:149788467-149788489 CACGGTGTGTAGAGTGACAAAGG 0: 1
1: 0
2: 0
3: 6
4: 65
1034267515_1034267520 -4 Left 1034267515 7:149788415-149788437 CCAGGTGGTGGCCTGTGTGGAGG 0: 1
1: 0
2: 4
3: 18
4: 311
Right 1034267520 7:149788434-149788456 GAGGGCTGCTTCTGCCCCGAGGG 0: 1
1: 0
2: 5
3: 30
4: 331
1034267515_1034267527 30 Left 1034267515 7:149788415-149788437 CCAGGTGGTGGCCTGTGTGGAGG 0: 1
1: 0
2: 4
3: 18
4: 311
Right 1034267527 7:149788468-149788490 ACGGTGTGTAGAGTGACAAAGGG No data
1034267515_1034267521 -3 Left 1034267515 7:149788415-149788437 CCAGGTGGTGGCCTGTGTGGAGG 0: 1
1: 0
2: 4
3: 18
4: 311
Right 1034267521 7:149788435-149788457 AGGGCTGCTTCTGCCCCGAGGGG 0: 1
1: 0
2: 7
3: 42
4: 215
1034267515_1034267524 11 Left 1034267515 7:149788415-149788437 CCAGGTGGTGGCCTGTGTGGAGG 0: 1
1: 0
2: 4
3: 18
4: 311
Right 1034267524 7:149788449-149788471 CCCGAGGGGACTCTGCTGCACGG 0: 1
1: 0
2: 1
3: 15
4: 156
1034267515_1034267519 -5 Left 1034267515 7:149788415-149788437 CCAGGTGGTGGCCTGTGTGGAGG 0: 1
1: 0
2: 4
3: 18
4: 311
Right 1034267519 7:149788433-149788455 GGAGGGCTGCTTCTGCCCCGAGG 0: 1
1: 1
2: 4
3: 39
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034267515 Original CRISPR CCTCCACACAGGCCACCACC TGG (reversed) Intergenic
900171498 1:1271253-1271275 TCTCCCCTCAGGCCAACACCTGG + Intronic
900228669 1:1544854-1544876 CCTCCTCACCTTCCACCACCTGG + Exonic
900535029 1:3172628-3172650 CGGCGACACACGCCACCACCTGG + Intronic
900898764 1:5502935-5502957 CCTCCACACTGGCCATAACTAGG + Intergenic
901137997 1:7009994-7010016 CTTCCACACTGGCCGGCACCTGG - Intronic
901324945 1:8360425-8360447 CCCCCCTACAGGCCTCCACCAGG - Exonic
902075124 1:13778476-13778498 CCTCCTGACTGGCCACCTCCTGG - Exonic
903492172 1:23737616-23737638 CCTGCAGACAGGCTTCCACCTGG + Intergenic
904681907 1:32235061-32235083 AGTCCCCACAGGCCTCCACCAGG + Intergenic
905026407 1:34853103-34853125 CCTCCTCTCAGGCCACCACCAGG + Exonic
907384510 1:54117391-54117413 CCTGCACACAGGGCCCAACCTGG + Intergenic
907458520 1:54591629-54591651 CCTCCCCACAGTCCATCAGCTGG + Intronic
909263656 1:73527741-73527763 CCTCCCCACAGGCACACACCAGG + Intergenic
910937270 1:92494592-92494614 CCTCCACACTGGTCACCCCTGGG - Intergenic
912162719 1:107006039-107006061 CTACAGCACAGGCCACCACCAGG + Intergenic
912558690 1:110534831-110534853 CATCCATACAGGCCACAACCGGG + Intergenic
913649474 1:120898288-120898310 CCTCCTCAAAGGCCACCTACAGG + Intergenic
914077210 1:144365223-144365245 CCTCCTCAAAGGCCACCTACAGG - Intergenic
914101968 1:144601282-144601304 CCTCCTCAAAGGCCACCTACAGG + Intergenic
914171661 1:145230807-145230829 CCTCCTCAAAGGCCACCTACAGG - Intergenic
914296935 1:146335919-146335941 CCTCCTCAAAGGCCACCTACAGG - Intergenic
914639632 1:149592366-149592388 CCTCCTCAAAGGCCACCTACAGG + Intergenic
915755664 1:158256976-158256998 CCTCCCCAGCGGCCACCTCCAGG - Exonic
917509682 1:175659816-175659838 CCACCACACCTGCCACCTCCTGG - Intronic
920445103 1:206010405-206010427 CCACCACACAGGCAGCCTCCAGG - Intronic
922217720 1:223534208-223534230 CCACCATAGAGGACACCACCTGG + Intergenic
922910388 1:229210897-229210919 CCTCCACACACGGCACAGCCTGG + Intergenic
923279318 1:232427263-232427285 CCTCCTCACACACCACCAGCAGG + Intronic
923972995 1:239226525-239226547 CCACAACACAATCCACCACCTGG - Intergenic
1062957833 10:1552002-1552024 CCTCCACGCAGGAGGCCACCTGG - Intronic
1063889433 10:10614565-10614587 ACTCCACAGAGGCTGCCACCAGG + Intergenic
1066620498 10:37344661-37344683 ACTCCAGGCAGGCCACCAGCAGG + Intronic
1066623760 10:37385198-37385220 ACTCCAGGCAGGCCACCAGCAGG + Intergenic
1066746631 10:38607902-38607924 CCTCCGAATAGGCCACCTCCTGG - Intergenic
1067429137 10:46231356-46231378 CCTCCACCCTGGCCACCCACAGG - Intergenic
1067546817 10:47197718-47197740 CCTCCAGGCAGGGCACCAACTGG - Intergenic
1067752492 10:48981356-48981378 GCTCCACACAGGCCACAAGTGGG + Exonic
1067809660 10:49417374-49417396 CTCCCCCACAGGCCACCCCCAGG + Intergenic
1069601252 10:69709674-69709696 ACTACACAGAGGCCACCACTGGG - Intergenic
1069863158 10:71483701-71483723 CCACCACACAGGCCACTAGGAGG - Intronic
1069907760 10:71741876-71741898 CCTCCACAGTGGCCACCAGGTGG - Intronic
1070306031 10:75239700-75239722 CCTGCACTTAGGCCCCCACCAGG + Intergenic
1070812420 10:79305210-79305232 CTTGCACACAGGACACCTCCAGG - Exonic
1071502542 10:86213915-86213937 TCTGCACCCAAGCCACCACCAGG + Intronic
1072664428 10:97383582-97383604 CCTCCATGCAGGTCACCAACTGG + Intronic
1073295058 10:102433835-102433857 CTTCCCCACAGGGCAGCACCGGG - Intergenic
1075006724 10:118835923-118835945 CCTCCAGCCAGGACAGCACCTGG + Intergenic
1076193581 10:128499520-128499542 CGCTCACACAGGCCAGCACCTGG - Intergenic
1076393379 10:130120495-130120517 GGGCCACACAGGCCAGCACCAGG - Intergenic
1077087829 11:763401-763423 CCTCGGCACAGGCCACAGCCTGG - Exonic
1077101372 11:823999-824021 GCTCCACGCAGGCCTCCAGCAGG - Exonic
1077188114 11:1244505-1244527 CCTCCTCCCTGGGCACCACCTGG + Exonic
1077189069 11:1248276-1248298 CCTCCTCCCTGGGCACCACCTGG + Exonic
1077189632 11:1250460-1250482 CCTCCTCCCTGGGCACCACCTGG + Exonic
1077328749 11:1974804-1974826 CCTCCCCACAGGCCCCCGCTGGG - Intronic
1077474105 11:2778365-2778387 CCTCCACTCAGGACACAGCCAGG - Intronic
1077496684 11:2890065-2890087 CCTCTCCACAGGGCACCACCTGG - Intronic
1079453466 11:20617614-20617636 CCTCCACCCACCCCACCATCAGG - Intronic
1081497677 11:43631928-43631950 CCTCTTCACAGGCCCACACCTGG + Intronic
1081552531 11:44127316-44127338 GCTCCAAACAGGCCACAGCCCGG - Intronic
1081808859 11:45904254-45904276 CTTCCACTCAGCCCCCCACCTGG - Intronic
1082021723 11:47539716-47539738 ACTCCAAACAGGCCCACACCTGG + Intronic
1082086882 11:48057652-48057674 CCTCCACACAGTTCTCCCCCAGG - Intronic
1083479716 11:62936098-62936120 CCTCCAAGCAGGGGACCACCAGG - Intergenic
1083675080 11:64320714-64320736 CACTCAGACAGGCCACCACCTGG - Exonic
1084501310 11:69537226-69537248 GCTTCCCACAGGGCACCACCTGG - Intergenic
1084779624 11:71399774-71399796 CCTCCACACTGCCCTCCCCCAGG - Intergenic
1085038641 11:73314155-73314177 CCTCAACAGAGGCCACCAGGAGG - Intronic
1085453003 11:76648201-76648223 CCACCCCTCATGCCACCACCAGG + Intergenic
1087291341 11:96323838-96323860 CCTCCACACAGCCCTCCAGGTGG + Intronic
1089200571 11:116722483-116722505 CCTCCATCCAGGCCTCCTCCAGG + Intergenic
1089213071 11:116819593-116819615 CCTCCCACCAGGCCAGCACCAGG + Intergenic
1202811728 11_KI270721v1_random:29983-30005 CCTCCCCACAGGCCCCCGCTGGG - Intergenic
1095852471 12:46825944-46825966 CCTCCGTGCACGCCACCACCCGG + Exonic
1095986034 12:48000437-48000459 CCTCCACCCACTCCATCACCTGG - Intronic
1096505053 12:52087449-52087471 CCTCCAGCCTGGCCTCCACCCGG + Intergenic
1103060037 12:117851228-117851250 CCTCCACATAGGCCTCCCTCTGG - Intronic
1103326930 12:120127938-120127960 CCTCCAAACTGGCCACATCCAGG + Exonic
1103607623 12:122098834-122098856 CCTCCTCCCAGCCCACCCCCAGG - Intronic
1104014429 12:124952693-124952715 CCTCCCCAGAGGCCACCAGCAGG + Intronic
1104728008 12:131089442-131089464 CCTTCACACAGCCGACCACCTGG + Intronic
1104863932 12:131941644-131941666 CCTTCACAATGGCCACCACCAGG - Exonic
1105544217 13:21340042-21340064 CCTCCAGACAGGCCACTCCTTGG - Intergenic
1105698617 13:22915879-22915901 CCTGCCCGCAGCCCACCACCAGG + Intergenic
1106136929 13:26980373-26980395 AGTCCACACAGGCCACCTCTGGG + Intergenic
1106756426 13:32826987-32827009 CCTCCAGAGAGGCCAACATCTGG - Intergenic
1106850012 13:33780291-33780313 CCTCCATAGAAGCCACCAACAGG - Intergenic
1107560344 13:41552192-41552214 ACTGCACAGAGGCCCCCACCAGG - Intergenic
1108673072 13:52711316-52711338 GTTCCACACCTGCCACCACCTGG - Intronic
1112333158 13:98492527-98492549 GCTCCGCACAGCCCACCCCCAGG + Intronic
1112426388 13:99305370-99305392 CCTCTACACAGGCCACGTCCAGG + Intronic
1112449803 13:99498491-99498513 CCTCCACGCAGGCCACAAAATGG - Intergenic
1114538374 14:23437125-23437147 CCCCCACAGAGGCCTCCTCCTGG - Intergenic
1114627331 14:24138038-24138060 CCTCTTCCCAGGTCACCACCTGG + Exonic
1115758521 14:36554229-36554251 CATCCACCCAGGATACCACCTGG - Intergenic
1117424319 14:55579892-55579914 CCTCCCTCCAGGGCACCACCTGG - Intronic
1122610951 14:102983178-102983200 CCTCCCCACTGGCTACCCCCGGG + Intronic
1122649772 14:103220196-103220218 CCTCCAGCCAGGCCATCTCCAGG - Intergenic
1123123535 14:105929061-105929083 CCTCCACACAGGCATCCTCAGGG + Intronic
1123406178 15:20020562-20020584 CCTCCACACAGGCATCCTCAGGG + Intergenic
1123515508 15:21027210-21027232 CCTCCACACAGGCATCCTCAGGG + Intergenic
1124871730 15:33550208-33550230 TCTCACCACAGGCCACTACCTGG + Exonic
1125284449 15:38076967-38076989 CCCACAAACAGGCAACCACCCGG + Intergenic
1126850140 15:52791440-52791462 CCTCCGCACACGTCCCCACCAGG - Intergenic
1127502713 15:59569667-59569689 CTTCCTCTCAAGCCACCACCAGG + Intergenic
1128456829 15:67835847-67835869 CCTCCGGACAGGCCATCTCCGGG + Intergenic
1129319860 15:74768454-74768476 ACTACACACAAGCCAGCACCAGG + Intergenic
1129955173 15:79629885-79629907 CCCCCACACAGACCACAAACAGG + Intergenic
1131105522 15:89731510-89731532 CATCCTCGCAGGCCAGCACCAGG - Exonic
1132027456 15:98415559-98415581 ACTCCACACAGGCCAGCATTGGG + Intergenic
1132309874 15:100849701-100849723 GCTCCACACAGGCCACCGAACGG + Intergenic
1132691119 16:1182394-1182416 ACCCACCACAGGCCACCACCTGG - Intronic
1132730395 16:1358144-1358166 CCTCCAGCCAGGCCAGCCCCAGG - Intronic
1132814899 16:1821038-1821060 GCCACACAGAGGCCACCACCAGG + Intronic
1132981917 16:2742645-2742667 CCTGCCCAGAGGCCACCAGCAGG - Intergenic
1136230145 16:28880911-28880933 CCTCAAACCAGGCCAGCACCTGG - Exonic
1136429392 16:30187920-30187942 CCTCCACACCTGCCACCTACAGG + Exonic
1136547718 16:30965060-30965082 CCTCCACCCCCGCCTCCACCAGG - Exonic
1136716938 16:32288897-32288919 CCTGCACACAGGGCTCCTCCTGG + Intergenic
1136835313 16:33495142-33495164 CCTGCACACAGGGCTCCTCCTGG + Intergenic
1139698173 16:68690095-68690117 CCTGCACACTGGGCACCACTCGG - Intronic
1139966159 16:70746566-70746588 CCTCCACCCAGGCCAGGAGCCGG + Intronic
1141755121 16:85985904-85985926 CCTCCACACCGACCACCTCGTGG - Intergenic
1142234433 16:88915184-88915206 CCCACACCCACGCCACCACCTGG - Intronic
1203009490 16_KI270728v1_random:228890-228912 CCTGCACACAGGGCTCCTCCTGG - Intergenic
1203145486 16_KI270728v1_random:1795463-1795485 CCTGCACACAGGGCTCCTCCTGG + Intergenic
1143389152 17:6549861-6549883 CCTCCTGGCAGGCCATCACCAGG - Intronic
1144547879 17:16215069-16215091 CCTCCGCACAGGACACCTCGGGG + Intronic
1145103390 17:20095457-20095479 CCTGGACACACGCCACCAGCTGG + Intronic
1145921871 17:28615741-28615763 ACTCCAGACAGGGCAGCACCAGG + Exonic
1146062067 17:29612876-29612898 CCTCCCCGCAGGTCACCATCTGG + Exonic
1147614902 17:41822035-41822057 CCTCCACCCCAGCCCCCACCAGG + Intronic
1148566444 17:48635690-48635712 CCAGCACACCGGCCCCCACCAGG - Intergenic
1150219772 17:63489471-63489493 CCTGCTCACAGGCCACCTCTTGG - Intronic
1151368417 17:73631627-73631649 CATCCACCCAGTCCCCCACCAGG - Intronic
1152545026 17:80996035-80996057 CCACCACACCCGCCACCTCCAGG - Intronic
1152797696 17:82316206-82316228 CCAGCACACACGCCACCCCCAGG + Exonic
1156351540 18:36306222-36306244 CCTCCACACTCTCCACCACTTGG - Intronic
1159990573 18:74902194-74902216 CCTCCACGCAGGCCAGCAGTGGG - Intronic
1160346622 18:78137580-78137602 CATCCACACAGGCCCCGTCCAGG - Intergenic
1160591240 18:79945738-79945760 CCCCCACACCGGCCCCCTCCAGG + Intronic
1161392409 19:4028352-4028374 CCCCCACTCAGGCCACACCCGGG + Intronic
1161426724 19:4207787-4207809 CCCCCTCACAGGCCAGCATCAGG - Exonic
1161576879 19:5059279-5059301 CCTCCACACTCGCCAGCAGCAGG + Intronic
1161592815 19:5136453-5136475 CCCCCAGGCAGGCCACCGCCAGG - Intronic
1161687089 19:5708207-5708229 CCTCCACACAGGCCACTCCTTGG + Intronic
1163266274 19:16224386-16224408 CCTCCAAACAGGTCAGCACAAGG + Intronic
1163372772 19:16911141-16911163 CTTCCTAACAGGCCACCAACCGG - Intronic
1163767471 19:19171479-19171501 ACTACAGGCAGGCCACCACCAGG + Intronic
1163779862 19:19240463-19240485 CCCCCACCCAGCCCACCTCCAGG + Intronic
1166075044 19:40409137-40409159 CCTCCACACCTGGCAACACCAGG + Intronic
1166160802 19:40951428-40951450 CCTCCACATATTCCACCAGCAGG + Intergenic
1166169708 19:41019163-41019185 CCTCCAAACATTCCACCAGCAGG + Intergenic
1166256021 19:41605175-41605197 CCTCCACCCAGGTCAGCTCCAGG + Intronic
1166432641 19:42740340-42740362 CCTGCACACAGCGCATCACCTGG - Exonic
1166435753 19:42765537-42765559 CCTGCACACAGCGCATCACCTGG - Exonic
1166482567 19:43186361-43186383 CCTGCACACAGCACATCACCTGG - Exonic
1166485049 19:43205492-43205514 CCTGCACACAGCGCATCACCTGG - Exonic
1166492193 19:43269387-43269409 CCTGCACACAGCGCATCACCTGG - Exonic
1166565925 19:43765491-43765513 CCTCCCCTCAGGCCCCCAGCCGG - Intergenic
1166615857 19:44245527-44245549 CCTCCAGAAACACCACCACCAGG - Intronic
1166710600 19:44934759-44934781 CCTACAAACAGGACACTACCCGG + Intergenic
1167103469 19:47417944-47417966 CATGCACACAGCCCAACACCAGG + Intronic
1167160860 19:47766348-47766370 CCTCCACACTGGCCCTGACCGGG + Intergenic
1167287989 19:48609688-48609710 CCACTAAACAGGCCAGCACCAGG + Intronic
1167369046 19:49070088-49070110 CCTCCACTCTGGGCACCCCCAGG - Exonic
1167419587 19:49395122-49395144 CCTCCAGGTAGGCCAGCACCTGG - Exonic
1167666776 19:50826938-50826960 ACACCACACAGGCCTCCCCCGGG + Exonic
1167745206 19:51346812-51346834 CCTCCCCACGTGCGACCACCGGG + Intronic
925090349 2:1150183-1150205 GTTCCACACAGACCTCCACCAGG - Intronic
925224585 2:2172335-2172357 CCTCCCCACTGGCCACCCCGAGG + Intronic
926043049 2:9690221-9690243 CCTCCCCACTGCCCTCCACCAGG - Intergenic
926098349 2:10097417-10097439 CCTCCAAACCAGCCCCCACCCGG + Intergenic
926225928 2:10966851-10966873 CCTCCCCACAGGCTTCCACACGG - Intergenic
927513355 2:23658190-23658212 CCTCCACCAAGGCCAGCTCCAGG + Intronic
928091489 2:28377522-28377544 CCTCCCAACAGGCCCTCACCTGG + Intergenic
928092916 2:28386989-28387011 CTTCCACATCTGCCACCACCAGG - Intergenic
928786418 2:34892035-34892057 CCTCCATACAGTCCACTAACGGG - Intergenic
929781607 2:44960890-44960912 ACTCCACAGCTGCCACCACCAGG - Intergenic
929788586 2:45008598-45008620 CCACCACACAGGTCAGCAACTGG - Exonic
931424350 2:62157389-62157411 CCTCTACCTAGGCTACCACCTGG - Intergenic
932306221 2:70705731-70705753 CCTCCACTCTGCCCACCTCCTGG + Intronic
932676269 2:73784189-73784211 CCACCAAACCGACCACCACCTGG + Exonic
933997429 2:87680071-87680093 CCTCCTCAGAGGCTGCCACCTGG - Intergenic
936296422 2:111270841-111270863 CCTCCTCAGAGGCTGCCACCTGG + Intergenic
938923617 2:136018465-136018487 CCTTCACCCAGGCCACTACAGGG + Intergenic
939019286 2:136939874-136939896 CCCCGACACACACCACCACCAGG + Intronic
941662158 2:168206157-168206179 CCTCCACATAGGCCCACAGCTGG + Intronic
944551075 2:200845193-200845215 CCTCCTCAGAGGCGAGCACCTGG - Intergenic
946441981 2:219704388-219704410 CCTCCACACTGCCCTCCCCCAGG + Intergenic
947324374 2:228958650-228958672 GCTCAACAAAGGCCACCAGCAGG + Intronic
947628033 2:231633330-231633352 TCTCCACACTGGCCAGCCCCTGG - Intergenic
948388786 2:237597781-237597803 CCTCCATCCAGGCCACCCTCCGG + Intronic
948425164 2:237882811-237882833 CCTGCAGGCAGGCCATCACCAGG + Intronic
948439903 2:237979958-237979980 CCTCCAGAGAGAGCACCACCAGG - Intronic
948772349 2:240258165-240258187 TCTCCTCACAGGCCTCCTCCAGG + Intergenic
948778801 2:240304511-240304533 CCGCCACAGAAGCCACCACTGGG + Intergenic
948857251 2:240735845-240735867 CCTCCACATAGAACACCCCCCGG + Intronic
1169900515 20:10547884-10547906 CCTCCACAAAGGCCACCTGGTGG + Intronic
1171156598 20:22880227-22880249 CCTCAACACAGGGATCCACCTGG + Intergenic
1172094501 20:32454060-32454082 CCTCAGCAGAGGCCAACACCAGG + Intronic
1172331590 20:34079430-34079452 CCTCCACCCAAGCCACCCCAAGG - Intronic
1172883269 20:38215313-38215335 CCTCCACACAGGCCATCCCCAGG + Intronic
1173413522 20:42836563-42836585 CCTGGACGCAGGCCAACACCTGG + Intronic
1173684257 20:44911606-44911628 CACCCACTCAGGCAACCACCAGG - Intronic
1174078074 20:47952230-47952252 GCCCACCACAGGCCACCACCTGG + Intergenic
1174269460 20:49356755-49356777 CCTTCAGACATGCCACCAGCTGG + Intergenic
1175286542 20:57840555-57840577 TCTCCACAAAGACCACCTCCTGG - Intergenic
1175299750 20:57934477-57934499 CATCCACACTGGCCACAAGCTGG - Intergenic
1175486458 20:59350277-59350299 CCTCCCCACCCGCCACCACCCGG - Intergenic
1175940891 20:62537054-62537076 CCTCCACACAGGCCTCCTCCTGG - Intergenic
1176675110 21:9770513-9770535 CCTGCTCCCAGGCCACCCCCAGG - Intergenic
1176696782 21:9987368-9987390 CCTCCACACCTGCCCCCATCAGG + Intergenic
1178877531 21:36424326-36424348 CCTGCACCCAGGCCAGCACTAGG + Intergenic
1179874093 21:44258820-44258842 CCTCTTCCCAGTCCACCACCTGG - Intronic
1180019290 21:45111126-45111148 CTTCCACCCAGGCCAGCACACGG + Intronic
1180154759 21:45972520-45972542 GCTCCACACAGGCCCTCCCCCGG - Intergenic
1180179132 21:46110140-46110162 CCTTCACCCAGCACACCACCCGG + Intronic
1181018793 22:20087412-20087434 CCTCCACCCAGCCCACTACCTGG - Intronic
1181019034 22:20088673-20088695 CCTGTACCCAGGCCACCATCAGG - Intronic
1181643899 22:24220014-24220036 CGTACACACAGGCCCCCTCCTGG + Exonic
1182299609 22:29330302-29330324 CCTCCACCAGGGCCACCCCCTGG + Intronic
1182305581 22:29365670-29365692 CTCCCACCCAAGCCACCACCTGG + Intronic
1182312855 22:29421608-29421630 CTCCCACCCAAGCCACCACCTGG + Intronic
1183333632 22:37234551-37234573 CCCCCACACAGGCCCTGACCTGG + Intronic
1183672788 22:39283023-39283045 CCTCCACACTGGCCACCCCTTGG + Intergenic
1183858459 22:40652444-40652466 CCTCCCCACACCCCAGCACCGGG + Intergenic
1184473186 22:44707339-44707361 CCTCCACACAGGCCCTCCCTGGG - Intronic
1184583289 22:45431090-45431112 CCTCCACCCGGTCCCCCACCTGG - Intronic
1185036009 22:48477261-48477283 ACTCCACACACCCCATCACCAGG + Intergenic
1185101683 22:48843953-48843975 CCTCAACACACCCCACCTCCAGG + Intronic
1185325881 22:50225648-50225670 CACCCACCCAGGCCACCGCCAGG + Intronic
953814047 3:46139457-46139479 CCTCCACAAGAGCCACCACAGGG + Intergenic
954373669 3:50183330-50183352 CCTCCCCACAGCTCGCCACCGGG - Intronic
955826326 3:62951574-62951596 CCCCAACACAGGTCCCCACCGGG + Intergenic
956916318 3:73875542-73875564 CCTCCCCAAATGCCAGCACCTGG - Intergenic
960995836 3:123339527-123339549 CCTGCACAAAGTCCACCAACAGG + Intronic
966874956 3:184316215-184316237 CCTCCCCACAGCCCCTCACCTGG - Exonic
968182783 3:196609505-196609527 CCTCCCCACAGGGCACCCCTTGG - Intergenic
969250802 4:5967447-5967469 CTTGCAGACAAGCCACCACCTGG - Exonic
969425598 4:7122142-7122164 CCCCACCACAGGCCACCGCCTGG + Intergenic
969508898 4:7605909-7605931 CCTCCACAGAGACCACCACCTGG - Intronic
972342255 4:38162554-38162576 GCTCCACAAAGGCCTCCAGCTGG + Intergenic
979291195 4:118980816-118980838 ATGCCACACATGCCACCACCAGG - Intronic
979946777 4:126842949-126842971 CCTGGATACAGTCCACCACCTGG + Intergenic
980896624 4:138866521-138866543 ACTCCACAGGGGACACCACCGGG - Intergenic
981348036 4:143698845-143698867 CTCCCACTCAGGCCACTACCTGG - Exonic
984154436 4:176177135-176177157 CTTGCACACAGTCCACCAACAGG + Exonic
984376826 4:178942132-178942154 GTTCCTCACAGGCCACCAACCGG - Intergenic
984774296 4:183467267-183467289 CCTCCACACAGACTCCCTCCTGG + Intergenic
985238253 4:187900634-187900656 ACTTCACACAGCCGACCACCCGG - Intergenic
985514680 5:335445-335467 CCACAACACAGTCCACCACCTGG - Intronic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
985571135 5:645954-645976 CATCCACACAGGGCGCCAACGGG - Intronic
985571154 5:646084-646106 CATCCACACAGGCCGCCAATGGG - Intronic
985778053 5:1855478-1855500 CCTCAACTCAGGCCACCCTCAGG - Intergenic
985782746 5:1879664-1879686 CCCTCACACAGGTCTCCACCTGG - Exonic
985985759 5:3515061-3515083 CCCCCACACAGGCCAGCACTGGG + Intergenic
989225471 5:39022645-39022667 CCTCCAAATAGTCCACCACCTGG - Intronic
989820887 5:45794855-45794877 TCTCCCCACAACCCACCACCAGG - Intergenic
989980760 5:50641584-50641606 CCTCCTCAAAGGCCACCTACAGG + Intergenic
991422001 5:66451638-66451660 TCTGCTCACAGGGCACCACCTGG - Intergenic
993109845 5:83643488-83643510 CCACCACACAGGGCCCCACACGG + Intronic
997236633 5:132275742-132275764 CCTCCACCCAGGCCAGGAACTGG + Intronic
997905129 5:137808783-137808805 TCTCCACACAGGCCACCTGGTGG - Intergenic
998053344 5:139054771-139054793 CCTTCACATAAGCCACCACAGGG + Intronic
998094669 5:139390506-139390528 CCTCCACCCAGGCCATACCCAGG + Intergenic
1003325201 6:5085572-5085594 CCTGCACACAGGGGACCACCGGG - Exonic
1003395533 6:5749420-5749442 CTTCCATCCAGGCCACCAGCAGG - Intronic
1005946959 6:30602268-30602290 CCCCCACCCATGCTACCACCAGG + Exonic
1005947002 6:30602406-30602428 CCTCCAACCATGCCCCCACCAGG + Exonic
1006804141 6:36777504-36777526 CGTCCACACAGGCCCCCTCCAGG - Intronic
1009381363 6:63034673-63034695 CCTCCACACAGGGCATTATCTGG + Intergenic
1010794098 6:80099560-80099582 TTTCCACACTGGTCACCACCTGG + Intergenic
1016341041 6:143061331-143061353 CCTCCAAAGAGCCCACCACCTGG - Intronic
1017057393 6:150450059-150450081 CTTCCACACTGGCCATCACCAGG + Intergenic
1023045826 7:36209396-36209418 CCTCCTCACAGGGCACCAGGTGG - Intronic
1023955586 7:44884696-44884718 TCTCCATACAGGCCGCCCCCTGG + Exonic
1026955185 7:74372456-74372478 CCTCCACACAGGAGACCCACAGG - Intronic
1029482118 7:100819677-100819699 CCACCACCCAGGGCTCCACCAGG + Exonic
1032068848 7:128791676-128791698 CCTCCATCCTGGCCTCCACCGGG + Intronic
1032916437 7:136495381-136495403 CTTCCAGACCGGCCCCCACCCGG + Intergenic
1033078111 7:138268302-138268324 CCTCCACAAATGGCACCAGCAGG + Intergenic
1033089467 7:138371743-138371765 CCACCACACATGGCACCAGCAGG + Intergenic
1034212457 7:149375961-149375983 CCTCCACACCTGCCGGCACCTGG + Intergenic
1034212628 7:149377730-149377752 CCTCCACACCTGCCAGCATCCGG + Intergenic
1034267515 7:149788415-149788437 CCTCCACACAGGCCACCACCTGG - Intergenic
1035455404 7:159005757-159005779 CCTCCACACTGGGTTCCACCGGG - Intergenic
1035731262 8:1854973-1854995 CCTCCCCATACGCCACCTCCTGG - Intronic
1035779431 8:2216268-2216290 CAGCCACCCAGGCCACCTCCTGG + Intergenic
1036703647 8:11030635-11030657 CCTCCCCTCACGCCACCCCCAGG - Intronic
1036777862 8:11625808-11625830 CCTTCACACTGGGCACCCCCTGG + Intergenic
1037778286 8:21849831-21849853 ACAACACCCAGGCCACCACCAGG + Intergenic
1040579955 8:48689563-48689585 CCCCTGCACTGGCCACCACCTGG + Intergenic
1040699344 8:50042287-50042309 CATCCCCACAGCCCACCCCCAGG + Intronic
1047340479 8:123976042-123976064 CCTCCACAAAGGGATCCACCAGG - Exonic
1048035486 8:130673596-130673618 CCTGCAGCCAGGACACCACCGGG - Intergenic
1049351596 8:142167542-142167564 TCTCCACCTTGGCCACCACCGGG + Intergenic
1049447001 8:142635784-142635806 ACACCCCACAGCCCACCACCTGG + Intergenic
1049551565 8:143262159-143262181 CCTCCTCACAGACCTGCACCTGG - Intronic
1049794329 8:144489538-144489560 CCTACACACAGGGCATCCCCGGG - Intronic
1050131272 9:2415207-2415229 GCTCCTAACAGGCCACCAACAGG + Intergenic
1051581457 9:18680369-18680391 CCTCCACACAGGAAACTGCCCGG - Exonic
1051805549 9:20988831-20988853 CCTCCACACTGGCCAGCATATGG + Intronic
1053225857 9:36356340-36356362 CCTCCTCATTTGCCACCACCAGG - Exonic
1053524003 9:38810427-38810449 CCTCCACATGTGCCTCCACCAGG - Intergenic
1053633757 9:39973214-39973236 CCTCCACACCTGCCCCCATCAGG + Intergenic
1053771991 9:41490286-41490308 CCTCCACACCTGCCCCCATCAGG - Intergenic
1054196236 9:62034835-62034857 CCTCCACATGTGCCTCCACCAGG - Intergenic
1054210130 9:62277483-62277505 CCTCCACACCTGCCCCCATCAGG - Intergenic
1054314865 9:63571445-63571467 CCTCCACACCTGCCCCCATCAGG + Intergenic
1054642169 9:67553854-67553876 CCTCCACATGTGCCTCCACCAGG + Intergenic
1056074575 9:83025280-83025302 CCTGCACACTGCCCACCACATGG - Intronic
1057194775 9:93110862-93110884 CCTCCCCAGAGGCCACCCTCTGG + Intronic
1057361086 9:94374497-94374519 CCTCCCCACAGGCCGGCGCCGGG - Intergenic
1057542937 9:95992732-95992754 CCTCCACCCTGGCCTCCAGCTGG - Intronic
1057873316 9:98734070-98734092 CCTCCACACATGCCCCCGCTGGG + Exonic
1057996327 9:99823962-99823984 CCTCCACACACTTCACCACCGGG + Intronic
1060199927 9:121646430-121646452 CTGCCAGACAGGCCACCTCCTGG + Intronic
1060884006 9:127137791-127137813 GCTCAACACATGCCCCCACCAGG - Intronic
1060934713 9:127508345-127508367 CCTCATCCCCGGCCACCACCAGG - Intronic
1061414857 9:130442082-130442104 CCTGGGCACAGGCCTCCACCAGG + Intergenic
1061649021 9:132031167-132031189 TCTCCAGAGAGGACACCACCTGG - Intronic
1061764697 9:132874355-132874377 CCTCCACACAGGGCATCTCTGGG + Intronic
1062178695 9:135179140-135179162 CTCCCACAAAGGCCACGACCAGG + Intergenic
1185461406 X:334314-334336 GCTCCCCACGTGCCACCACCGGG - Exonic
1186027776 X:5332731-5332753 CCTCATCAAAGGCCAGCACCTGG - Intergenic
1189025332 X:37388306-37388328 CCCCCACACACGTCACCACTGGG - Intronic
1189324703 X:40105450-40105472 CCTCGCCCCAGGCGACCACCCGG + Intronic
1190118110 X:47638921-47638943 CCTCCAGACAGGCCTCCAAGGGG + Exonic
1190884301 X:54517877-54517899 CCTCCAGCCAAGCCACCAACTGG - Intergenic
1190947956 X:55114224-55114246 CCTCTTCTCAGGCCACCATCTGG + Intronic
1195541422 X:106067671-106067693 CCTCCACAAAGGCAGGCACCTGG - Intergenic
1198806704 X:140501568-140501590 CCTCCACCCAGTCCTCCTCCTGG - Intergenic