ID: 1034268300

View in Genome Browser
Species Human (GRCh38)
Location 7:149791572-149791594
Sequence GGCCCTGCAGCCGGACGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 121}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034268276_1034268300 29 Left 1034268276 7:149791520-149791542 CCCTCCCCAGAAGAGCAGGGTTG 0: 1
1: 0
2: 2
3: 22
4: 305
Right 1034268300 7:149791572-149791594 GGCCCTGCAGCCGGACGTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 121
1034268288_1034268300 1 Left 1034268288 7:149791548-149791570 CCTGGGGCCCCTGGAGCCCATGG 0: 1
1: 0
2: 8
3: 59
4: 656
Right 1034268300 7:149791572-149791594 GGCCCTGCAGCCGGACGTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 121
1034268295_1034268300 -8 Left 1034268295 7:149791557-149791579 CCTGGAGCCCATGGGGGCCCTGC 0: 1
1: 0
2: 3
3: 47
4: 388
Right 1034268300 7:149791572-149791594 GGCCCTGCAGCCGGACGTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 121
1034268283_1034268300 23 Left 1034268283 7:149791526-149791548 CCAGAAGAGCAGGGTTGTGGGGC 0: 1
1: 0
2: 0
3: 24
4: 220
Right 1034268300 7:149791572-149791594 GGCCCTGCAGCCGGACGTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 121
1034268275_1034268300 30 Left 1034268275 7:149791519-149791541 CCCCTCCCCAGAAGAGCAGGGTT 0: 1
1: 0
2: 3
3: 26
4: 322
Right 1034268300 7:149791572-149791594 GGCCCTGCAGCCGGACGTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 121
1034268277_1034268300 28 Left 1034268277 7:149791521-149791543 CCTCCCCAGAAGAGCAGGGTTGT 0: 1
1: 0
2: 1
3: 11
4: 144
Right 1034268300 7:149791572-149791594 GGCCCTGCAGCCGGACGTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 121
1034268281_1034268300 24 Left 1034268281 7:149791525-149791547 CCCAGAAGAGCAGGGTTGTGGGG 0: 1
1: 0
2: 0
3: 25
4: 268
Right 1034268300 7:149791572-149791594 GGCCCTGCAGCCGGACGTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 121
1034268293_1034268300 -6 Left 1034268293 7:149791555-149791577 CCCCTGGAGCCCATGGGGGCCCT 0: 1
1: 0
2: 4
3: 20
4: 255
Right 1034268300 7:149791572-149791594 GGCCCTGCAGCCGGACGTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 121
1034268279_1034268300 25 Left 1034268279 7:149791524-149791546 CCCCAGAAGAGCAGGGTTGTGGG 0: 1
1: 0
2: 1
3: 33
4: 230
Right 1034268300 7:149791572-149791594 GGCCCTGCAGCCGGACGTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 121
1034268294_1034268300 -7 Left 1034268294 7:149791556-149791578 CCCTGGAGCCCATGGGGGCCCTG 0: 1
1: 0
2: 6
3: 50
4: 399
Right 1034268300 7:149791572-149791594 GGCCCTGCAGCCGGACGTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034268300 Original CRISPR GGCCCTGCAGCCGGACGTGT GGG Intergenic
900369128 1:2323702-2323724 AGCCCTGCAGCCGGCCTTGCTGG + Intronic
902375017 1:16026517-16026539 GGCCCTGCAGAGGGAAGGGTGGG - Exonic
903361786 1:22781527-22781549 GGCCCTGCAGCAGGGCTTGAGGG - Intronic
907939406 1:59073008-59073030 GGCACTTCAGCTGGACCTGTAGG - Intergenic
912968805 1:114260938-114260960 GGTCCTGCAGCAGGAGGCGTTGG - Intergenic
914242269 1:145859775-145859797 GGTCCAGCAGCCGGACGCGGCGG + Intronic
915929508 1:160050834-160050856 GGCCCTGCAGCTGGCCATGAAGG - Intronic
917929536 1:179813930-179813952 AGCCCTGCAGCCAGCCCTGTGGG + Exonic
918572196 1:186010058-186010080 GGCCCTACAGCAGGAGGTGACGG - Intronic
920371439 1:205481704-205481726 AGCCTGGCAGCCGGACATGTGGG + Intergenic
924684779 1:246277850-246277872 GTTGCTGCAGCCAGACGTGTAGG + Intronic
1069752589 10:70753820-70753842 GTGCCTGCAGCCGGAGCTGTGGG + Exonic
1071152550 10:82652182-82652204 GGCCCTGCAGCAGCACCTGGAGG + Intronic
1071435649 10:85646425-85646447 GGCTCTACAGCTGCACGTGTTGG + Intronic
1076994118 11:289999-290021 GGGCCTCCAGCCGGACGTTGAGG - Exonic
1077066699 11:644203-644225 GGCACTGCAACCGGCCGTGTGGG + Intergenic
1077237739 11:1489971-1489993 GGCCAGGCAGCCGGGCGTGGTGG + Intronic
1077318366 11:1929154-1929176 GTCCCTGCCGCCGGAGGTGCAGG + Intronic
1077409152 11:2395448-2395470 GGCCCTACAGCAGGCCGTGGTGG + Exonic
1089317345 11:117600950-117600972 GGCCCTGCAGGAGGACGGGAGGG + Intronic
1089945066 11:122462034-122462056 GGCCCTGCAGCTGGAGAGGTAGG - Intergenic
1091055784 11:132417522-132417544 GGCCCTGAAGCCAGCCTTGTTGG + Exonic
1091154475 11:133360984-133361006 AGCCCCGCAGCCGGGCGGGTAGG - Intronic
1104848156 12:131857571-131857593 GGCCCTGCAGCCAGTGGTGTTGG + Intergenic
1105572019 13:21611655-21611677 GGGCCTGCAGTCAGAAGTGTGGG - Intergenic
1105806239 13:23953213-23953235 GGCCCTGCAGATGGAGTTGTTGG - Intergenic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1111556154 13:89883981-89884003 GGACCTGCAGCCCGCCATGTGGG - Intergenic
1119171354 14:72538583-72538605 GGCCCTGCAGCTGGCATTGTCGG - Intronic
1119407781 14:74409549-74409571 GTCCCTGCAGCTGGCCGTGGAGG - Exonic
1120830381 14:88992671-88992693 GGCCCTGCAGCCAGAAGGGAAGG - Intergenic
1121463765 14:94101382-94101404 GGCCCTGCAGCAGCACGCGGGGG - Intronic
1121778175 14:96604630-96604652 GGTCCTGCAGCCAGATGTGGTGG - Intergenic
1122278759 14:100609366-100609388 GGGCCTGCAGTCTGGCGTGTGGG + Intergenic
1122630143 14:103103995-103104017 GCTCCTGGCGCCGGACGTGTGGG + Exonic
1132343669 15:101093700-101093722 GGGCCTGCAGCCAGACTGGTTGG - Intergenic
1132641346 16:979961-979983 GGCACTGCAGACGGAGGTGTGGG + Intronic
1132651327 16:1022609-1022631 GGCCCTGCAGCAGGGGGTGGAGG + Intergenic
1132832350 16:1934696-1934718 AACCCTCCAGCCGGACGTGGTGG - Intergenic
1137026916 16:35486141-35486163 GGCCCAGCACCCGGACCTGCAGG - Intergenic
1138434541 16:56989725-56989747 GGCCCTGGAGCGGGAGGTGCGGG + Intronic
1143984362 17:10898594-10898616 GGCCCTGCTGCCTGGTGTGTGGG - Intergenic
1145743091 17:27292921-27292943 GGCTATGCAGCCGGGCGTGGTGG + Intergenic
1148940780 17:51209373-51209395 GGCCCTGGAGCAGGAAGTGGTGG - Intronic
1151677429 17:75605857-75605879 GCTCCTGCAGCAGGACCTGTGGG - Intergenic
1152550123 17:81025373-81025395 GGCCCTGGAGCCAGTGGTGTTGG - Intergenic
1152659852 17:81537162-81537184 GGTCCTGCAGCTGGAGGTGGAGG + Intergenic
1156228636 18:35132918-35132940 GGCCCAGCAGCCAGAGGTGGAGG + Intronic
1161068999 19:2251213-2251235 GGCCCTGGATCCGGACGCGCTGG + Exonic
1161159631 19:2754785-2754807 GGCCCTGCAGCCGCTCATGGCGG - Exonic
1161467964 19:4442676-4442698 GGCCCTGCAGCAGGCTGCGTGGG + Intronic
1162187839 19:8920054-8920076 TGCCCTGTAGCCGGGCGTGATGG + Intronic
1163312624 19:16523141-16523163 GGCCCTGTCGCCGCATGTGTGGG + Exonic
1164986744 19:32653794-32653816 GGCCCTGCAGCAGTGTGTGTGGG - Intronic
1165349820 19:35269369-35269391 GGCCCTGCAGCTGGGCGCGGGGG + Intronic
1166762662 19:45234632-45234654 GGCCCTGCAGCGCGAGCTGTGGG - Intronic
925764125 2:7214489-7214511 GGCCCTGCTGCAGGCCGTGGAGG + Intergenic
927188922 2:20502667-20502689 GGTGCTGCAGCCGGGCGTGGTGG - Intergenic
927868943 2:26611221-26611243 GGCCCTGCAGCCCGAAGGCTAGG - Intronic
927904606 2:26847909-26847931 GGCCCTGCAGCAGGGCCTGCCGG + Intronic
927962972 2:27251985-27252007 GGCCTTGCCGCCGGGCGTGATGG + Intergenic
929484689 2:42342894-42342916 GGCACTGCTGCAGGATGTGTTGG - Intronic
932750827 2:74370690-74370712 GTCCCTGCAGCAGGAGGTGGAGG - Exonic
934558338 2:95299251-95299273 GGCCCAGCACCAGGAGGTGTGGG - Intronic
937895972 2:126977030-126977052 GGCCCTGCAGCACGAAGTGGGGG - Intergenic
940954346 2:159712144-159712166 GGCCCTGCAGGTGGGCCTGTGGG + Intergenic
941805844 2:169711749-169711771 GGCCATGCAGCTGCAGGTGTGGG - Intronic
941806724 2:169717318-169717340 GGCCATGCAGCTGCAGGTGTGGG - Intronic
943324908 2:186486302-186486324 GGCCCTGCGGCAGGACGAGGAGG - Exonic
947570007 2:231226274-231226296 AGTCATGCAGCCAGACGTGTGGG + Intronic
1171497871 20:25569895-25569917 GGTACTGCAGCCGGGCGTGGTGG + Intronic
1173451723 20:43170419-43170441 GGCTCTGAAGCCAGACTTGTTGG - Intronic
1174299271 20:49569608-49569630 GGCCCTGCAGTGGGACCTCTAGG - Intergenic
1176140438 20:63542557-63542579 GGCCCCGAGGCAGGACGTGTGGG - Exonic
1176214103 20:63940114-63940136 GGCCCTTCAGCCGCACATGAGGG - Intronic
1178504459 21:33151707-33151729 GCCACTGCACCCGGCCGTGTGGG + Intergenic
1181106409 22:20578416-20578438 GGTACTGCAGCCGGACGTAGAGG - Intronic
1181442073 22:22941867-22941889 GGCCCTGCTGCTGGAGGTGCTGG - Intergenic
1183694612 22:39414588-39414610 GGGCCTGCAGCCTGCAGTGTTGG + Intronic
1183741139 22:39669258-39669280 GGCTCTGGAGCTGGACGTGGGGG + Intronic
1184037646 22:41926281-41926303 GGCGCTGCAGCCGCAGGAGTCGG - Exonic
1184973378 22:48043490-48043512 GGCCCTCCAGCTGGAACTGTGGG + Intergenic
1185274565 22:49944731-49944753 GGCACTGCAGCCTGAGGTCTGGG - Intergenic
950453465 3:13078758-13078780 GGCGCTGGAGCCGGAGGTCTGGG + Intergenic
953458174 3:43060612-43060634 GGCCCGGCAGCTGGAAGGGTAGG + Intergenic
962199781 3:133391745-133391767 GGCCCTGCAGCAGGATGGGTTGG - Intronic
964854402 3:161130464-161130486 GTCCCTACAGCTGGACGTTTAGG - Intronic
967132734 3:186487631-186487653 GCCCCTCCAGCCTGACGTGTTGG - Intergenic
969389439 4:6879928-6879950 GGCACTGCAGACGGGTGTGTTGG - Intronic
969389498 4:6880355-6880377 GGCACTGCAGACGGGTGTGTTGG - Intronic
979865250 4:125745243-125745265 GGACCTGCAGCCGGCCATGCCGG + Intergenic
982553597 4:156832789-156832811 GGCCCTGCAGACCGACATATTGG - Intronic
983778793 4:171642598-171642620 GGCCATGCAGCTGTAGGTGTGGG + Intergenic
987195222 5:15519054-15519076 GGCCCTGCAGCAGGGCGCGGTGG + Intronic
989058766 5:37389379-37389401 GGGCCTGAAGCCGGGCGTGATGG - Intronic
998370310 5:141656477-141656499 GGCCCTGGGGCCAGAGGTGTGGG - Intronic
1000770027 5:165341496-165341518 GGCTCTGCAGCCTGTAGTGTTGG - Intergenic
1001320214 5:170674611-170674633 GGCCCTGCAGGCTGACATTTTGG + Intronic
1001484057 5:172107007-172107029 GGAACTGCAGCAGGACGTGGCGG - Intronic
1002524516 5:179807544-179807566 GGCCCTGCCCCCGGTGGTGTAGG + Intronic
1007913272 6:45536896-45536918 GGACCTGCAGCTGGGTGTGTGGG + Intronic
1013957269 6:115855447-115855469 GGACCTGCAGCCGGTCATGCCGG + Intergenic
1017327182 6:153152736-153152758 GGCCATGCAGCTGCAGGTGTGGG + Intergenic
1018903099 6:168060894-168060916 GGCCTTGATGCCTGACGTGTAGG + Exonic
1019428215 7:987223-987245 GGGCCGGCACCCGGACGTGCAGG + Exonic
1021986457 7:26102365-26102387 AGCCCTGCAGCTGGCCCTGTAGG - Intergenic
1024293539 7:47824835-47824857 GTCCCTCCAGCAAGACGTGTGGG + Intronic
1029372537 7:100158582-100158604 GGCGCAGCAGCCGGAGGTGTCGG - Exonic
1034268300 7:149791572-149791594 GGCCCTGCAGCCGGACGTGTGGG + Intergenic
1034641629 7:152608469-152608491 GGCCCTGCAGCCAGCCACGTGGG - Intergenic
1037815171 8:22108229-22108251 GGCGCTGCAGCGGGAGGTGAAGG - Exonic
1046046537 8:108972352-108972374 GGCCCTGCTGCTGGAGGAGTGGG + Intergenic
1046260293 8:111758864-111758886 GGACCTGCAGCCTGCCGTGCCGG - Intergenic
1049574887 8:143385401-143385423 GTCCCTGCAGCAGCACGTGTTGG + Intergenic
1050400108 9:5244296-5244318 GGCCTTCCAGCCGGAGCTGTAGG - Intergenic
1050876959 9:10651164-10651186 GGCCCTGCAGCTAGGGGTGTGGG - Intergenic
1052936602 9:34098505-34098527 GGCCCTGCAGGCTCACGTGATGG - Exonic
1053281877 9:36825809-36825831 GGCCCTGCAGCAGGTAGTGAAGG - Intergenic
1053463061 9:38285422-38285444 GGCCCTGGGGCAGGACGTGCTGG - Intergenic
1059108782 9:111535008-111535030 TGCACTGCAGCCGGGCGTGGTGG - Intronic
1059337449 9:113578157-113578179 GGCCCTGCAGCAGGTCCTGATGG + Intronic
1060188472 9:121577877-121577899 GGCCCTGCAGCCTGAGGTCAGGG + Intronic
1060770251 9:126327051-126327073 GGCCCTGCAGCCGGGAGGGCGGG + Intronic
1061716626 9:132522299-132522321 GACACTGCAGCCGGAAGGGTGGG + Intronic
1062434292 9:136539856-136539878 GGCCCTGCAGCCGGCCTGGGAGG - Intronic
1062598826 9:137311108-137311130 GGCCCTGGGGCTGGAGGTGTTGG + Intronic
1192780629 X:74291166-74291188 GGCCCAGCAGCCGGGCGTGGTGG + Intergenic
1200249543 X:154545545-154545567 CGTCCTGCAGCCGGGCGTGGTGG + Intronic
1202369786 Y:24188770-24188792 GGCCCTGGTGCTGGAGGTGTTGG - Intergenic
1202500999 Y:25481347-25481369 GGCCCTGGTGCTGGAGGTGTTGG + Intergenic