ID: 1034275984

View in Genome Browser
Species Human (GRCh38)
Location 7:149824073-149824095
Sequence CCCCCTCCCACAGTGAATGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 194}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034275976_1034275984 16 Left 1034275976 7:149824034-149824056 CCTGGACTGGGTCCTGCCTCCCT No data
Right 1034275984 7:149824073-149824095 CCCCCTCCCACAGTGAATGCCGG 0: 1
1: 0
2: 2
3: 21
4: 194
1034275972_1034275984 27 Left 1034275972 7:149824023-149824045 CCCCCGGAGGTCCTGGACTGGGT No data
Right 1034275984 7:149824073-149824095 CCCCCTCCCACAGTGAATGCCGG 0: 1
1: 0
2: 2
3: 21
4: 194
1034275970_1034275984 28 Left 1034275970 7:149824022-149824044 CCCCCCGGAGGTCCTGGACTGGG No data
Right 1034275984 7:149824073-149824095 CCCCCTCCCACAGTGAATGCCGG 0: 1
1: 0
2: 2
3: 21
4: 194
1034275979_1034275984 -3 Left 1034275979 7:149824053-149824075 CCCTTAGTCTACCCTGACTACCC No data
Right 1034275984 7:149824073-149824095 CCCCCTCCCACAGTGAATGCCGG 0: 1
1: 0
2: 2
3: 21
4: 194
1034275977_1034275984 4 Left 1034275977 7:149824046-149824068 CCTGCCTCCCTTAGTCTACCCTG No data
Right 1034275984 7:149824073-149824095 CCCCCTCCCACAGTGAATGCCGG 0: 1
1: 0
2: 2
3: 21
4: 194
1034275973_1034275984 26 Left 1034275973 7:149824024-149824046 CCCCGGAGGTCCTGGACTGGGTC No data
Right 1034275984 7:149824073-149824095 CCCCCTCCCACAGTGAATGCCGG 0: 1
1: 0
2: 2
3: 21
4: 194
1034275980_1034275984 -4 Left 1034275980 7:149824054-149824076 CCTTAGTCTACCCTGACTACCCC No data
Right 1034275984 7:149824073-149824095 CCCCCTCCCACAGTGAATGCCGG 0: 1
1: 0
2: 2
3: 21
4: 194
1034275974_1034275984 25 Left 1034275974 7:149824025-149824047 CCCGGAGGTCCTGGACTGGGTCC No data
Right 1034275984 7:149824073-149824095 CCCCCTCCCACAGTGAATGCCGG 0: 1
1: 0
2: 2
3: 21
4: 194
1034275975_1034275984 24 Left 1034275975 7:149824026-149824048 CCGGAGGTCCTGGACTGGGTCCT No data
Right 1034275984 7:149824073-149824095 CCCCCTCCCACAGTGAATGCCGG 0: 1
1: 0
2: 2
3: 21
4: 194
1034275978_1034275984 0 Left 1034275978 7:149824050-149824072 CCTCCCTTAGTCTACCCTGACTA No data
Right 1034275984 7:149824073-149824095 CCCCCTCCCACAGTGAATGCCGG 0: 1
1: 0
2: 2
3: 21
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034275984 Original CRISPR CCCCCTCCCACAGTGAATGC CGG Intergenic
900192922 1:1358984-1359006 CCCCCACCCACGGTGCACGCTGG + Intronic
901041828 1:6368652-6368674 CCCCTCCCCACAGTGAGAGCGGG + Intronic
901419354 1:9139942-9139964 CAACCTCCCACAGTGATTACAGG - Intergenic
901493278 1:9607457-9607479 CCCTCTCCCACAGTGCAAGGTGG - Intronic
902738134 1:18414722-18414744 CCTCCTCCACCAGTGAAGGCAGG + Intergenic
902754319 1:18539253-18539275 CCTGATCCCACAGGGAATGCTGG - Intergenic
904249467 1:29212786-29212808 ACCCCTCGCACCGTGGATGCAGG + Intronic
904526013 1:31134540-31134562 ACCTCTCCCACAGTGAAGGGTGG - Intergenic
905268648 1:36772144-36772166 CCCCCACCCCCAGTGACTGCTGG + Intergenic
905644737 1:39617279-39617301 CCCCTCCTCACAGGGAATGCAGG + Intergenic
905854281 1:41297357-41297379 TCCCCTCCCACATTGAATCGGGG - Intergenic
906711586 1:47934338-47934360 CCCCCTCCCACAGTCCCTGCAGG + Intronic
912795217 1:112689242-112689264 CCCCCTCCTTCAGGGAATGGGGG + Intronic
914357398 1:146898722-146898744 CCCTCTCTCCCCGTGAATGCAGG + Intergenic
915068965 1:153249813-153249835 GCCCAGCCCACAATGAATGCTGG - Intergenic
915111020 1:153564742-153564764 CCCCCTGCCTCGGTGAAGGCAGG - Intronic
915523406 1:156462001-156462023 TCCCCTCCCTCAGTGAATCATGG - Intergenic
917808767 1:178637546-178637568 CCCCCTCCTACATTGATTCCTGG + Intergenic
919747492 1:201017695-201017717 CCCCTGCCCACACTGCATGCAGG + Intronic
919748248 1:201021782-201021804 CCCCCACCCATTGTGAATGAGGG - Intronic
919853982 1:201693361-201693383 CCTCCTCCCATGGAGAATGCAGG - Intronic
920233697 1:204487842-204487864 CCCCCTCCCACCCAAAATGCAGG - Intronic
921155724 1:212436831-212436853 CGACCTCCCAAAGTGAGTGCTGG - Intronic
922729033 1:227940534-227940556 CCCCACCCCACAGTGACTCCAGG + Intronic
924153258 1:241150554-241150576 CCCCCTCCCATAGGGAGTGTGGG + Intronic
1063944017 10:11159552-11159574 CTCCTTCCCACACTGCATGCTGG - Intronic
1064307594 10:14181942-14181964 CGGCCTCCCAAAGTGCATGCTGG + Intronic
1064693143 10:17938453-17938475 GGCCCTCCCAAAGTGCATGCTGG + Intergenic
1066124955 10:32332411-32332433 TCCCCTCCCACAGTGAACAAGGG + Intronic
1070338828 10:75478155-75478177 CCTCCTCCCAAGGTGAATGCTGG - Intronic
1070785131 10:79158326-79158348 CCCCCTCCCCCAGTGCAACCTGG + Intronic
1070955101 10:80458438-80458460 CCACCTCCAACAGTGTCTGCTGG - Intronic
1071503534 10:86219602-86219624 CCCCGTCCCAGAGTGAGGGCAGG + Intronic
1073106200 10:101033447-101033469 CCCCCTCCTCCAGTGGCTGCAGG + Intronic
1074697142 10:116059691-116059713 CTCCCTCCCAGAGACAATGCAGG - Intronic
1076383407 10:130040134-130040156 CCCCCTCCCTAAGGGAGTGCTGG + Intergenic
1076799156 10:132812637-132812659 CCCCCACCCTCTGTGACTGCAGG - Intronic
1076804510 10:132848539-132848561 CCCCCTCCCACAACCCATGCAGG - Intronic
1079187978 11:18254282-18254304 CGCCATCCCACAGGGAATGTCGG + Intergenic
1080304545 11:30822169-30822191 TACCCTCCCACAGTGAATCAGGG + Intergenic
1080776702 11:35393426-35393448 CTTCTCCCCACAGTGAATGCAGG + Intronic
1081868052 11:46370444-46370466 CCGCCTCCCTCAGTAAGTGCAGG + Intronic
1082231074 11:49767241-49767263 CAACCTCCCAGAGTGAGTGCTGG - Intergenic
1083087810 11:60168519-60168541 CTCCCTCCGTCAGTGATTGCAGG - Intergenic
1084332879 11:68439962-68439984 GCCCCTCCCACCGTCAGTGCTGG + Intronic
1084432084 11:69116777-69116799 CCCCCTCCAGCAGTGACTGGAGG + Intergenic
1084576853 11:69994104-69994126 CCCCCCCCCACAGTCACAGCTGG + Intergenic
1086618975 11:88861730-88861752 CAGCCTCCCAGAGTGAGTGCTGG + Intronic
1087943720 11:104132732-104132754 TCCTGTCCCACAGTGAATTCTGG - Intronic
1089982195 11:122781497-122781519 CCGCGTCCCACAGGGAAAGCTGG - Intronic
1091838866 12:3605003-3605025 CCACCCCCCAGGGTGAATGCTGG - Intergenic
1095506609 12:42905470-42905492 CCGCCTCCCACCCTGAAGGCTGG - Intergenic
1095841674 12:46700717-46700739 GCCCCTCCCACTGGGAATGAGGG - Intergenic
1102954783 12:117052495-117052517 TCCCCTCCCTCAGTGACTTCTGG + Intronic
1106244911 13:27940812-27940834 TCCCCTCCCACAATGAATCTGGG + Intergenic
1106953977 13:34915236-34915258 CCCCCACCCACACTAAATGCTGG - Intergenic
1106967618 13:35090252-35090274 CCGCCTCCTACAATGAATACTGG - Intronic
1107643691 13:42472209-42472231 TCCCTTCCCACAGTGATTGGTGG + Intergenic
1108319507 13:49274806-49274828 CACTGTGCCACAGTGAATGCTGG + Intronic
1110264602 13:73523069-73523091 CAGCCTGGCACAGTGAATGCTGG - Intergenic
1110731486 13:78883413-78883435 CCCCCTCCCCCAGTTAAAACAGG - Intergenic
1113483330 13:110637438-110637460 GCCCCATCCACAGTGAATGATGG - Intronic
1113576078 13:111396213-111396235 CCTCCTCCCTCGGTGCATGCTGG - Intergenic
1113601225 13:111569567-111569589 ACCCCTCCCACATTGAATCTGGG - Intergenic
1113772835 13:112922048-112922070 CCCCAGCTCACAGTGAATGGAGG + Intronic
1113871573 13:113563056-113563078 CCCACTCCCACACTGCAAGCGGG + Intergenic
1121291882 14:92782704-92782726 TCTCCTCCCACAGTGAATTGGGG + Intergenic
1122250297 14:100434326-100434348 CCCCCTCCAACAGTGAAACCTGG + Intronic
1123687224 15:22807334-22807356 GACCCTCCTACAGTGAAAGCTGG - Intronic
1123753489 15:23377889-23377911 CCCCCTCCAATAGTTAATTCAGG - Intergenic
1123898508 15:24851882-24851904 CCCCATCCCACCCTGAATGCAGG + Intronic
1125336999 15:38636587-38636609 CCCCCTCCCACAGTGGACCAGGG + Intergenic
1126352553 15:47759623-47759645 CCCTCTCCCACCAGGAATGCTGG - Intronic
1127774072 15:62252097-62252119 CCTCCTCCCACAGTGGGGGCTGG - Intergenic
1129208054 15:74048843-74048865 CGGCCTCCCAAAGTGAGTGCTGG - Intergenic
1129227955 15:74180756-74180778 CGCCCTCCCACTGGGAATGGGGG - Intronic
1129452177 15:75657291-75657313 ACCCCTCCCCCAGTCACTGCTGG - Exonic
1130265080 15:82394093-82394115 GCCCATCCCACAGTGAATCTGGG - Intergenic
1130475355 15:84261426-84261448 TCCCATCCCACAGTGAATCTGGG - Intergenic
1130482772 15:84375480-84375502 TCCCATCCCACAGTGAATCTGGG - Intergenic
1130506913 15:84552792-84552814 GCCCATCCCACAGTGAATCTGGG + Intergenic
1132438803 15:101838002-101838024 TTCCCTCCAACAGTGTATGCGGG + Intergenic
1132462092 16:60530-60552 CCCCCTCCCACAGTCCACGCTGG - Exonic
1132745578 16:1434843-1434865 CCCCGTCCCACAGCGCACGCAGG - Exonic
1132866011 16:2093127-2093149 CCCCAGCCCACAGTGACAGCAGG + Intronic
1132914248 16:2333939-2333961 CAGCCTCCCAAAGTGCATGCTGG + Intronic
1133134708 16:3702277-3702299 CCCCCTCCCTCTGTGTTTGCTGG - Intronic
1135550691 16:23396056-23396078 CCCACTCCCACTGTGAAGGAGGG + Intronic
1135932419 16:26749679-26749701 GCCCCTCACACAGTGTTTGCTGG + Intergenic
1137289415 16:47041784-47041806 CTCCCTCCCTCAGTGGTTGCTGG + Intergenic
1139531451 16:67544599-67544621 CAACCTCCCCCAGTGCATGCTGG + Intronic
1139976790 16:70818572-70818594 CCCTCTCTCCCCGTGAATGCAGG - Exonic
1141903664 16:87008705-87008727 CCCCCTCCCACACTGACTCTGGG + Intergenic
1144874018 17:18387611-18387633 CCCCCTCCTACTGTGAATAAAGG - Intronic
1147658522 17:42104731-42104753 ATCCCTCCCACAGGGCATGCAGG + Intronic
1148049246 17:44761013-44761035 ACCCCACCCCCAGTGACTGCGGG - Intronic
1148957977 17:51369807-51369829 TCCCCTCCTGCAGTGAATGGAGG - Intergenic
1148959711 17:51383352-51383374 CGGCCTCCCAAAGTGATTGCAGG + Intergenic
1151477917 17:74354286-74354308 CGCCCTCGCTCAGTGAGTGCAGG - Exonic
1151492812 17:74442903-74442925 CCCGCCCCCACACTGAATGCCGG + Intronic
1151888301 17:76937280-76937302 CCCCCTCCTTCAGTGAAAGAAGG + Intronic
1154941410 18:21116243-21116265 TTCCCTCCCACACTGAATCCGGG + Intergenic
1155523197 18:26689962-26689984 TCTCCTCCCTCAGGGAATGCTGG - Intergenic
1158005269 18:52664912-52664934 CTCCCTCCAACACTGAATGCAGG + Intronic
1158420137 18:57286092-57286114 CCTCCTTCCACAGGGAATGGTGG + Intergenic
1160487548 18:79308215-79308237 ATCCCACCCACAGTGCATGCAGG - Intronic
1160966002 19:1747243-1747265 ACCCCTCCCCCAGGGAATGGGGG + Intergenic
1162831622 19:13288152-13288174 GCCTCTCACACAGTCAATGCTGG + Intronic
1164667471 19:30051124-30051146 CCTCCCCCCACAGTGAAGGCAGG - Intergenic
1165816180 19:38643774-38643796 CCTCCTACCTCAGGGAATGCTGG - Intergenic
1166035354 19:40164272-40164294 CAGCCTCCCAAAGTGCATGCTGG + Intergenic
1167219273 19:48186922-48186944 CCCCCACCCCCAGTGACTGGGGG - Intronic
926082988 2:10003904-10003926 CCCCCTCACATAGTGAGTGCTGG - Intergenic
926890736 2:17637127-17637149 CCCCTTCCCACAGGGAAGGCTGG + Intronic
927206044 2:20611326-20611348 CTCCCTCCCAAAGTGATTGAGGG + Intronic
928674686 2:33639027-33639049 GCCCCTGCTACAGTGAGTGCTGG + Intergenic
928697192 2:33861332-33861354 CCCCCCACCTCAGTGCATGCTGG - Intergenic
930108375 2:47657664-47657686 CCCCATCCCAGGGTGAATGGAGG + Intergenic
932787591 2:74621021-74621043 CGGCCTCCCAAAGTGATTGCAGG - Intronic
933846378 2:86330393-86330415 CTCCCTACCACAGTGAATCCTGG + Intronic
934716890 2:96549706-96549728 CCACCTCCCACAGAGACTGACGG + Intronic
935678756 2:105618287-105618309 GCCCATCCCACAGGGAGTGCTGG - Intergenic
942094752 2:172526353-172526375 CACCCTCCCAAAGTGGATTCTGG + Intergenic
944578995 2:201116251-201116273 CGGCCTCACACAGTGAGTGCCGG + Exonic
945257209 2:207812798-207812820 ACCCCTCCCACACTGATTGTTGG + Intergenic
948437153 2:237961475-237961497 GCCCCACCCACAGTGAGGGCAGG + Intergenic
948440034 2:237980816-237980838 CCCCTGCCCACAGGGTATGCAGG + Intronic
1168899097 20:1345090-1345112 TCTCCTCCCACAGTGAATCAGGG + Intronic
1170053790 20:12176474-12176496 CCTTCTGCCACAGTGCATGCTGG + Intergenic
1171412319 20:24955871-24955893 CCCCACCCCATAGAGAATGCTGG - Intronic
1171533737 20:25868444-25868466 CCCCCTCCCTCAGTGGAAGTCGG - Intergenic
1171847099 20:30283945-30283967 CCCCCTCCCTCAGTGGAAGTCGG + Intergenic
1174741537 20:53019405-53019427 ACCACTCCCACTGTGACTGCTGG + Intronic
1177642435 21:23861063-23861085 CCCACTCTCTCAGTGAATGCTGG + Intergenic
1183269220 22:36850268-36850290 CCCCCACTCAGAGTGCATGCTGG + Intergenic
1184435965 22:44476808-44476830 CCTCCTCCCACATGGGATGCTGG - Intergenic
952046207 3:29324227-29324249 CCCTCAGCCACAGTGACTGCTGG - Intronic
952410678 3:33047245-33047267 GCCCCTTGCACAGTGACTGCAGG - Intronic
952625002 3:35393015-35393037 CCCATTCCCACAGTGCATGTGGG - Intergenic
953703041 3:45211304-45211326 GGTCCTCCCACAGTGAATGATGG - Intergenic
954754814 3:52833421-52833443 CCTCCTCCCACAGAGCAAGCTGG - Exonic
962318485 3:134373296-134373318 CCGACTCCCACAGAGAAGGCAGG + Intronic
963935482 3:151047793-151047815 TCCCCTCCCACATTGACTGTGGG + Intergenic
965505444 3:169510210-169510232 CCCAATCACAGAGTGAATGCAGG - Intronic
965766778 3:172138955-172138977 CCCCCTGCCTCAGTGAGTGTGGG + Intronic
966622463 3:181980644-181980666 CCCCCCCCCTCTGTGCATGCAGG - Intergenic
968055623 3:195689673-195689695 CCAGCTCCCACAGTGAACACGGG - Intergenic
969285234 4:6198920-6198942 GCTCCACCCACAGTGAATGTTGG - Intronic
972272488 4:37524595-37524617 CCCCTTCCCATAGTGAATCAGGG - Intronic
975101007 4:70512894-70512916 CCCCCACCCACAAGGAATGTTGG - Intergenic
977891247 4:102314166-102314188 CCCTCTCCCACAATCAATCCAGG + Intronic
979171554 4:117606716-117606738 CACACTCCCACATTAAATGCTGG - Intergenic
981328159 4:143476236-143476258 TCTCCTCCCACAGTGAATCAAGG - Intergenic
982551476 4:156805928-156805950 CACCCTTCCACAGGGCATGCTGG + Intronic
985393114 4:189513019-189513041 TCCCCTCACACAGAGAATGCAGG + Intergenic
985865114 5:2508654-2508676 CCCCCTCCCTCAGTGACTGCTGG + Intergenic
986026163 5:3853374-3853396 CCCCATGCCACAGGGAAGGCAGG + Intergenic
986052458 5:4102908-4102930 CCACCTTCCACAGTGCAGGCTGG + Intergenic
987010700 5:13760905-13760927 CCTCCCTACACAGTGAATGCGGG + Intronic
987244824 5:16038041-16038063 GCCCCACCCACAGTGACTGTGGG - Intergenic
988585953 5:32507773-32507795 CCCCCTCACAGACTGAATCCCGG + Intergenic
988807724 5:34756020-34756042 CCCCCACCAACACTGAGTGCAGG - Intronic
989168847 5:38455715-38455737 CCCCCTCCCACAGTGATGGCTGG + Intronic
989592128 5:43121557-43121579 CTCCTTCCCTCAGTGAGTGCCGG + Intronic
995754461 5:115487863-115487885 CACCCTCCCACAGTGGAAGAAGG + Intergenic
997847439 5:137300833-137300855 CTCCGTGCCACAGTGAATGGAGG + Intronic
998812791 5:145983278-145983300 CGCCCTCACTCAGTAAATGCTGG - Intronic
998812794 5:145983305-145983327 CACCCTCACTCAGTAAATGCTGG - Intronic
999286161 5:150395478-150395500 CCGCCTCTCACAGAGAATGTTGG - Intronic
1001922813 5:175613821-175613843 GCCCCTCCCATAGACAATGCTGG + Intergenic
1006297904 6:33178185-33178207 CCTCCCCTCACCGTGAATGCAGG - Exonic
1007606218 6:43119906-43119928 CCCCTTCCAAAGGTGAATGCAGG - Intronic
1011639752 6:89407712-89407734 CCCCAGCCCATAGTAAATGCTGG - Intronic
1015060916 6:128964416-128964438 ACCTCTCCCACAGTGAATATTGG + Intronic
1016915141 6:149237742-149237764 TCCCCTCCCACTGTGGGTGCTGG + Intronic
1018160672 6:161039111-161039133 TCGCCTCCCACAGTGAATTTGGG - Intronic
1019354113 7:570089-570111 CACCCACCCACAGTGACCGCTGG + Intronic
1019455260 7:1123459-1123481 TCCCCTCCCCCAGTGGATCCTGG - Intronic
1019482434 7:1273120-1273142 CCACCTCCCACAGACACTGCCGG + Intergenic
1019618786 7:1979428-1979450 CCGCCTCCCACATTGGATTCTGG + Intronic
1019799242 7:3076044-3076066 CCACCTCCAACACTGAATCCAGG + Intergenic
1020135685 7:5586676-5586698 CCCCGGCCCTCAGTGAAAGCAGG + Intergenic
1023847819 7:44132655-44132677 GCCTCTCCCACAGAGAGTGCTGG - Intergenic
1023850822 7:44149355-44149377 CCCCCACCCAAAGTGAAGGCAGG - Intronic
1029671071 7:102031310-102031332 CAGCCTCCCAGAGTGAGTGCTGG + Intronic
1030092185 7:105867446-105867468 CCTCCACCCACAGTGAAGGAGGG + Intronic
1031201295 7:118689747-118689769 CAGCCTCCCAAAGTGAGTGCTGG + Intergenic
1032529673 7:132609780-132609802 CCCCCTCCCACTGCCAATGGGGG - Intronic
1032976936 7:137235952-137235974 CCGCCTCCCAAAGTGAGTGGGGG - Intronic
1034275984 7:149824073-149824095 CCCCCTCCCACAGTGAATGCCGG + Intergenic
1035597624 8:871181-871203 CCCCTTCCCACAGAGAAGGCCGG + Intergenic
1037746966 8:21653388-21653410 CCCACCCCCAAAGTGAATCCAGG + Intergenic
1039017061 8:33161631-33161653 CCCCACCCCAAAGTGAATGTGGG - Intergenic
1040505597 8:48045128-48045150 CCACCACCCACAGGGAATGGAGG - Intronic
1041548906 8:59078481-59078503 GCACCTCACACAGTGAAAGCAGG - Intronic
1042752781 8:72176356-72176378 ATCCCTCCCACACTGAATGGAGG - Intergenic
1042765227 8:72314050-72314072 TTCCCTCCCACATTGAATGGGGG - Intergenic
1049433644 8:142576459-142576481 TCCCCTCCCAAAGTGACTGCAGG - Intergenic
1049731847 8:144182182-144182204 CACCCTCCCGCAGTGGACGCAGG - Intronic
1050613268 9:7375339-7375361 CCACCTGCCACAGTGACTCCAGG + Intergenic
1050682877 9:8134515-8134537 CGGCCTCCCAAAGTGAATTCTGG + Intergenic
1051332643 9:16039292-16039314 CCCCCTCCCTGAGTCAAGGCTGG - Intronic
1053239827 9:36487080-36487102 CCCCCTCCCCCAGGGTGTGCAGG - Intronic
1054173630 9:61860566-61860588 CCCCCTCCCTCAGTGGAAGTCGG - Intergenic
1054448484 9:65389631-65389653 CCCCCTCCCTCAGTGGAAGTCGG - Intergenic
1054663910 9:67720215-67720237 CCCCCTCCCTCAGTGGAAGTCGG + Intergenic
1056820993 9:89842056-89842078 CCCCCTCCCAAAGTCAATGATGG + Intergenic
1058803842 9:108570518-108570540 CCGCCTCCCAAAGTGATTACAGG - Intergenic
1061298086 9:129687869-129687891 CCCCCTCGCACAGTGATTGAGGG + Intronic
1061597706 9:131642913-131642935 CTCCCACCCGCAGTGAATCCAGG + Intronic
1185880046 X:3732735-3732757 CCCCCTCACAGATTGAATCCTGG + Intergenic
1187745205 X:22402013-22402035 TCCTCTCCCACAGTGAATCTAGG - Intergenic
1188418977 X:29973125-29973147 CCCCCTCCCGCAGTGAATCTAGG - Intergenic
1189107194 X:38249232-38249254 CCACATCCCAGGGTGAATGCTGG - Intronic
1197708790 X:129652119-129652141 CACACTCCCACTGTGACTGCAGG + Intronic
1199204904 X:145137299-145137321 CCCCCTCCCACACTGACTCTGGG + Intergenic
1202375389 Y:24230666-24230688 TCCCATCCCACAGTGAATCTAGG + Intergenic
1202495391 Y:25439453-25439475 TCCCATCCCACAGTGAATCTAGG - Intergenic