ID: 1034272292

View in Genome Browser
Species Human (GRCh38)
Location 7:149809112-149809134
Sequence AGGCTGCGCAGCTGCTGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 294}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034272292_1034272298 16 Left 1034272292 7:149809112-149809134 CCGAGGCAGCAGCTGCGCAGCCT 0: 1
1: 0
2: 3
3: 26
4: 294
Right 1034272298 7:149809151-149809173 TGTGGCCTGCAGCCCTGCGCAGG 0: 1
1: 1
2: 4
3: 34
4: 282
1034272292_1034272295 -2 Left 1034272292 7:149809112-149809134 CCGAGGCAGCAGCTGCGCAGCCT 0: 1
1: 0
2: 3
3: 26
4: 294
Right 1034272295 7:149809133-149809155 CTCATGGAGTTTTCCACCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 237
1034272292_1034272300 21 Left 1034272292 7:149809112-149809134 CCGAGGCAGCAGCTGCGCAGCCT 0: 1
1: 0
2: 3
3: 26
4: 294
Right 1034272300 7:149809156-149809178 CCTGCAGCCCTGCGCAGGTGAGG 0: 1
1: 0
2: 1
3: 28
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034272292 Original CRISPR AGGCTGCGCAGCTGCTGCCT CGG (reversed) Intergenic
900080087 1:850061-850083 AGCCTGACCAGCTGCTGCCATGG - Intergenic
900403088 1:2480654-2480676 AGGCTGCGGGGCTGGGGCCTGGG - Intronic
900419342 1:2548957-2548979 AGGCTGCTCAGGTCCTGCCTGGG - Intergenic
900550384 1:3251556-3251578 AGGGTGCACAGGTGCTGCCCTGG + Intronic
900712438 1:4122830-4122852 TGGCTGGGTGGCTGCTGCCTGGG + Intergenic
901021475 1:6258100-6258122 AGGCTTGCCAGCTGCTGGCTGGG - Intronic
901700554 1:11043042-11043064 AAGCTGGGGAGCAGCTGCCTGGG + Intronic
901978218 1:13012166-13012188 GGGCTGTGCTGCTGCTGCCCTGG - Intronic
902003867 1:13216772-13216794 GGGCTGTGCTGCTGCTGCCCTGG + Intergenic
902023091 1:13362516-13362538 GGGCTGTGCTGCTGCTGCCCTGG + Intergenic
903665456 1:25004553-25004575 AGGCTGTGCAGCTTCTGGCTGGG + Intergenic
903886783 1:26545607-26545629 AGTCTGCTCAGCAGCTGCATTGG + Intronic
904006592 1:27366317-27366339 AGGCTGCGCAGCTGCGGGGGCGG + Exonic
905166924 1:36088446-36088468 AGGCCGCGCTGCTGCAGCCCAGG - Intergenic
905775577 1:40665455-40665477 AGGCGGGGCAGGTGCTGCCCCGG + Exonic
905887580 1:41499763-41499785 AGGCAGAGGAGCTGCTGCCAGGG + Intergenic
906062569 1:42958272-42958294 AGGCTGGGCTGCTGCTGCCGAGG + Intronic
906089524 1:43166697-43166719 AGAGAGTGCAGCTGCTGCCTGGG - Intronic
906288441 1:44603520-44603542 TGGCTCCGCCGCTGCTGCCAGGG + Intronic
908755885 1:67468420-67468442 AGCCAGGGCAGCAGCTGCCTGGG - Intergenic
912557957 1:110529875-110529897 AGCCTGCCCAGCTGGTGCCTGGG + Intergenic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
912931074 1:113962386-113962408 TGGCTGAGCAGCTGGTGCCTGGG - Exonic
913987098 1:143575200-143575222 ACCCTCCGCAGCTGCTGCCCAGG - Intergenic
914215072 1:145618661-145618683 AGGCTGTGAAGCTGCAGTCTAGG + Intronic
914467019 1:147939058-147939080 AGGCTGTGAAGCTGCAGTCTAGG + Intronic
916366986 1:164040492-164040514 AGCCCTGGCAGCTGCTGCCTAGG + Intergenic
920253813 1:204640532-204640554 AGGCTGTGCAGCTCCTTCCGAGG + Intronic
920342624 1:205284929-205284951 AGGCTGGGCTGCAGCTCCCTTGG - Intergenic
921039532 1:211416657-211416679 CGGCGCCGCCGCTGCTGCCTCGG - Intergenic
921347611 1:214203179-214203201 AGGCTGCCGAGCTGCTCCCAGGG - Intergenic
921367424 1:214386900-214386922 AGGATGTACGGCTGCTGCCTGGG + Exonic
922746235 1:228045728-228045750 TGGCTGCCTAGCTGCTCCCTGGG + Intronic
923055636 1:230424786-230424808 AGGCTGCGGAGCTTCTGCAGAGG + Intronic
923077297 1:230621433-230621455 ATGCATTGCAGCTGCTGCCTTGG + Intergenic
923210451 1:231799575-231799597 AGACTGCTCAGTCGCTGCCTGGG - Intronic
923402337 1:233627440-233627462 AGGCTGTTCCGCAGCTGCCTAGG + Intronic
923523828 1:234757351-234757373 AGGATGTAGAGCTGCTGCCTTGG - Intergenic
923865233 1:237932431-237932453 AGGCTGCTCAGATGCATCCTGGG + Intergenic
1062937418 10:1398825-1398847 AGGCTGCGCTGCTGCTGCGGAGG - Intronic
1063961154 10:11306375-11306397 AGGCTGGCAAGATGCTGCCTCGG - Intronic
1064138244 10:12768771-12768793 AGGCTGAGAAGCTACAGCCTTGG - Intronic
1065590311 10:27256600-27256622 ATCCTCCGCAGCTGCTGGCTTGG - Intergenic
1066063963 10:31749367-31749389 AGCCCGCCCACCTGCTGCCTCGG - Intergenic
1066149989 10:32606230-32606252 AGGCTTGGCAGCCTCTGCCTAGG + Intronic
1066259225 10:33712876-33712898 AGGCTGTGCAGCTTCCCCCTTGG + Intergenic
1067370681 10:45678948-45678970 AGGCTGCACAGCAGCAGCCATGG - Intergenic
1070136315 10:73697603-73697625 AGGCTGCACAGCAGCAGCCATGG + Exonic
1070544914 10:77444760-77444782 AGGCTGCCCAGCTGCTCCCTGGG - Intronic
1070618461 10:77987815-77987837 AAGCTGGGCAGCAGCTGGCTGGG - Intronic
1071470829 10:85983126-85983148 AGGCTGCCCACCTGCTTCCCCGG - Intronic
1072569689 10:96647872-96647894 AGGAAGAGCAGCTGCTTCCTAGG + Intronic
1072609113 10:97004858-97004880 AGCCTGTGCCGCTGCTGCATGGG - Intronic
1075405380 10:122192312-122192334 AGGCTGGGCAGTTGCTGCAGCGG + Intronic
1075728556 10:124623085-124623107 AGGGAGCCCACCTGCTGCCTGGG - Exonic
1076597889 10:131637251-131637273 AGGCTCAGCAGCTGCTGCCCTGG - Intergenic
1076616414 10:131758059-131758081 AGGGTGCGGAGCTGTTCCCTGGG - Intergenic
1076810897 10:132885835-132885857 AGGCTGTGCAGGTGCTGCCAAGG - Exonic
1076885518 10:133260710-133260732 GGGCTGGGCAGGTGCTGCCCAGG + Intergenic
1076990042 11:268028-268050 GGGCTGCACGGCTGCTGCCCGGG + Intergenic
1077038368 11:506493-506515 GGGCCGCGAAGCTGCCGCCTGGG - Intronic
1077281108 11:1746687-1746709 AGGCTGGGCAGAGGCTGGCTGGG - Intronic
1077403117 11:2368726-2368748 AGGCTGTGCAGGTGCTGGCCGGG + Intergenic
1077547659 11:3182531-3182553 AGGCAGAGCTGCTGCTGTCTAGG - Intergenic
1078397402 11:10993254-10993276 AGGCCTTGCAGCTTCTGCCTTGG - Intergenic
1079608280 11:22397717-22397739 AGGCTGGGAAGCTGCAGTCTTGG - Intergenic
1079689111 11:23400296-23400318 ACCCTCCGCAGCTGCTGGCTGGG - Intergenic
1083615570 11:64024516-64024538 AGGACCCCCAGCTGCTGCCTGGG + Intronic
1083878560 11:65537328-65537350 AGGCTAGGCAGATGGTGCCTGGG + Intronic
1084369684 11:68732466-68732488 GAGCTGCTCAGCTGCTGGCTGGG - Intronic
1084526118 11:69699032-69699054 AGCTTGCCCAGCTGCTGCCTGGG - Exonic
1084914483 11:72418111-72418133 AGCCTGCCCAGCTGCTGCCTAGG + Intronic
1085758388 11:79220407-79220429 ACGCTGCACAGCTGGTGACTGGG - Intronic
1087078792 11:94150550-94150572 AGGGTGATCAGCTGCTGCCAGGG - Intronic
1090471808 11:126987633-126987655 AGCCTTGGCAGCTGATGCCTGGG - Intronic
1090731295 11:129575231-129575253 AAGATGCTCAGCTGCTGGCTGGG - Intergenic
1091335463 11:134762711-134762733 CGGCTGCACAGCTGGTGCGTGGG + Intergenic
1091406823 12:214368-214390 GGGCTGAGCTGCTGCTCCCTTGG + Intronic
1091828354 12:3531985-3532007 AGGCTCTCCAGCTGGTGCCTAGG - Intronic
1091858237 12:3756080-3756102 AGGGTTTGCAGCTGCTGTCTGGG - Intronic
1092280062 12:7091849-7091871 GGCCTGTGCAGCTGCTGCATCGG + Intronic
1093226435 12:16489475-16489497 AGGCTGACCAGCTGTTGCCCTGG - Intronic
1094473448 12:30823750-30823772 AGCCTGCCCTGCTGCTTCCTAGG + Intergenic
1096215826 12:49796959-49796981 AGGAGGAGGAGCTGCTGCCTGGG + Exonic
1097280769 12:57844705-57844727 AGGCGGTGAAGTTGCTGCCTGGG + Intronic
1097794796 12:63850066-63850088 ACCCTGTGAAGCTGCTGCCTGGG - Intronic
1099826235 12:87780600-87780622 GTGCTGCACAGCTGCTGCCAGGG + Intergenic
1102230803 12:111260985-111261007 AGGCTGCGGTGCTGGTGACTTGG - Intronic
1102457898 12:113082221-113082243 AGGCTGGGCAGCATCTGCGTGGG - Intronic
1104444109 12:128819928-128819950 AGGCTGCACAGCAGGTGCCTAGG - Intronic
1104560622 12:129840614-129840636 AGGCTGCGCAGCCCCCGCCCTGG - Intronic
1105013706 12:132773277-132773299 AGGCTGTCCATCTCCTGCCTGGG + Exonic
1105741180 13:23324594-23324616 ACGATGTGCAGCTGCTCCCTGGG - Exonic
1105756160 13:23466402-23466424 AGGCTGCGCAGCTGCGTCTGCGG + Intergenic
1107011179 13:35673140-35673162 AGGCTGAGCAGCTGCTAGCAAGG + Intergenic
1109442823 13:62397651-62397673 AGGTTCAGCAGCTGCTGTCTTGG - Intergenic
1109566896 13:64130376-64130398 ACACTGTGCAGCTGTTGCCTGGG - Intergenic
1112319876 13:98396156-98396178 AGCCAGCGCAGCTGCTCCCGAGG + Intronic
1113371958 13:109732894-109732916 ACCCTCCGCAGCTGCTGGCTCGG + Intergenic
1113836503 13:113331485-113331507 GGGGTGCGCAGCTGCTGGGTGGG - Intronic
1116927069 14:50650570-50650592 AGACCGTGCAGCTTCTGCCTTGG + Intronic
1117233868 14:53751531-53751553 GTGCTGCACAGCTGCTGCCAGGG - Intergenic
1118463229 14:66006055-66006077 AGGCTCCTGAGATGCTGCCTTGG - Intergenic
1121278058 14:92681005-92681027 AAGGTGCCCAGCAGCTGCCTGGG - Intronic
1122153159 14:99735379-99735401 GGGCTGCGCAGCTGCTGGGCGGG - Intergenic
1122620893 14:103057267-103057289 AGGAGGCGCCGCTGCTGCCGGGG - Exonic
1122986662 14:105214733-105214755 AGGCAGCACAGCTGCTGCTGAGG + Intronic
1122999237 14:105283361-105283383 AGGTTCTGCAGCTGCAGCCTGGG - Intronic
1123413008 15:20074437-20074459 CCGCCGCGCAGCTGCCGCCTCGG + Intergenic
1123522350 15:21081550-21081572 CCGCCGCGCAGCTGCCGCCTCGG + Intergenic
1125019352 15:34969593-34969615 GGGCTGCGCAGGGGCTGCCATGG + Exonic
1125885541 15:43226771-43226793 ACGCTCCGCAGCTGCTGGCCCGG + Intergenic
1126792594 15:52234707-52234729 AGGCTGTGCAGGTGCTGACGAGG - Intronic
1127927521 15:63561393-63561415 TGACTGCGGTGCTGCTGCCTCGG - Intronic
1128482769 15:68054392-68054414 AGACGGCGCCGCTGCTGCCAGGG + Intronic
1129361983 15:75029886-75029908 AGGCTGCCCATCTGTTTCCTGGG - Intronic
1129867717 15:78922106-78922128 AGTCTGCGCTGCGGCTGCCACGG + Exonic
1130044107 15:80430802-80430824 AGGCTGCCCAACTGCTGTCAGGG - Intronic
1131021354 15:89101981-89102003 ACGCTACACAGGTGCTGCCTTGG - Intronic
1132754237 16:1474897-1474919 AGGCGGCGCCGCTGCTGCGGAGG - Exonic
1132912380 16:2321135-2321157 GAGCTGAGCAGCTCCTGCCTGGG + Intronic
1135276623 16:21118850-21118872 AGGCTGCAAAGTTCCTGCCTGGG + Intronic
1136223647 16:28844661-28844683 AGGCAGGGCAGCTGCTGCAGAGG - Intronic
1136540134 16:30924136-30924158 AGGGTGCTCAGCTTCTGCCCGGG - Intronic
1136990960 16:35151156-35151178 GGGCTGGGCAGGTGCTGCTTGGG + Intergenic
1137483290 16:48870294-48870316 AGGCTGCCCACATGCTGCCTGGG + Intergenic
1138393739 16:56688966-56688988 AGGCTGAACATCTGCTGACTGGG + Intronic
1139262970 16:65612831-65612853 AGGCTGAGAACCTGCTACCTTGG - Intergenic
1139433132 16:66921821-66921843 CGGCTGCGCTGCGGCTGCTTGGG + Exonic
1140382354 16:74501567-74501589 AGGCTAATCAGCTGCTACCTTGG + Intronic
1140478778 16:75251585-75251607 CCGCCGCGCAGCTGCCGCCTCGG + Intronic
1140808879 16:78558138-78558160 AGCCAGGGCAGCTGCTGCCCAGG - Intronic
1140883551 16:79221312-79221334 AGGCTGAGCAGATCCTCCCTGGG + Intergenic
1141463206 16:84190762-84190784 AGGCTGCTCAGCTGCTTCACTGG - Intergenic
1141484599 16:84330410-84330432 AGGCAGCCCACCTGCTGCCAGGG + Intergenic
1141629228 16:85277640-85277662 AGGCTGCCCAGCTGCAGCCCAGG - Intergenic
1141838884 16:86561307-86561329 AGGCTGCCGAGCAGATGCCTGGG + Intergenic
1142239036 16:88936653-88936675 CGGCTGGGCTGCTGGTGCCTTGG + Intronic
1142495521 17:304579-304601 ACTCTGAGCAGCTGGTGCCTGGG + Intronic
1142635361 17:1253851-1253873 AGGCTGCCCAGCTGCTGTACAGG + Intergenic
1143015542 17:3889454-3889476 AGACTGGGGATCTGCTGCCTCGG + Intronic
1143099931 17:4499281-4499303 CGGCTGCGCAGCTACTGCAAAGG + Exonic
1143432139 17:6895022-6895044 AGGCTGGGCACTTGCTTCCTAGG + Intronic
1143447219 17:7016690-7016712 GGGCTGTGGAGTTGCTGCCTAGG + Intronic
1144131794 17:12253582-12253604 AGGACTGGCAGCTGCTGCCTTGG - Intergenic
1144269651 17:13603253-13603275 AGGCTGCGAAGTTCCTGCATGGG - Intergenic
1145086707 17:19948466-19948488 TGGCTGCTCTGATGCTGCCTGGG - Intronic
1145791903 17:27632574-27632596 AGGGTCAGCAGGTGCTGCCTTGG + Intronic
1148178182 17:45585230-45585252 AGGTGGCGCAGCGGCTGCTTGGG + Intergenic
1148579613 17:48734587-48734609 AGGGCGCGCAGCAGCTGCCGTGG - Intergenic
1151108136 17:71642332-71642354 TAGCTGCACAGCTGCTGCCCTGG - Intergenic
1152070575 17:78131968-78131990 AGGCAGCGCAGCGGCTGGCCCGG + Exonic
1152609848 17:81310144-81310166 GGGGTGCGCAGCTGCTGGATGGG - Intergenic
1152710019 17:81866742-81866764 GGGCTGGGCAGCTGCTACCCCGG - Intergenic
1155306852 18:24487031-24487053 AGGCTGTGTAGCTGATGTCTTGG + Intergenic
1156308923 18:35904958-35904980 GGGCTGCCCAGCTTCTGCTTGGG + Intergenic
1157325198 18:46664098-46664120 TGGCAGCTCAGCTGCTGCCTAGG + Intergenic
1157794249 18:50560040-50560062 AGCCTGCGCCGCCGCCGCCTCGG - Intergenic
1158515797 18:58129221-58129243 AGGCTGAGCAGCAGCAGCCAAGG - Intronic
1160373524 18:78393476-78393498 TGGCTGCACATCTGCTTCCTGGG + Intergenic
1160426930 18:78784088-78784110 AGTCTCAGCAGCTGCTGCCTGGG + Intergenic
1160800677 19:966647-966669 TGCTTGCACAGCTGCTGCCTGGG - Exonic
1161319547 19:3634607-3634629 ACGCTGCCCACCTGCTGCCCAGG + Intronic
1162757500 19:12868968-12868990 AGGCTGCTCTGCCACTGCCTTGG + Intronic
1163517949 19:17776097-17776119 GAGCTGTGCCGCTGCTGCCTCGG - Exonic
1163644332 19:18479873-18479895 AGCCTTGGCACCTGCTGCCTTGG - Intronic
1163753476 19:19092525-19092547 AGGCTGGGCAGGTGCAGCCAAGG + Intronic
1164595982 19:29530838-29530860 AGAGTGCAGAGCTGCTGCCTAGG - Intronic
1165037196 19:33042272-33042294 AGGCTGCCCACCTGCCCCCTTGG + Intronic
1165075289 19:33276908-33276930 AGGCAGGGCAGCCCCTGCCTGGG + Intergenic
1165900726 19:39168058-39168080 ACCCTGGGCAGCTGCTGCATGGG + Intronic
1166045831 19:40230427-40230449 AGGCTTTCCAGCTGCTTCCTGGG - Exonic
1166687486 19:44804282-44804304 AGGCCATGCAGCTTCTGCCTGGG - Intergenic
1166894815 19:46016689-46016711 CGGTTCCGCTGCTGCTGCCTGGG - Exonic
1167050421 19:47074690-47074712 ATGCTGGGCAGAGGCTGCCTAGG + Intronic
1168494835 19:56839901-56839923 TTGCTGCGCAGGAGCTGCCTTGG - Intronic
924997965 2:381405-381427 AGGCTGCCCTGCTGCTGCCTGGG + Intergenic
925203928 2:1990904-1990926 AGGCTGCACAGCAGATTCCTGGG - Intronic
925725196 2:6865335-6865357 AGGCTGCTCTGCTACTGCCCGGG - Exonic
925859330 2:8159738-8159760 AGGCAGCCCAGCAGCTGCCCAGG - Intergenic
926461154 2:13130893-13130915 AGCCTCCTCAGCTGCTGTCTAGG - Intergenic
927596586 2:24402999-24403021 ACCCTCCGCAGCTGCTGGCTCGG - Intergenic
929008107 2:37415113-37415135 TGGCAGCTCAGCTGCTTCCTAGG - Intergenic
929609860 2:43263005-43263027 AGGATGCCCTGCTGCTGACTTGG - Intronic
930475343 2:51875100-51875122 ATGCCGCACAGCTGCTGCCAGGG - Intergenic
932812275 2:74835047-74835069 AGGCTGCTCCGCTGCCGCGTGGG + Intronic
934717012 2:96550238-96550260 TGGCCGCGCTGGTGCTGCCTGGG - Exonic
935644547 2:105323338-105323360 AGGCTGAGCAGCAGGTCCCTTGG - Intronic
938102019 2:128503984-128504006 AGGCTGCCCAACTGCTCCCACGG - Intergenic
941309786 2:163913753-163913775 ACCCTCCGCAGCCGCTGCCTTGG - Intergenic
941476592 2:165957288-165957310 ACTCTCCGCAGCTGCTGGCTCGG + Intergenic
941672694 2:168311456-168311478 ACCCTGCACAGCTGCTGCCCAGG + Intergenic
944656667 2:201882515-201882537 GGGCTCTGCTGCTGCTGCCTCGG + Intronic
946399443 2:219460871-219460893 AGGCTGGGCTCCTGCTCCCTGGG + Intronic
947909857 2:233793860-233793882 AGGCTGGGGAGCTGTGGCCTGGG - Intronic
948136356 2:235639234-235639256 AGCCTACTCAGCTGCTCCCTGGG - Intronic
948373217 2:237503906-237503928 AGGCTGCCCACCTGCTGGCCTGG + Intronic
948861668 2:240755535-240755557 GGCCTGCACAGCTGCTGCATGGG + Intronic
1171488150 20:25498449-25498471 AGGAGGGGCAGGTGCTGCCTGGG - Intronic
1172874342 20:38155184-38155206 AGGGTGCCCAGCTGATGCCTAGG - Intronic
1173658337 20:44716267-44716289 AGGCTTAGCAGCTGTGGCCTTGG - Intronic
1174413800 20:50353658-50353680 AGGCTGCGGAGCTGCAGCCAAGG + Intergenic
1175788088 20:61724284-61724306 AGGCTGCCCTGCTGCTGGCACGG - Intronic
1175976258 20:62711800-62711822 AGGCTGGGCAGGTGGTGCTTTGG - Intronic
1176073594 20:63238729-63238751 AGGGTGTGACGCTGCTGCCTGGG + Intronic
1179440466 21:41390111-41390133 TCGCTGAGCACCTGCTGCCTGGG + Intronic
1179468972 21:41597953-41597975 AGGCGGGGCAGCTGGGGCCTGGG - Intergenic
1180044807 21:45300402-45300424 GGGCTGGGCAGCTGCTGGCCTGG - Intergenic
1180162032 21:46002416-46002438 AGGCGGGGCAGGTGCAGCCTGGG - Intronic
1180737015 22:18024621-18024643 AGGCCGCGGAGCTGCGGCGTGGG + Intergenic
1180833522 22:18918582-18918604 GGGCTGGGCAGCAGCTGCCTGGG + Intronic
1181048431 22:20227512-20227534 GGGCAGGGCACCTGCTGCCTCGG + Intergenic
1181066305 22:20307673-20307695 GGGCTGGGCAGCAGCTGCCTGGG - Intergenic
1181106389 22:20578348-20578370 GGGCTGCAGAGCAGCTGCCTGGG - Intronic
1182024748 22:27109129-27109151 GGCCTGCGCTGCTGCTTCCTGGG - Intergenic
1183186258 22:36293273-36293295 AGGCTGGGGAGCTGCTGGCCGGG - Intronic
1183207774 22:36431509-36431531 AGGCTGCGGAGCTGATGCGGTGG - Intergenic
1183455266 22:37919086-37919108 AGGCTGCGCACGTGCTGCTGGGG - Exonic
1185059308 22:48597790-48597812 AGGCTGAGCTGCTGCTCTCTGGG + Intronic
1185139080 22:49090241-49090263 AGGGAGCACAGCTGCTGGCTGGG - Intergenic
1185193679 22:49454800-49454822 AGGCCTCCCAGCTGCTGCCCGGG + Intronic
1185339732 22:50285913-50285935 AGGCTGGTCAGGTGCTGCCTGGG + Intronic
1203283607 22_KI270734v1_random:143880-143902 GGGCTGGGCAGCAGCTGCCTGGG + Intergenic
949694627 3:6680511-6680533 AGGCTGCGCTGGTGGTGGCTTGG - Intergenic
950522467 3:13505223-13505245 AGGGTTCCCACCTGCTGCCTGGG - Exonic
950665962 3:14495101-14495123 AGGCTGGGGTGCTGCAGCCTGGG - Intronic
952944873 3:38472591-38472613 GGGCTGGGCACCTGCTCCCTGGG + Intronic
954332061 3:49896367-49896389 AGGCGGCACAGCTGCTGCTCTGG + Exonic
954783769 3:53078714-53078736 AGGATCTGGAGCTGCTGCCTGGG - Intronic
956438821 3:69260414-69260436 ACCCTCCGCAGCTGCTGGCTGGG - Intronic
957371484 3:79300359-79300381 ACGCTCCGCAGCTGCTGGCCTGG - Intronic
961794170 3:129397621-129397643 TGGTAGCGCAGCTGCTACCTAGG - Intergenic
962381460 3:134901551-134901573 AGGCTTCTCACCTGCTGGCTTGG + Intronic
966831887 3:184017395-184017417 AGGCTGTGCAGCGGGTGGCTCGG - Intronic
968520448 4:1032607-1032629 AGGCGGGGCTGCAGCTGCCTCGG - Intergenic
968973023 4:3805953-3805975 ACGCTGAGCAGCCTCTGCCTGGG + Intergenic
969425068 4:7119460-7119482 AGGCTGATCAGCTGCAGCCCTGG - Intergenic
969698132 4:8747536-8747558 TTGCAGCACAGCTGCTGCCTAGG - Intergenic
978299004 4:107243631-107243653 GGGCTGCACAGCTGGTGCCAAGG + Intronic
981713826 4:147733344-147733366 AGGCTGCCCAGCTCCTCACTGGG - Intronic
984562769 4:181290481-181290503 AGGCTGTGCAGCTTATGCCAGGG + Intergenic
986018684 5:3780865-3780887 AGGATGGGCAGCTGCTGCTGTGG + Intergenic
986972654 5:13355114-13355136 AGGCTGCACAGCTGCTAGATGGG + Intergenic
987990246 5:25200243-25200265 ACCCTCCGCAGCTGCTGGCTCGG + Intergenic
988577889 5:32444447-32444469 AGGCGGCGCGGCCGCGGCCTGGG - Intronic
988614822 5:32765193-32765215 TGGCTCAGCAGCTGCTGCCAAGG - Intronic
993287458 5:86017182-86017204 ATGCTGCACAGCTGCTGCCAGGG + Intergenic
995528302 5:113068262-113068284 AGGCAGCTCAGGTGCTGTCTCGG + Intronic
995678910 5:114695600-114695622 ACCCTCCGCAGCTGCTGGCTTGG - Intergenic
997699000 5:135883229-135883251 GGGCAGCGGAGCTTCTGCCTTGG + Intronic
998071789 5:139203490-139203512 AAGCTGCTCAGGTGCTGCTTGGG - Intronic
999325787 5:150642546-150642568 ATCTTGAGCAGCTGCTGCCTGGG + Intronic
999430326 5:151520253-151520275 AGGCTCCTGAGCTGCTCCCTTGG + Intronic
999768091 5:154755768-154755790 AGGTGGAGCCGCTGCTGCCTGGG + Intronic
999986227 5:157007833-157007855 AGGCTTGGCAGCTTCTACCTGGG - Intergenic
1000014695 5:157266461-157266483 AGGCCGCGCACCTGCTGCTGCGG - Intronic
1000179584 5:158795031-158795053 AGCTTGTGCTGCTGCTGCCTTGG - Intronic
1003749583 6:9040900-9040922 ACCCTCCGCAGCTGCTGGCTTGG - Intergenic
1003982463 6:11402801-11402823 AGCCTCCGCAGCTGCTGGCCTGG + Intergenic
1006520576 6:34568836-34568858 GAGCTGGGCAGGTGCTGCCTGGG - Intergenic
1011089517 6:83580544-83580566 AGGCTGCCCAGCTGGTGCCATGG + Exonic
1011591228 6:88972464-88972486 AGGCTGCTCAGCTTCTTTCTAGG + Intergenic
1012063027 6:94511711-94511733 AGGCAGCGCAGCTGCGGCCCTGG - Intergenic
1014001530 6:116370958-116370980 GGGATGCGCTGCTGCAGCCTCGG - Exonic
1015830716 6:137365952-137365974 AAGTTGCTCAGCTGCTGCCCGGG - Intergenic
1016180418 6:141139672-141139694 AGACCGTGCAGCTGCCGCCTGGG + Intergenic
1017760102 6:157562133-157562155 AGACGGAGCAGCTGCAGCCTGGG + Intronic
1018927041 6:168213567-168213589 AGGCAGCTCAGCAGGTGCCTCGG - Intergenic
1018992699 6:168686247-168686269 CGGCTGCACAGCTCATGCCTTGG + Intergenic
1019062211 6:169264756-169264778 ATGCTGAGCAGCTGCTTTCTGGG - Intergenic
1019105464 6:169663897-169663919 TAGCTGCAAAGCTGCTGCCTTGG + Intronic
1019436968 7:1027540-1027562 AGGCTCTGCCGCTGCTGCGTCGG - Intronic
1019451104 7:1098798-1098820 AGGCTGGGAAGCGGCTGCCGGGG + Intronic
1019714613 7:2532825-2532847 AGGTTGGGCAGCTGCTGGCCAGG - Intergenic
1019741706 7:2678228-2678250 AGGTTGGGCAGCTGCTGGCCAGG + Intergenic
1019975980 7:4581867-4581889 AGACTTTGCTGCTGCTGCCTTGG - Intergenic
1020055652 7:5116302-5116324 AGTCAGAGCAGCTGCTGCCATGG - Intergenic
1020145341 7:5638007-5638029 TGGCTGCGCAGCAGCCCCCTTGG + Intronic
1021907941 7:25354389-25354411 AGGCTCTGCTACTGCTGCCTGGG - Intergenic
1023845776 7:44119364-44119386 AGCCTGAGCCCCTGCTGCCTGGG + Intronic
1024997767 7:55286897-55286919 TTGGTGTGCAGCTGCTGCCTTGG + Intergenic
1025256735 7:57388910-57388932 AGGCTGCACAGCTGCAGCCAAGG - Intergenic
1026929074 7:74213077-74213099 AGGCTGCCTACCTCCTGCCTTGG - Intronic
1027978353 7:85186411-85186433 AGGCTCCGCAGCTGCTGAGGCGG + Intronic
1029351447 7:100015790-100015812 GGGCTCCGCAGCTGCGGCCCTGG + Intronic
1030788615 7:113695045-113695067 AGGCTCCCCACCTGCTGCCAGGG - Intergenic
1032433027 7:131878413-131878435 AGGGTGTGCAGCTGCAGCCCTGG - Intergenic
1034272292 7:149809112-149809134 AGGCTGCGCAGCTGCTGCCTCGG - Intergenic
1034346200 7:150386781-150386803 AGGCTGCACAGCTCCTGGCCAGG + Intronic
1034347424 7:150396182-150396204 AGGCAGAGCAGCCGGTGCCTCGG + Intronic
1035097173 7:156365165-156365187 AGGCTTCTCACCGGCTGCCTTGG + Intergenic
1035525425 8:308856-308878 AGCCTGACCAGCTGCTGCCATGG + Intergenic
1035673347 8:1436947-1436969 ACGCTGTGCAGGTGCAGCCTGGG + Intergenic
1036017105 8:4797150-4797172 AGCCTGAGATGCTGCTGCCTGGG - Intronic
1037578559 8:20230824-20230846 GGCATGAGCAGCTGCTGCCTGGG - Intergenic
1040466572 8:47701021-47701043 AGGCTAGCCAGCTGCTGCTTTGG + Intronic
1042456469 8:69010680-69010702 AGTCTGTGCATCTGCTCCCTAGG + Intergenic
1042759113 8:72251832-72251854 AGGCGGCGCAGCGTCTGCCGAGG + Intergenic
1047208301 8:122820581-122820603 AGGAAGCTCAGCTGCTGTCTTGG + Intronic
1047785875 8:128153434-128153456 GGGCTGTCCAGCTGCAGCCTGGG + Intergenic
1048302389 8:133261087-133261109 AGGTTGCACAGCTGATGACTGGG - Intronic
1048852217 8:138656125-138656147 AGTCTGTGCAGTTGCTGTCTTGG - Intronic
1049356106 8:142189167-142189189 AGGTTGTGCAGCTGCTCACTGGG + Intergenic
1049588263 8:143441734-143441756 AGGCTGGGCCGCTGGGGCCTTGG - Intronic
1050957890 9:11687645-11687667 AAGCTATGCAGCTGGTGCCTGGG + Intergenic
1054721496 9:68608901-68608923 GGGATGCGCTGCTGCAGCCTCGG - Intergenic
1054731322 9:68705214-68705236 CGGCTGCGCGGCGGCTGCCGCGG - Intergenic
1056801456 9:89694956-89694978 AGCCTCCACACCTGCTGCCTCGG - Intergenic
1060197771 9:121634526-121634548 AGCCTGGGCAGGTGCAGCCTCGG + Intronic
1060712196 9:125878436-125878458 CGGCTGCCCAGCAGCTGACTGGG + Intronic
1060793209 9:126499326-126499348 GGGCTGCCCAGCTGCTGCAGTGG + Intronic
1060795176 9:126508250-126508272 AGGCTGGGCTGCACCTGCCTTGG - Intergenic
1060933716 9:127504323-127504345 AGGCCACCCAGCTCCTGCCTGGG - Intergenic
1062087397 9:134655907-134655929 TGGCAGTGCAGCTGCTGTCTTGG - Intronic
1062111229 9:134783117-134783139 AAGGAGCGCAGCTGCTGCCCAGG + Intronic
1062592269 9:137279675-137279697 CGCCTGCGCCGCTGCGGCCTCGG - Exonic
1189147531 X:38670734-38670756 AGGATGAGAACCTGCTGCCTAGG - Intronic
1189473645 X:41333273-41333295 AGGCGGCGCCCCCGCTGCCTAGG + Intergenic
1193083100 X:77424808-77424830 AAGCTGCGGAGGTGGTGCCTGGG + Intergenic
1195290166 X:103424473-103424495 AGGCTTCACAGCTGCTGCCAGGG + Intergenic
1199724372 X:150566783-150566805 AGGGAGGGCAGCAGCTGCCTGGG - Intergenic
1200244605 X:154516270-154516292 AGACGGCGCAGCTGCTGCCGGGG - Intergenic
1201800044 Y:17945024-17945046 AGGCTCCGCTGCTGATACCTAGG + Intergenic
1201801509 Y:17960932-17960954 AGGCTCCGCTGCTGATACCTAGG - Intergenic