ID: 1034275976

View in Genome Browser
Species Human (GRCh38)
Location 7:149824034-149824056
Sequence AGGGAGGCAGGACCCAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034275976_1034275990 22 Left 1034275976 7:149824034-149824056 CCTGGACTGGGTCCTGCCTCCCT No data
Right 1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG 0: 1
1: 0
2: 2
3: 2
4: 53
1034275976_1034275988 21 Left 1034275976 7:149824034-149824056 CCTGGACTGGGTCCTGCCTCCCT No data
Right 1034275988 7:149824078-149824100 TCCCACAGTGAATGCCGGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 56
1034275976_1034275992 23 Left 1034275976 7:149824034-149824056 CCTGGACTGGGTCCTGCCTCCCT No data
Right 1034275992 7:149824080-149824102 CCACAGTGAATGCCGGCGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 73
1034275976_1034275984 16 Left 1034275976 7:149824034-149824056 CCTGGACTGGGTCCTGCCTCCCT No data
Right 1034275984 7:149824073-149824095 CCCCCTCCCACAGTGAATGCCGG 0: 1
1: 0
2: 2
3: 21
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034275976 Original CRISPR AGGGAGGCAGGACCCAGTCC AGG (reversed) Intergenic
No off target data available for this crispr