ID: 1034275992

View in Genome Browser
Species Human (GRCh38)
Location 7:149824080-149824102
Sequence CCACAGTGAATGCCGGCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 73}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034275981_1034275992 -7 Left 1034275981 7:149824064-149824086 CCCTGACTACCCCCTCCCACAGT No data
Right 1034275992 7:149824080-149824102 CCACAGTGAATGCCGGCGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 73
1034275976_1034275992 23 Left 1034275976 7:149824034-149824056 CCTGGACTGGGTCCTGCCTCCCT No data
Right 1034275992 7:149824080-149824102 CCACAGTGAATGCCGGCGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 73
1034275977_1034275992 11 Left 1034275977 7:149824046-149824068 CCTGCCTCCCTTAGTCTACCCTG No data
Right 1034275992 7:149824080-149824102 CCACAGTGAATGCCGGCGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 73
1034275980_1034275992 3 Left 1034275980 7:149824054-149824076 CCTTAGTCTACCCTGACTACCCC No data
Right 1034275992 7:149824080-149824102 CCACAGTGAATGCCGGCGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 73
1034275979_1034275992 4 Left 1034275979 7:149824053-149824075 CCCTTAGTCTACCCTGACTACCC No data
Right 1034275992 7:149824080-149824102 CCACAGTGAATGCCGGCGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 73
1034275978_1034275992 7 Left 1034275978 7:149824050-149824072 CCTCCCTTAGTCTACCCTGACTA No data
Right 1034275992 7:149824080-149824102 CCACAGTGAATGCCGGCGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 73
1034275982_1034275992 -8 Left 1034275982 7:149824065-149824087 CCTGACTACCCCCTCCCACAGTG No data
Right 1034275992 7:149824080-149824102 CCACAGTGAATGCCGGCGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034275992 Original CRISPR CCACAGTGAATGCCGGCGTG GGG Intergenic
900564954 1:3327666-3327688 GCACAGTGGATGATGGCGTGCGG + Intronic
904291307 1:29487782-29487804 CCACAGTGAAGGCTGGGGTAGGG + Intergenic
908831184 1:68180124-68180146 CCACAGTGATAGCTGGCATGGGG - Intronic
911157966 1:94655208-94655230 CCACACTGAATACAGGGGTGGGG - Intergenic
916365148 1:164017780-164017802 CCACAATGAATACTGGTGTGAGG + Intergenic
916689162 1:167173964-167173986 CCACAGGGAAGGCTGGAGTGGGG + Intergenic
1063267783 10:4473592-4473614 CCATAGTGGATGCGGGCATGGGG + Intergenic
1067264321 10:44724071-44724093 CCACAGTGATTCCAGGCATGGGG + Intergenic
1070489782 10:76965626-76965648 CCACAGTAAATGCCTGGGTGTGG - Intronic
1072143430 10:92611470-92611492 CCAAAGTGATTACAGGCGTGAGG + Intronic
1074591949 10:114821964-114821986 CCAGAGTGAAGGCCGGTGCGGGG - Exonic
1077190462 11:1253991-1254013 CCACTGTGACTGCCGCCTTGGGG - Intronic
1086311075 11:85536907-85536929 CCACAGTGAATGCCAGTGAGAGG + Intronic
1087242100 11:95790882-95790904 CCACAGTGAATGGAAGCTTGGGG - Intronic
1087967516 11:104436086-104436108 CAACACTGAATACCGGAGTGGGG + Intergenic
1088867781 11:113865102-113865124 CCAAAGTGATTACAGGCGTGAGG + Intronic
1092819376 12:12339071-12339093 CCACAGTGAACACCAGTGTGTGG - Intronic
1094073732 12:26449783-26449805 CCACACTAAATGCCAGTGTGAGG + Intronic
1096976846 12:55704072-55704094 CCAGAGTGAAGGCGGGGGTGAGG + Intronic
1097547603 12:61023708-61023730 CCACAGTGAGTGCCAGTGAGAGG + Intergenic
1100464537 12:94833634-94833656 CCAGAGAGAACGCCGCCGTGGGG + Intergenic
1103479259 12:121240726-121240748 CCGCAGTGGATGCATGCGTGCGG + Exonic
1110264598 13:73523062-73523084 GCACAGTGAATGCTGGAGTGGGG - Intergenic
1112723490 13:102274271-102274293 CCACAGTGAATCCCACCTTGGGG + Intronic
1117376144 14:55120091-55120113 CCACAGTGAAGGCTGCGGTGAGG - Intergenic
1121077168 14:91078522-91078544 AGACAGTGAATGAAGGCGTGGGG - Intronic
1126325024 15:47467310-47467332 CCACAGTGATTTCCAGGGTGGGG - Intronic
1129408537 15:75336196-75336218 ACACAGTGTGTGCGGGCGTGAGG + Intronic
1131542796 15:93288898-93288920 CCACAGTGAATGGCAGCATGGGG - Intergenic
1132847087 16:2005641-2005663 CCACGGTGGATGAGGGCGTGCGG - Intronic
1135558013 16:23453229-23453251 CCATAGTGACTGCAGGCGTCCGG + Intergenic
1138099801 16:54243686-54243708 CCACAGTGAATGCTGGGGAAGGG - Intergenic
1142451592 16:90175800-90175822 CCTCACTGAATGCAGGCCTGGGG + Intergenic
1144405370 17:14947905-14947927 CCACAGTGAACACAGGCATGTGG + Intergenic
1148959715 17:51383359-51383381 CCAAAGTGATTGCAGGCATGAGG + Intergenic
1151401539 17:73858907-73858929 CCAGAGTGAAGGCCGGGATGTGG - Intergenic
1151573127 17:74937002-74937024 CCACAGTGAACTCCAGCCTGAGG - Intronic
1152781116 17:82227842-82227864 CCTCTGTGAATGCCAGCGGGAGG + Intergenic
1154404417 18:14075532-14075554 CCACAGAGAATGCCTGCTTTTGG - Intronic
1160020872 18:75179987-75180009 GCACAGAGAATGCCAGTGTGTGG + Intergenic
1163405392 19:17118927-17118949 CCTCAGTGCAGGCCGGCCTGAGG + Intronic
1164603704 19:29580589-29580611 CCACCGTGAATGGCTCCGTGTGG - Intergenic
1165329075 19:35131471-35131493 CCACCGTGAATGCCAGCGTGGGG - Exonic
1168600817 19:57717022-57717044 CCACAGAGAATACTCGCGTGAGG + Intronic
929604767 2:43226858-43226880 CCCCAGTGGATGCCGCCGGGTGG + Intergenic
937145434 2:119640307-119640329 TCACAGTGAATGCCAGCCTGTGG - Intronic
948116403 2:235496557-235496579 ACACTGTGAAAGCCGGCGTCAGG + Intronic
1172645248 20:36465167-36465189 CCACAGGGCATGCGGGGGTGGGG - Intronic
1179255600 21:39712755-39712777 CCACGGTGAATGCTGTCTTGGGG + Intergenic
1180004867 21:45015696-45015718 CCAGCGTGAATGCAGCCGTGAGG + Intergenic
1183512956 22:38246489-38246511 CCACAGTCACAGCCGGAGTGAGG - Intronic
1185095235 22:48802814-48802836 CCACAGAGGGTCCCGGCGTGGGG - Intronic
954464669 3:50647371-50647393 CCACACTGAATGGCGTAGTGAGG - Intronic
956146779 3:66198653-66198675 TCACAGTGAGTGCCGGAGTTAGG - Intronic
960600117 3:119448852-119448874 CCACAGTGATTAGCGGCTTGGGG - Intronic
965135463 3:164760812-164760834 CCACAGTGAATGACAGATTGAGG - Intergenic
979040733 4:115789622-115789644 CCACAGGGAATGCTGGTATGTGG + Intergenic
988631746 5:32938791-32938813 CCAAAGTGAATGACAGAGTGGGG + Intergenic
995541275 5:113188440-113188462 CCACAGTGACTGCAGGGGTATGG + Intronic
995714298 5:115067111-115067133 CCACTGTGAAGGCTGGTGTGTGG + Intergenic
1000997261 5:167971913-167971935 CCACTATAAATGCCGGAGTGGGG + Intronic
1001496930 5:172195038-172195060 CCAGAGTTAATGCCTGAGTGGGG - Intronic
1002665245 5:180818521-180818543 CCACAGTGAATTCCAACGTAGGG - Intergenic
1004549873 6:16636393-16636415 CCACAGTGAAGGGCTGCCTGGGG - Intronic
1004658910 6:17692320-17692342 GCACAGTGAATGACAGCATGAGG + Intronic
1012954641 6:105555968-105555990 CTACTGTGAATGACGGAGTGGGG - Intergenic
1017566879 6:155696323-155696345 CCGCAGTGAATGCCTGCCTCGGG - Intergenic
1019536137 7:1530821-1530843 CGACAGTGAGCGCCGGCGCGAGG + Exonic
1029476394 7:100787484-100787506 CCACAGGGGATGCCACCGTGGGG + Intronic
1034275992 7:149824080-149824102 CCACAGTGAATGCCGGCGTGGGG + Intergenic
1035286306 7:157809522-157809544 GCACAGTGAATGCCGCCTTCTGG + Intronic
1037787703 8:21912369-21912391 CCTCAGTGACTGCCTGCGGGTGG - Exonic
1037806221 8:22059112-22059134 CCACAGTAACTGCGGGGGTGGGG + Intronic
1040871763 8:52107079-52107101 CCAGAGTGGATGCCGGCACGGGG - Intergenic
1040883800 8:52237206-52237228 CCACAATGAATGCCCCAGTGTGG + Intronic
1047508118 8:125495872-125495894 ACACAGTGGATGCTGGCGTTAGG + Intergenic
1052375371 9:27712907-27712929 CCAGAGTGAATGCAGGCGAGAGG + Intergenic
1055970075 9:81903054-81903076 CCACAGTGGATGCAGGGGTGGGG - Intergenic
1060839452 9:126782234-126782256 ACACAGTGAATGCAGGTGAGGGG - Intergenic
1061989212 9:134149132-134149154 CCCCAGTGACTGTTGGCGTGGGG + Intronic
1195280775 X:103330688-103330710 CCTCACTCAATGCCGGCCTGTGG + Intronic
1201067853 Y:10116288-10116310 GGACAGTGAATGCCGGGCTGAGG + Intergenic