ID: 1034275975

View in Genome Browser
Species Human (GRCh38)
Location 7:149824026-149824048
Sequence AGGACCCAGTCCAGGACCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034275975_1034275988 29 Left 1034275975 7:149824026-149824048 CCGGAGGTCCTGGACTGGGTCCT No data
Right 1034275988 7:149824078-149824100 TCCCACAGTGAATGCCGGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 56
1034275975_1034275984 24 Left 1034275975 7:149824026-149824048 CCGGAGGTCCTGGACTGGGTCCT No data
Right 1034275984 7:149824073-149824095 CCCCCTCCCACAGTGAATGCCGG 0: 1
1: 0
2: 2
3: 21
4: 194
1034275975_1034275990 30 Left 1034275975 7:149824026-149824048 CCGGAGGTCCTGGACTGGGTCCT No data
Right 1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG 0: 1
1: 0
2: 2
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034275975 Original CRISPR AGGACCCAGTCCAGGACCTC CGG (reversed) Intergenic
No off target data available for this crispr