ID: 1034275990

View in Genome Browser
Species Human (GRCh38)
Location 7:149824079-149824101
Sequence CCCACAGTGAATGCCGGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 53}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034275979_1034275990 3 Left 1034275979 7:149824053-149824075 CCCTTAGTCTACCCTGACTACCC No data
Right 1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG 0: 1
1: 0
2: 2
3: 2
4: 53
1034275980_1034275990 2 Left 1034275980 7:149824054-149824076 CCTTAGTCTACCCTGACTACCCC No data
Right 1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG 0: 1
1: 0
2: 2
3: 2
4: 53
1034275975_1034275990 30 Left 1034275975 7:149824026-149824048 CCGGAGGTCCTGGACTGGGTCCT No data
Right 1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG 0: 1
1: 0
2: 2
3: 2
4: 53
1034275981_1034275990 -8 Left 1034275981 7:149824064-149824086 CCCTGACTACCCCCTCCCACAGT No data
Right 1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG 0: 1
1: 0
2: 2
3: 2
4: 53
1034275978_1034275990 6 Left 1034275978 7:149824050-149824072 CCTCCCTTAGTCTACCCTGACTA No data
Right 1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG 0: 1
1: 0
2: 2
3: 2
4: 53
1034275976_1034275990 22 Left 1034275976 7:149824034-149824056 CCTGGACTGGGTCCTGCCTCCCT No data
Right 1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG 0: 1
1: 0
2: 2
3: 2
4: 53
1034275977_1034275990 10 Left 1034275977 7:149824046-149824068 CCTGCCTCCCTTAGTCTACCCTG No data
Right 1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG 0: 1
1: 0
2: 2
3: 2
4: 53
1034275982_1034275990 -9 Left 1034275982 7:149824065-149824087 CCTGACTACCCCCTCCCACAGTG No data
Right 1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG 0: 1
1: 0
2: 2
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034275990 Original CRISPR CCCACAGTGAATGCCGGCGT GGG Intergenic
900955405 1:5883592-5883614 CCCACAGTGAATGGAGGTGCTGG - Intronic
904291305 1:29487781-29487803 GCCACAGTGAAGGCTGGGGTAGG + Intergenic
907437975 1:54461849-54461871 CCTGCAGTGAATGCCAGCATGGG + Intergenic
1063003545 10:1946657-1946679 CTCACAGTGAATACTGGCTTTGG + Intergenic
1063267781 10:4473591-4473613 CCCATAGTGGATGCGGGCATGGG + Intergenic
1064555726 10:16545479-16545501 CCCACAGGAAATGCTGGAGTGGG + Intergenic
1078045196 11:7907440-7907462 CCCACAGTGAATCCCTGGCTTGG + Intergenic
1084762597 11:71283412-71283434 CCCAAAGTCAATGCCGTGGTGGG - Intergenic
1087967515 11:104436085-104436107 CCAACACTGAATACCGGAGTGGG + Intergenic
1100464535 12:94833633-94833655 CCCAGAGAGAACGCCGCCGTGGG + Intergenic
1110264599 13:73523063-73523085 GGCACAGTGAATGCTGGAGTGGG - Intergenic
1112723488 13:102274270-102274292 CCCACAGTGAATCCCACCTTGGG + Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1122152211 14:99731350-99731372 CCCCCAGTGACTGCCGGGGAGGG - Intergenic
1125734044 15:41911456-41911478 CCGACAGTGAATGCCTGGCTTGG + Intronic
1131542798 15:93288899-93288921 TCCACAGTGAATGGCAGCATGGG - Intergenic
1132665644 16:1080266-1080288 CCCAGAGGGAAGGCCGGCATGGG - Intergenic
1132746630 16:1438928-1438950 CCCACAGAGAATGAAGGCCTCGG - Exonic
1133051483 16:3119664-3119686 CCCGCAGTCAGTGCAGGCGTAGG - Exonic
1138099803 16:54243687-54243709 GCCACAGTGAATGCTGGGGAAGG - Intergenic
1146061697 17:29611268-29611290 CCCACAGTGCCTGCCGGGGCAGG + Intronic
1148049241 17:44761007-44761029 CCCCCAGTGACTGCGGGCCTTGG - Intronic
1151492819 17:74442909-74442931 CCCACACTGAATGCCGGTCGGGG + Intronic
1154375807 18:13808739-13808761 CCCACAGTGAATTTCCTCGTGGG - Intergenic
1162060908 19:8094632-8094654 CACACAGTGATTGCAGGTGTTGG - Intronic
1165329077 19:35131472-35131494 CCCACCGTGAATGCCAGCGTGGG - Exonic
937119533 2:119432009-119432031 CCCACCGCGAGCGCCGGCGTCGG + Intronic
1178022936 21:28430707-28430729 GCCACACTGAATGCCAGGGTGGG - Intergenic
1185095237 22:48802815-48802837 CCCACAGAGGGTCCCGGCGTGGG - Intronic
951140218 3:19149048-19149070 CCCACAGTGAATACGGGCGTCGG - Intronic
960164126 3:114382625-114382647 CCCACAGTGAATTCCTCCCTAGG + Intronic
961571769 3:127804413-127804435 CCCACAGTGACTCCCTGAGTAGG + Intronic
967969559 3:194988976-194988998 CCCATAAGGAATGCTGGCGTTGG - Intergenic
974783487 4:66585819-66585841 CCCACAGGGAATTCTGGAGTTGG - Intergenic
977957144 4:103042124-103042146 CCCACAGTGAATGCTGTCTATGG + Intronic
983891105 4:173031081-173031103 CCCACTGTGGATGCTGGCTTTGG + Intronic
984890341 4:184486460-184486482 CCAACAGTGAAAGCCTGCCTCGG + Intergenic
1002665247 5:180818522-180818544 GCCACAGTGAATTCCAACGTAGG - Intergenic
1004559257 6:16731783-16731805 ACCACAGAGAATGCCAGTGTAGG - Intronic
1011054843 6:83193655-83193677 CCCACAGTGAGCGCCGCCGGCGG + Intronic
1012954642 6:105555969-105555991 CCTACTGTGAATGACGGAGTGGG - Intergenic
1017566881 6:155696324-155696346 CCCGCAGTGAATGCCTGCCTCGG - Intergenic
1020013537 7:4818638-4818660 CCCACAGCGAGTGCCGGCAAAGG + Intronic
1020265590 7:6557845-6557867 TCCACAGAGAATGCCGCAGTGGG + Intergenic
1026829351 7:73601498-73601520 CCCAGAGAGAATGCCAGGGTGGG + Intronic
1029358595 7:100071530-100071552 CCCACATTCATTGCAGGCGTAGG + Exonic
1032784536 7:135190109-135190131 CCCATAGTGAAAGCCGGCTTTGG - Intronic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1034964719 7:155384032-155384054 CCCCCAGAGAAGGCGGGCGTGGG - Intronic
1049282185 8:141755318-141755340 CCTACTGTGAATGCCTGCTTTGG + Intergenic
1054804728 9:69386926-69386948 CCCACAGTGAAGGCAGGTCTTGG - Intronic
1055970077 9:81903055-81903077 TCCACAGTGGATGCAGGGGTGGG - Intergenic
1056660005 9:88536232-88536254 CCCACAGTGCAGGCCGTGGTTGG + Intronic
1060839453 9:126782235-126782257 CACACAGTGAATGCAGGTGAGGG - Intergenic
1060920292 9:127415751-127415773 CTCACAGTGAATGCCAGGTTTGG - Intergenic
1190825892 X:54017681-54017703 CTCACAGTGAATGATGGCGAGGG + Exonic
1195470133 X:105220707-105220729 CCCAGAGTAAAAGCCGACGTTGG - Intronic
1198674866 X:139120769-139120791 CCCACAGTGCCTGAAGGCGTAGG - Intronic