ID: 1034275988

View in Genome Browser
Species Human (GRCh38)
Location 7:149824078-149824100
Sequence TCCCACAGTGAATGCCGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034275974_1034275988 30 Left 1034275974 7:149824025-149824047 CCCGGAGGTCCTGGACTGGGTCC No data
Right 1034275988 7:149824078-149824100 TCCCACAGTGAATGCCGGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 56
1034275979_1034275988 2 Left 1034275979 7:149824053-149824075 CCCTTAGTCTACCCTGACTACCC No data
Right 1034275988 7:149824078-149824100 TCCCACAGTGAATGCCGGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 56
1034275982_1034275988 -10 Left 1034275982 7:149824065-149824087 CCTGACTACCCCCTCCCACAGTG No data
Right 1034275988 7:149824078-149824100 TCCCACAGTGAATGCCGGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 56
1034275980_1034275988 1 Left 1034275980 7:149824054-149824076 CCTTAGTCTACCCTGACTACCCC No data
Right 1034275988 7:149824078-149824100 TCCCACAGTGAATGCCGGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 56
1034275981_1034275988 -9 Left 1034275981 7:149824064-149824086 CCCTGACTACCCCCTCCCACAGT No data
Right 1034275988 7:149824078-149824100 TCCCACAGTGAATGCCGGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 56
1034275977_1034275988 9 Left 1034275977 7:149824046-149824068 CCTGCCTCCCTTAGTCTACCCTG No data
Right 1034275988 7:149824078-149824100 TCCCACAGTGAATGCCGGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 56
1034275978_1034275988 5 Left 1034275978 7:149824050-149824072 CCTCCCTTAGTCTACCCTGACTA No data
Right 1034275988 7:149824078-149824100 TCCCACAGTGAATGCCGGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 56
1034275975_1034275988 29 Left 1034275975 7:149824026-149824048 CCGGAGGTCCTGGACTGGGTCCT No data
Right 1034275988 7:149824078-149824100 TCCCACAGTGAATGCCGGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 56
1034275976_1034275988 21 Left 1034275976 7:149824034-149824056 CCTGGACTGGGTCCTGCCTCCCT No data
Right 1034275988 7:149824078-149824100 TCCCACAGTGAATGCCGGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034275988 Original CRISPR TCCCACAGTGAATGCCGGCG TGG Intergenic
900336988 1:2169273-2169295 GCCAAGAGTGAAGGCCGGCGAGG + Intronic
910813797 1:91266411-91266433 TTCCACAGTGAATACCAGCTGGG - Intronic
914478187 1:148041692-148041714 TCCCACAGTGAGGGCAGGGGAGG + Intergenic
917529232 1:175819176-175819198 TCCCACTGAGAATGCAGGTGAGG - Intergenic
919001809 1:191842147-191842169 TCTCACAGTGAATGCAAGCACGG + Intergenic
923281178 1:232444505-232444527 TTCCAGAGTGAATGCAGGAGAGG - Intronic
924009688 1:239651469-239651491 TCGCACAGAGAATGCTGGTGGGG + Intronic
1067134054 10:43592827-43592849 AGCCACAGGGAATGCCGGCTTGG - Intergenic
1086321047 11:85648020-85648042 GGCCACAGTGAACTCCGGCGTGG + Exonic
1088074823 11:105834533-105834555 TCCCACAGAGAATGCTAGCATGG - Intronic
1093009183 12:14086333-14086355 ACCCTCAGTGAATGCTGGTGGGG - Intergenic
1100222649 12:92522494-92522516 TTCAACAGTGAATGCTGGCAGGG + Intergenic
1101072263 12:101088058-101088080 TCTCACAGTAAAAGCCTGCGAGG + Intronic
1103705070 12:122867104-122867126 TCCTCCAGTGAGCGCCGGCGCGG - Exonic
1109880909 13:68474969-68474991 TCCCACATTGAATTCCTGCCAGG + Intergenic
1110264600 13:73523064-73523086 TGGCACAGTGAATGCTGGAGTGG - Intergenic
1112723486 13:102274269-102274291 TCCCACAGTGAATCCCACCTTGG + Intronic
1113297043 13:108970514-108970536 TCCCACAGGCAAGGCCTGCGGGG + Intronic
1119614589 14:76090797-76090819 TCTTAAAGTGAATGCCTGCGTGG - Intergenic
1122152213 14:99731351-99731373 ACCCCCAGTGACTGCCGGGGAGG - Intergenic
1122937885 14:104968262-104968284 TACCACAGTGAAAGCCGCAGAGG + Intronic
1130900470 15:88203139-88203161 TCCCACAGTGATTGCTAGCTCGG + Intronic
1141561733 16:84873006-84873028 TCCCGTAGTGGATGGCGGCGCGG - Exonic
1144180356 17:12745826-12745848 TCCCAAAGTGATTGCCTGCAAGG - Intronic
1145949190 17:28802685-28802707 TCACACAGTGTATCCCTGCGTGG + Intronic
1149047757 17:52267385-52267407 TCCTACATTTAATGCAGGCGGGG + Intergenic
1151492817 17:74442908-74442930 CCCCACACTGAATGCCGGTCGGG + Intronic
1154941414 18:21116248-21116270 TCCCACACTGAATCCGGGCTGGG + Intergenic
1159556940 18:69955614-69955636 TCCCAAAGTGAAGGCCGAGGCGG + Intronic
1160912739 19:1482337-1482359 TGCCAGGGTGAGTGCCGGCGGGG - Exonic
1165329079 19:35131473-35131495 GCCCACCGTGAATGCCAGCGTGG - Exonic
934912628 2:98273508-98273530 GCCCACAGGGCATGCAGGCGAGG - Intronic
937779251 2:125818719-125818741 TCCCACATTGGATGTCGGCTTGG - Intergenic
942453869 2:176124639-176124661 GCCCACGGTGAAGCCCGGCGGGG + Exonic
1173224822 20:41156300-41156322 GCCCACAGTGAATGCTGCCTGGG - Intronic
1179018304 21:37614261-37614283 TGCCACAGTGCATGCAGGGGAGG + Exonic
1179926570 21:44538360-44538382 TCCCACAGATGATGCCGGTGCGG - Intronic
1182016355 22:27043364-27043386 TCCCACAGTGAAAGCCAGCTTGG + Intergenic
953389795 3:42527548-42527570 TCCCACAGTGGAGCCCAGCGTGG + Intronic
967835353 3:193958007-193958029 TCCCACAGTGAATGCTGTGACGG + Intergenic
968156515 3:196385608-196385630 TCCCAGAGTGGGTGGCGGCGGGG - Intronic
969447484 4:7253528-7253550 TCCCCCACTGAGTGCCGGGGCGG + Intronic
978765747 4:112403209-112403231 TCCCAAAATGTATGCCGGGGAGG - Intronic
983918386 4:173316505-173316527 TCCCAGAGTGAATGGAGGCAGGG + Intronic
989592130 5:43121562-43121584 TCCCTCAGTGAGTGCCGGCCCGG + Intronic
997702342 5:135911465-135911487 TTCAACAGTGAATGCCAGCGGGG + Intergenic
1012449754 6:99342793-99342815 TCACACAGTGGATGCCAGAGGGG - Intronic
1012954644 6:105555970-105555992 TCCTACTGTGAATGACGGAGTGG - Intergenic
1013221373 6:108080579-108080601 TCCCACTGTGAAAGCCAGCTGGG + Intronic
1018630857 6:165821195-165821217 TTGCACAGTGGATGCCGGCCTGG + Intronic
1020200685 7:6077464-6077486 TCCCACAGTGAGGGCTGGCTAGG - Intergenic
1020265589 7:6557844-6557866 TTCCACAGAGAATGCCGCAGTGG + Intergenic
1027482202 7:78712285-78712307 TCCCCCACTGAATGCCTGCCTGG + Intronic
1034275988 7:149824078-149824100 TCCCACAGTGAATGCCGGCGTGG + Intergenic
1034500733 7:151448792-151448814 TCCCACCCTGAAAGCCAGCGAGG + Intergenic
1038257684 8:25965789-25965811 TCCCACAGTGAAAGATGGGGAGG + Intronic
1060839454 9:126782236-126782258 GCACACAGTGAATGCAGGTGAGG - Intergenic
1061419033 9:130463416-130463438 GCCCACAGAGGATGCAGGCGAGG + Intronic
1185484697 X:473522-473544 ACACACGGTGAATGCCGGCCGGG - Intergenic
1190825891 X:54017680-54017702 CCTCACAGTGAATGATGGCGAGG + Exonic
1199988589 X:152970496-152970518 TCCCACAGTGAATGGTGTCACGG - Exonic