ID: 1034275980

View in Genome Browser
Species Human (GRCh38)
Location 7:149824054-149824076
Sequence GGGGTAGTCAGGGTAGACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034275980_1034275994 24 Left 1034275980 7:149824054-149824076 CCTTAGTCTACCCTGACTACCCC No data
Right 1034275994 7:149824101-149824123 GGAGCTGCACTGCACCAGCCAGG 0: 1
1: 0
2: 0
3: 19
4: 331
1034275980_1034275984 -4 Left 1034275980 7:149824054-149824076 CCTTAGTCTACCCTGACTACCCC No data
Right 1034275984 7:149824073-149824095 CCCCCTCCCACAGTGAATGCCGG 0: 1
1: 0
2: 2
3: 21
4: 194
1034275980_1034275992 3 Left 1034275980 7:149824054-149824076 CCTTAGTCTACCCTGACTACCCC No data
Right 1034275992 7:149824080-149824102 CCACAGTGAATGCCGGCGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 73
1034275980_1034275988 1 Left 1034275980 7:149824054-149824076 CCTTAGTCTACCCTGACTACCCC No data
Right 1034275988 7:149824078-149824100 TCCCACAGTGAATGCCGGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 56
1034275980_1034275995 25 Left 1034275980 7:149824054-149824076 CCTTAGTCTACCCTGACTACCCC No data
Right 1034275995 7:149824102-149824124 GAGCTGCACTGCACCAGCCAGGG 0: 1
1: 0
2: 3
3: 22
4: 225
1034275980_1034275990 2 Left 1034275980 7:149824054-149824076 CCTTAGTCTACCCTGACTACCCC No data
Right 1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG 0: 1
1: 0
2: 2
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034275980 Original CRISPR GGGGTAGTCAGGGTAGACTA AGG (reversed) Intergenic
No off target data available for this crispr