ID: 1034275981

View in Genome Browser
Species Human (GRCh38)
Location 7:149824064-149824086
Sequence ACTGTGGGAGGGGGTAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034275981_1034275990 -8 Left 1034275981 7:149824064-149824086 CCCTGACTACCCCCTCCCACAGT No data
Right 1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG 0: 1
1: 0
2: 2
3: 2
4: 53
1034275981_1034275992 -7 Left 1034275981 7:149824064-149824086 CCCTGACTACCCCCTCCCACAGT No data
Right 1034275992 7:149824080-149824102 CCACAGTGAATGCCGGCGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 73
1034275981_1034275988 -9 Left 1034275981 7:149824064-149824086 CCCTGACTACCCCCTCCCACAGT No data
Right 1034275988 7:149824078-149824100 TCCCACAGTGAATGCCGGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 56
1034275981_1034275995 15 Left 1034275981 7:149824064-149824086 CCCTGACTACCCCCTCCCACAGT No data
Right 1034275995 7:149824102-149824124 GAGCTGCACTGCACCAGCCAGGG 0: 1
1: 0
2: 3
3: 22
4: 225
1034275981_1034275996 24 Left 1034275981 7:149824064-149824086 CCCTGACTACCCCCTCCCACAGT No data
Right 1034275996 7:149824111-149824133 TGCACCAGCCAGGGCTGTCAAGG 0: 1
1: 0
2: 1
3: 50
4: 470
1034275981_1034275994 14 Left 1034275981 7:149824064-149824086 CCCTGACTACCCCCTCCCACAGT No data
Right 1034275994 7:149824101-149824123 GGAGCTGCACTGCACCAGCCAGG 0: 1
1: 0
2: 0
3: 19
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034275981 Original CRISPR ACTGTGGGAGGGGGTAGTCA GGG (reversed) Intergenic
No off target data available for this crispr