ID: 1034276761

View in Genome Browser
Species Human (GRCh38)
Location 7:149827240-149827262
Sequence CCAGTGAGGAAACTGAGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1131
Summary {0: 1, 1: 0, 2: 22, 3: 166, 4: 942}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034276752_1034276761 17 Left 1034276752 7:149827200-149827222 CCAGGGCTGTGATGCCAGGAAGT 0: 1
1: 0
2: 2
3: 22
4: 271
Right 1034276761 7:149827240-149827262 CCAGTGAGGAAACTGAGGTCTGG 0: 1
1: 0
2: 22
3: 166
4: 942
1034276755_1034276761 3 Left 1034276755 7:149827214-149827236 CCAGGAAGTGGAAGGTTCTTTCC 0: 1
1: 0
2: 1
3: 23
4: 165
Right 1034276761 7:149827240-149827262 CCAGTGAGGAAACTGAGGTCTGG 0: 1
1: 0
2: 22
3: 166
4: 942

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034276761 Original CRISPR CCAGTGAGGAAACTGAGGTC TGG Intergenic
900204399 1:1425929-1425951 GCAGAGGGGAAACTGAGGTGGGG + Intergenic
900238663 1:1604498-1604520 CCAGGGAGAAAACAGAGGCCTGG - Intergenic
900255554 1:1696624-1696646 CAGGTGGGGAAACTGAGGCCGGG + Intronic
900264230 1:1749326-1749348 CAGGTGGGGAAACTGAGGCCGGG + Intergenic
900342321 1:2194893-2194915 CCTGTAGGGAAACTGAGGCCAGG + Intronic
900387652 1:2417853-2417875 CAGGTGAGGAAGCTGAGGCCAGG - Intergenic
900589422 1:3453204-3453226 CCCGTGAGGGGACTGAGGTGCGG - Intergenic
901217662 1:7563716-7563738 CCATTGGGGAAACTGAGTCCTGG + Intronic
901252177 1:7788205-7788227 CCAGAAAGGAAGCTGAGCTCTGG - Exonic
901328844 1:8388875-8388897 GCAGTGGGAAAAGTGAGGTCAGG - Intronic
901448473 1:9322293-9322315 CAGGTGGGGAAACTGAGGTTCGG + Intronic
901679130 1:10903008-10903030 CAGGTGAGGAAACTGAGGCCGGG + Intergenic
901681027 1:10912936-10912958 CAGGTGGCGAAACTGAGGTCTGG + Intergenic
901774954 1:11554151-11554173 CCAGTGGGGATACTCAGGTGTGG - Intergenic
901878842 1:12182107-12182129 CCAGGGAGGAAACACAGGACTGG + Intronic
901952693 1:12761254-12761276 CAAGAGGGGAAACTGAGGCCCGG + Exonic
902137655 1:14324203-14324225 CCAGAGAGGAAACTGTAGTCAGG - Intergenic
902295614 1:15464853-15464875 CAGATGAGGAAACTGAGGTTCGG - Intronic
902298508 1:15484755-15484777 CAGATGAGGAAACTGAGGTTCGG - Intronic
902398455 1:16144834-16144856 CAGATGAGGAAACTGAGGTCCGG - Intronic
902627633 1:17685803-17685825 CAATTGAGGAAACTGAGGCCTGG + Intronic
902633693 1:17720803-17720825 CCAATGAAGAAACTAAGGCCTGG - Intergenic
902658907 1:17887801-17887823 CAGGTGAGGAAACTGAGGCAGGG - Intergenic
902714398 1:18262463-18262485 TCAATGAGGAAACTGAGGCTTGG - Intronic
902787226 1:18740473-18740495 TAAATGAGGAAACTGAGGTACGG - Intronic
902809090 1:18878128-18878150 GGAGGGAGGAAACTGAGGCCGGG - Intronic
902813642 1:18903608-18903630 CAGATGAGGAAACTGAGGCCCGG - Intronic
902838987 1:19063558-19063580 CAGGTGAGGAAACTGAGCTTTGG - Intergenic
902885944 1:19404915-19404937 CAGATGAGGAAACTGAGGCCTGG + Intronic
903193096 1:21667765-21667787 CAGGTGAGGAAACTGAGGCTCGG - Intronic
903285488 1:22274358-22274380 CAGGTGAAGAAACTGAGGTTTGG + Intergenic
903294176 1:22333152-22333174 TCAATGAGGAGACTGAGGCCTGG + Intergenic
903295664 1:22341859-22341881 CAGATGAGGAAACTGAGGCCCGG + Intergenic
903306703 1:22417986-22418008 CAGATGAGGAAACTGAGGTCCGG - Intergenic
903351468 1:22719257-22719279 GAGATGAGGAAACTGAGGTCTGG + Intronic
903357161 1:22755223-22755245 CCGGTGAGAAAACTGAGGTCCGG + Intronic
903536617 1:24071235-24071257 CCAGTGATCAAACTGATCTCCGG - Exonic
904285162 1:29449274-29449296 TCAGTGAGGAAACTGAGGCAGGG - Intergenic
904395126 1:30215093-30215115 CAAGTGAGGAGAGTGAGGTCAGG - Intergenic
904420169 1:30386107-30386129 TCAGTGAGGAAACTGAGGCAGGG + Intergenic
904473615 1:30750845-30750867 CCAGGGAGGAAATTGAGGCTGGG + Intronic
904478061 1:30777259-30777281 GCTGTGAGGAAACAGAGGCCTGG - Intergenic
904565612 1:31426532-31426554 CAAGTGGGGAAACTGAGAGCTGG + Intronic
904827367 1:33282142-33282164 CCTGTGGGGACACAGAGGTCGGG - Intronic
904842353 1:33380858-33380880 CAAGTGTGGAAAATGAGGCCAGG - Intronic
905009599 1:34738549-34738571 CCACTGAGGACACTGAGGGCCGG + Intronic
905267808 1:36766824-36766846 CAAATGAGGAAACTGAGGCACGG - Intergenic
905447605 1:38037381-38037403 CCGATGAGGAAACTGAAGTTTGG + Intergenic
905529802 1:38668842-38668864 CAAGTGAGGAAAGTGAGATTGGG + Intergenic
905919845 1:41712067-41712089 CAAATGGGGAAACTGAGGTCCGG + Intronic
906024741 1:42663993-42664015 CATGTGAGGAAACTGAAGTCTGG - Intronic
906196883 1:43935176-43935198 CCGGAGAGGAAGCTGAGGGCTGG - Intronic
906969116 1:50492050-50492072 CAAGTGAGGAAACTGAGACCTGG - Intronic
907186282 1:52611855-52611877 CCAGTGAGAAAACGGAGGACAGG - Intergenic
907246127 1:53110211-53110233 TCACTGGGGAAACTGAGGCCTGG + Intronic
907323589 1:53620866-53620888 CAGATGAGGAAACTGAGATCTGG - Intronic
907440073 1:54473500-54473522 CCAAGGAGGAAACTGAGGCTTGG + Intergenic
907460453 1:54602425-54602447 CAGAGGAGGAAACTGAGGTCTGG + Intronic
907599171 1:55749489-55749511 TAAGTAAGCAAACTGAGGTCAGG + Intergenic
907676968 1:56526890-56526912 CCAGAGAGCAATCTGAGGTCAGG - Intronic
907896944 1:58700978-58701000 CAGGTGAGGTAACTGAGGCCTGG + Intergenic
908225698 1:62053758-62053780 CAGCTGAGGAAACTGAGGTTTGG - Intronic
908331029 1:63071273-63071295 CAAATGAGGAAACTGAGGCATGG + Intergenic
908519416 1:64926677-64926699 CTGATGACGAAACTGAGGTCTGG + Intronic
908779615 1:67677791-67677813 CAAATGAGGAAACTGAGGAATGG + Intergenic
909320301 1:74277214-74277236 TTAGTGAGGAAACTGAGGACTGG + Intronic
909660877 1:78080355-78080377 CAAATGAGGAAACTGAAGCCTGG - Intronic
911027587 1:93450642-93450664 CCATTGAGGAATTTGAGGTTGGG + Intronic
912456773 1:109803364-109803386 GCAGAGAGGAGAGTGAGGTCAGG + Intergenic
912526133 1:110284337-110284359 CCAGAGAGGAAACTGATTGCAGG + Intergenic
912819807 1:112857955-112857977 CCTGTGAAGAAACTAAGGCCTGG - Intergenic
913201944 1:116502031-116502053 CAGATGATGAAACTGAGGTCTGG + Intergenic
913209782 1:116572565-116572587 CAAATGAGGAAACTGATGCCTGG + Intergenic
913308494 1:117459404-117459426 CTAGTGGGGAAACAGAGGTTAGG + Intronic
913509862 1:119551726-119551748 CCAATGAGGAAACCGAGGCCTGG + Intergenic
913517343 1:119615813-119615835 CCGATGAGGAAACTGAGGCCTGG + Intergenic
913550182 1:119909980-119910002 CCAGTGAAGCAAATGAGATCAGG + Intergenic
913570925 1:120119332-120119354 CAGATGAGGAAACTGAGGTCTGG + Intergenic
913967129 1:143385645-143385667 CAAATGAGGAAACTGAGGCTGGG + Intergenic
914061506 1:144211252-144211274 CAAATGAGGAAACTGAGGCTGGG + Intergenic
914117644 1:144755117-144755139 CAAATGAGGAAACTGAGGCTGGG - Intergenic
914291733 1:146280308-146280330 CAGATGAGGAAACTGAGGTCTGG + Intergenic
914552777 1:148731091-148731113 CAGATGAGGAAACTGAGGTCTGG + Intergenic
914790880 1:150876523-150876545 CCGGTGAGGAGACGGAGGACTGG - Exonic
915545483 1:156594851-156594873 CCAGAAAGGAAACTGATCTCTGG - Intronic
915933045 1:160071907-160071929 CTGGTGAGGAGACTGAGGTGGGG + Intergenic
916195679 1:162220040-162220062 CCACTCAGGAGGCTGAGGTCAGG - Intronic
916288135 1:163133101-163133123 CTAGTGTGGAAGGTGAGGTCTGG + Intronic
916291340 1:163169693-163169715 CAGATGAGGGAACTGAGGTCTGG - Intronic
916476247 1:165171882-165171904 TCAATGAGGAAACTGAAGCCTGG - Intergenic
916850225 1:168695873-168695895 CCAGTAAGGAAAATGAGTGCAGG - Exonic
917172093 1:172188214-172188236 CAAGTAATGAAACTGAGGCCAGG + Intronic
917488674 1:175478708-175478730 CCACTGAGGAAAAGGAGATCAGG + Intronic
917656932 1:177135698-177135720 CAAATGATGAAACTGAGGCCTGG - Intronic
919500443 1:198331251-198331273 CAAGTGTAGCAACTGAGGTCAGG + Intergenic
919550878 1:198985335-198985357 CAAGTGAAGAAACTGAGGCTAGG - Intergenic
920048284 1:203147729-203147751 GCTGTGAAGAAACTGAGGACAGG - Intronic
920295817 1:204955612-204955634 CATGGGAAGAAACTGAGGTCCGG - Intronic
921001394 1:211047581-211047603 CAGGTGAGGAAACTGAGGCATGG - Intronic
921100121 1:211921611-211921633 CAAATGAGGAAACTGAGGTCCGG + Intergenic
921377896 1:214492974-214492996 CCATTAAGGAAACTGAGCTAAGG + Intronic
921616883 1:217279255-217279277 CCAGTGATGAAACTGACTCCTGG - Intergenic
921708802 1:218352883-218352905 CAAGGGAAGAAACTGAGGCCTGG - Intronic
922057377 1:222054544-222054566 CACATGAGGAACCTGAGGTCAGG + Intergenic
922216664 1:223525641-223525663 CAGATGAGGAAACTGAGGCCTGG + Intergenic
922300230 1:224292859-224292881 CTACTTAGGAAACTGAGGTAGGG - Intronic
922333649 1:224600618-224600640 CTATTCAGGAAGCTGAGGTCGGG - Intronic
922353831 1:224757665-224757687 CAGGTGAAGAAACTCAGGTCAGG + Intergenic
922858438 1:228795100-228795122 CCAGAAAGGAAACGGAGGTGGGG + Intergenic
923676139 1:236082142-236082164 CCAGTAAGGAAACCGAGGCTGGG + Intergenic
924458288 1:244235531-244235553 CCAGTGGGTCACCTGAGGTCAGG + Intergenic
924825997 1:247539616-247539638 CCAGTGAGGCAAGTTAAGTCTGG + Intronic
924954343 1:248912421-248912443 CCATTGAGGAAACTGAGGCATGG - Intronic
1063197200 10:3754442-3754464 CAGGTGAGCAAACTGAGGCCAGG - Intergenic
1063215052 10:3916955-3916977 CCAGTGAGGAAGCAGAGGCTTGG + Intergenic
1063336038 10:5215274-5215296 CCAGTGATGGAAGTGGGGTCTGG + Intronic
1063409933 10:5829662-5829684 CCACTCAGGAGACTGAGGTACGG + Intronic
1063707364 10:8443600-8443622 CCAGAGTGGAATCTTAGGTCGGG + Intergenic
1064090534 10:12379523-12379545 CCAGTGGATCAACTGAGGTCAGG + Intronic
1064356258 10:14621221-14621243 CCAGTGAGGAGAGTGAGATTTGG + Intronic
1064458888 10:15514341-15514363 AAAGGGAGGAAACTGAGGTCAGG - Exonic
1064662396 10:17618645-17618667 CCACTAAGGAAACTGAGGCATGG - Intergenic
1065124026 10:22555575-22555597 TAAGTAAGGAAACTGAGGTTTGG - Intronic
1065446536 10:25807994-25808016 CAAATGAGGAAACTGAGATAAGG + Intergenic
1065874262 10:29983462-29983484 CCAGTGAAGCTACTGAGGTCAGG - Intergenic
1067295208 10:44971682-44971704 CAAATGAGGAAACAGAGGCCAGG + Intronic
1067655739 10:48189962-48189984 TGAATGAGGAAACTGAGGCCTGG + Intronic
1068021429 10:51590281-51590303 CAAGTGAAGAAACTGAGGCTTGG + Intronic
1068149844 10:53117914-53117936 CCAATGAGGAAACTTAAGTTTGG + Intergenic
1068353688 10:55882773-55882795 CCAGTGGGCCACCTGAGGTCAGG + Intergenic
1068613880 10:59090360-59090382 CAAGTGAGAAAACTGAGGTTTGG + Intergenic
1069131260 10:64706231-64706253 GCATTGAGGAAAATGAGTTCTGG + Intergenic
1069335034 10:67338434-67338456 CCAGTGTTGAAACTGTGGCCTGG - Intronic
1069385949 10:67883907-67883929 CACGTGAGAAAACTGAGGCCCGG + Intergenic
1069595757 10:69669036-69669058 CTAGGGAGGAAACTGAGGCTGGG + Intergenic
1069760057 10:70803665-70803687 CAGATGAGGAAACTGAGGTCAGG - Intergenic
1069772854 10:70910591-70910613 CCAGTGTGGGAAGTGGGGTCTGG - Intergenic
1070391724 10:75976733-75976755 CTGATGAGGAAACTGAGGTATGG + Intronic
1070699746 10:78592853-78592875 GCAACAAGGAAACTGAGGTCCGG - Intergenic
1070824900 10:79385389-79385411 CTAATGGGGAAACTGAGGCCTGG + Exonic
1070826659 10:79394194-79394216 GGAGGGAGTAAACTGAGGTCCGG + Intronic
1070841786 10:79492456-79492478 CAGATGAGGAAACTGAGGTCTGG - Intergenic
1071411696 10:85403173-85403195 CCCAGGAGGAAACTGAGGCCAGG - Intergenic
1071471207 10:85985219-85985241 CAAGTGAGGAAACTGAGACTCGG + Intronic
1072452149 10:95547160-95547182 CCAGTGATGTATCTGAGGTCAGG - Intronic
1072741524 10:97912785-97912807 ACAGGAAGGAAACTGAGGCCTGG - Intronic
1072982403 10:100110403-100110425 CCAGTGAATCACCTGAGGTCAGG + Intergenic
1073516997 10:104085359-104085381 CGAGAGAGGAAACTGAGATTGGG + Intronic
1074145447 10:110713353-110713375 ACAGCAAGGAAACTGAGGCCAGG - Intronic
1074160240 10:110830895-110830917 CAAGTGAGGAAACTGAGGCTTGG + Intronic
1074163581 10:110855336-110855358 CCAGTGGATAACCTGAGGTCAGG + Intergenic
1074344943 10:112675891-112675913 CAGATGAGGAAACTGAGGTACGG - Intronic
1074435084 10:113427012-113427034 TCACTGAGGAAACTGAGCTGGGG - Intergenic
1074448894 10:113542918-113542940 CAGGTGAGGAAACTGAGGCATGG + Intergenic
1074773578 10:116749418-116749440 CAGGTAAGGAAACTGAGGCCCGG + Intergenic
1074904108 10:117845683-117845705 TGGGTGAGGAAATTGAGGTCTGG + Intergenic
1075078211 10:119365672-119365694 CTGGTGGGGAAACTGAGGCCGGG - Intronic
1075102522 10:119516408-119516430 CCCATGAGGACACAGAGGTCAGG + Intronic
1075317241 10:121462661-121462683 CCGGTGAGGAAGCTGAGCCCAGG + Intergenic
1075370212 10:121928632-121928654 CAGGTAAGGAAACTGAGGACCGG + Intronic
1075704235 10:124489892-124489914 CCAGTGAGAAAGCTGAGGCTGGG - Intronic
1075722127 10:124593384-124593406 CAGGTGTGGAAACTGAGGCCCGG - Intronic
1075819369 10:125292611-125292633 CTAATGAGGAAATTGAGGTTTGG - Intergenic
1075876818 10:125814391-125814413 CCATTGAGAAAACTGAGGCCAGG - Intronic
1076623381 10:131807253-131807275 TCAGTGGAGAAACTGAGGCCTGG - Intergenic
1076650277 10:131982363-131982385 CTAGTGGGGAAACTGAGGCGCGG + Intergenic
1077151190 11:1073853-1073875 CCAGTGGGTAAACTGAGGTCTGG - Intergenic
1077364687 11:2156812-2156834 CCAGGGAAGAGACTGAGGCCAGG - Intronic
1077366851 11:2164730-2164752 GCACTGGGGAAACTGAGGCCAGG - Intronic
1077524611 11:3056878-3056900 CAAGTGAGGAAACTGAGGCTGGG + Intronic
1077974604 11:7234780-7234802 CCAGTAAGGAAACTGAAGCATGG - Intergenic
1078359647 11:10658338-10658360 CAAATGAGGGAACTGAGGCCAGG - Intronic
1078469688 11:11577079-11577101 CAGATGAGGAAACTGAGCTCAGG - Intronic
1078506115 11:11947542-11947564 CTAGTGAGGAAATGGAGGTACGG + Intronic
1078558271 11:12348955-12348977 CCAGTGAAGAAGCAGAGGTTCGG + Intronic
1079107247 11:17579419-17579441 CAGGTGAAGAAACTGAGGCCAGG + Intronic
1079303275 11:19298421-19298443 TGAATGAGGAAACTGAGGCCAGG - Intergenic
1080265025 11:30391358-30391380 TCAATGAGGAACCTGAGGGCTGG - Intronic
1080395008 11:31882118-31882140 CCAATGAGGAAAGTCAGGTGTGG - Intronic
1080581608 11:33649015-33649037 TCAGTGAGGAAACTGAAGCTTGG + Intronic
1081121026 11:39266461-39266483 CAAGTGAGGAAACTGAGTTTGGG + Intergenic
1081240834 11:40704631-40704653 CAGTTGAGGAAACTGAGGTCCGG - Intronic
1081516126 11:43831958-43831980 CAGATGAGGAAACTGAGGTTAGG + Intronic
1081611681 11:44566605-44566627 CAGGTGAGGAAACTGAAGTTTGG - Intronic
1081716379 11:45253405-45253427 CAGATTAGGAAACTGAGGTCTGG - Intronic
1081792417 11:45797647-45797669 CAGAAGAGGAAACTGAGGTCTGG - Intergenic
1081905447 11:46666649-46666671 CCTGTGAGCTAACTGAGCTCAGG - Intronic
1083144728 11:60749744-60749766 CAGATGAGGAAACTGAGCTCAGG - Intergenic
1083172479 11:60931162-60931184 CAAGTGAAGAAACTGAGGCTTGG - Intronic
1083316535 11:61817943-61817965 ACAGTGAAGAAACTGAGCCCGGG + Intronic
1083364083 11:62130907-62130929 CAAGTGAGGAAACTGAGCTTCGG + Intronic
1083553596 11:63608881-63608903 CAGCTGAGGAAACTGAGGTTAGG - Intronic
1083661419 11:64253132-64253154 CAGAAGAGGAAACTGAGGTCTGG + Intronic
1083793922 11:65003608-65003630 CAACTGGGGAAACTGAGGCCTGG + Intergenic
1084460100 11:69292438-69292460 CAGATGAGGAAACTGAGGCCAGG - Intergenic
1084617916 11:70248669-70248691 TCATTGAGGAAACTGAGGCTTGG + Intergenic
1084750931 11:71204160-71204182 GGGGTGGGGAAACTGAGGTCTGG + Intronic
1085172517 11:74461401-74461423 CCAGTGGGTCACCTGAGGTCAGG + Intronic
1085395076 11:76203092-76203114 CAAGTGGGGAAACTGAGGCCCGG + Intronic
1085413407 11:76305321-76305343 CGAAAGAGGAAACTGAGGCCTGG + Intergenic
1085716468 11:78877913-78877935 TGGGTCAGGAAACTGAGGTCTGG + Intronic
1085718270 11:78891690-78891712 CAGGTGAGGAAACTGAGATGTGG + Intronic
1085930432 11:81076295-81076317 CCATAGAGAAAACTGATGTCAGG - Intergenic
1086001068 11:81986821-81986843 CCCGTGAGGCAGCTGAGGCCCGG + Intergenic
1086337910 11:85817614-85817636 CAAGTGGGAAAACTGAGGTAGGG - Intergenic
1086901922 11:92377309-92377331 CAAATGAGGATACTGAGGTGTGG + Intronic
1087927911 11:103941594-103941616 CCAATAAGAAAACTGAGATCAGG + Intronic
1088591644 11:111408500-111408522 CAGGTGAGGACACTGATGTCAGG - Intronic
1088961106 11:114665948-114665970 CAAGTGAGGAGACTGAGGTAGGG + Intergenic
1089125520 11:116174003-116174025 CCAATGTGGACACTGAGGCCTGG + Intergenic
1089134261 11:116236635-116236657 CAGGTGAGGAAAGTGAGTTCTGG - Intergenic
1089156742 11:116408662-116408684 CAGGTGAAGAAACTGAGGTCTGG + Intergenic
1089496694 11:118911650-118911672 TCAACGAGGAAACTGAGGTCTGG + Intronic
1089625748 11:119749576-119749598 CAGGTGAGGAAACTGAGGCACGG - Intergenic
1089780002 11:120866987-120867009 CAAGTGGGGAAACTGAGGCACGG + Intronic
1089802964 11:121052397-121052419 CAAATGAGGAAACTGAGATTTGG + Intronic
1089880288 11:121766690-121766712 CCTGGGAGGAAACCGGGGTCAGG + Intergenic
1089967207 11:122663380-122663402 TTAATGAGGAAACTGAGGTTTGG + Intronic
1090141809 11:124273411-124273433 CAAATGAGGAAACTGAGGCATGG + Intergenic
1090253061 11:125264434-125264456 CAAATTGGGAAACTGAGGTCAGG + Intronic
1090364090 11:126191875-126191897 CAGGTGAGGAAACTGAGGTCTGG + Intergenic
1090395805 11:126417082-126417104 ACAGAGGGGAAACTGAGGCCCGG + Intronic
1090905246 11:131068941-131068963 CCAGAGGGGAAACTTAGGACAGG - Intergenic
1090986229 11:131768537-131768559 TCATTGCGGAAACTGAGGTGAGG + Intronic
1091144658 11:133267391-133267413 CAAGTGAGAAAACTGAGGCTCGG - Intronic
1091166443 11:133480295-133480317 CAGATGAGGAAACTGTGGTCCGG + Intronic
1091177429 11:133574368-133574390 CCAGCCAGGTAACTGAGTTCTGG - Intergenic
1091280907 11:134380896-134380918 CCAGTGAGGGCAGTGAGGGCAGG + Intronic
1091602893 12:1928698-1928720 CCAGAGAGGGAACCGGGGTCCGG - Intergenic
1091681302 12:2529134-2529156 CCAGTGAGGCAAGTTAGGTTTGG + Intronic
1091801168 12:3325534-3325556 GAGGTGAAGAAACTGAGGTCTGG - Intergenic
1092347102 12:7724428-7724450 ACAGAGAGGAAACTGATGGCTGG + Intergenic
1092374774 12:7946295-7946317 CCAGTGAATCACCTGAGGTCAGG + Intergenic
1093054251 12:14538796-14538818 CCAGTGAATCACCTGAGGTCAGG + Intronic
1093886815 12:24470787-24470809 CAGTTGAGGAAACTGAGGTTTGG - Intergenic
1094269803 12:28600533-28600555 CAGGTGAGGAAACAGAGGCCTGG - Intergenic
1094321719 12:29191013-29191035 CCAGGGAGGGAAATGAGGACAGG - Intronic
1095271350 12:40223745-40223767 CTAGTGAGGAAATTGAGATTTGG - Intronic
1095454627 12:42370015-42370037 CCAGTGATGAAAGTAAGGCCTGG - Intronic
1095830112 12:46576514-46576536 CAGGTGAGGAAACTGAGGTTCGG + Intergenic
1096932510 12:55228726-55228748 CAGGTGAGGAAACTGAAGACAGG + Intergenic
1097156428 12:57015594-57015616 GTAGTGAGGAAACTGGGGTGGGG - Intronic
1097816583 12:64081014-64081036 CAAATGAGGAAACTGAGGGGAGG + Intronic
1098361270 12:69656687-69656709 CAAATGAGGAAACTGAGGCCTGG + Intronic
1098501405 12:71196660-71196682 CAGATGAGGAAACTGAGGTCTGG - Intronic
1098848491 12:75566812-75566834 CCAATGAATAACCTGAGGTCAGG + Intergenic
1100429651 12:94519267-94519289 CCAGTGTTGAAAGTGGGGTCTGG - Intergenic
1100639921 12:96472685-96472707 CCAGTGGGTCACCTGAGGTCAGG + Intergenic
1100804049 12:98262422-98262444 CCAGAGAGGAAAGCAAGGTCTGG + Intergenic
1101197613 12:102401368-102401390 CCAGAGAGGAAACTGTGGAATGG - Intronic
1101411556 12:104472947-104472969 GCAGTGAGGAGAGTGATGTCTGG + Intronic
1101530793 12:105571548-105571570 TCTGTGAAGAAACTGAGGCCTGG - Intergenic
1101846355 12:108366164-108366186 CCAATGAAGAAACTGAGGCCCGG - Intergenic
1101948940 12:109159497-109159519 CATGTGAGGAAACTGAGGCAGGG + Intronic
1102000139 12:109552439-109552461 TAAATGAGGAAACTGAGGCCTGG - Intergenic
1102187240 12:110958372-110958394 CCAGGGTGGAGACTGAGGTGAGG - Intergenic
1102254582 12:111408209-111408231 CAGATGAGGAAACTGAGGTGGGG - Intronic
1102455953 12:113070860-113070882 CAGATGAGGAAACTGAGGCCCGG - Intronic
1102458351 12:113084929-113084951 CCAGAGAGGAAGATGAGCTCAGG - Intronic
1102505366 12:113381192-113381214 CAAGTGAGGTCACTGAGGTCAGG - Intronic
1102530992 12:113546772-113546794 CAAATGAGGAAACTGAGGCACGG + Intergenic
1102696102 12:114800703-114800725 CGGGTGAGTCAACTGAGGTCAGG - Intergenic
1102831728 12:116008472-116008494 CCAGTGATGATGCTGAGTTCAGG - Exonic
1103284372 12:119787812-119787834 CAATTGAGGAAACTGAGGTTCGG - Intronic
1103508940 12:121460938-121460960 CAAGTGAGGAAACTGAGACATGG + Intronic
1103956265 12:124578499-124578521 ACAGAAAGGAAACTGAGGTATGG - Intergenic
1104120869 12:125798384-125798406 CTACTCAGGAAGCTGAGGTCGGG - Intergenic
1104154115 12:126114757-126114779 GCAGTCTGGAAACAGAGGTCAGG + Intergenic
1104749978 12:131232076-131232098 TGAGTGAGGAAACTGAGGCCTGG - Intergenic
1104798626 12:131537617-131537639 CCTGTGAGGAAACTGGTTTCCGG + Intergenic
1105784321 13:23733544-23733566 ACAGTGAGGACACAGAGCTCAGG + Intronic
1105861969 13:24423787-24423809 CTACTCAGGAAGCTGAGGTCGGG - Intronic
1106152912 13:27123269-27123291 CATCTGAGGAAACTGAGGTCTGG - Intronic
1106300576 13:28460623-28460645 CCAGTACTGAAACAGAGGTCTGG - Intronic
1106479491 13:30126335-30126357 ACAGTGAGAAACCTGAGGCCTGG + Intergenic
1106531798 13:30600121-30600143 CCAGTGAGGAAACTGTGATTAGG - Intronic
1106677557 13:31977132-31977154 CAACTGAGGAAACTGAGGCCTGG - Intergenic
1106699862 13:32217721-32217743 ACAATGAGGAAACTGAGGGGAGG - Intronic
1107401325 13:40072481-40072503 CCAGTCATGAAACTGAGCTTTGG - Intergenic
1107583987 13:41824050-41824072 TCAGAGAGGAAACTCAGGTAAGG - Intronic
1107826924 13:44337125-44337147 CGGATGAGGAAACTAAGGTCTGG - Intergenic
1108350494 13:49586255-49586277 CCAGCGAGTAAACTGAGGCCAGG + Intergenic
1108395350 13:49986097-49986119 ACAGTGGGGAAACTGAGGGTTGG - Intergenic
1108434684 13:50390159-50390181 GGAGGGAGGAAAGTGAGGTCAGG - Intronic
1108701435 13:52947695-52947717 CCACTGAGCAAGCTGAGGGCAGG + Intergenic
1109608360 13:64729211-64729233 CCTGTAAAGAAAGTGAGGTCAGG - Intergenic
1110114838 13:71800116-71800138 TAAATGAGGAAACTGAGGCCTGG - Intronic
1110424830 13:75355106-75355128 CCAGTGTGGACACTGAGGTTAGG - Intronic
1110566700 13:76964711-76964733 CCACTGAGTAAACTGAAGGCAGG + Intergenic
1111780447 13:92716958-92716980 CAAGTGAGGATACTGAAGTTTGG + Intronic
1112150141 13:96750381-96750403 CCAGTGAGGAAGGAGTGGTCTGG - Intronic
1112208214 13:97346818-97346840 CCAGCGAGGAAACTGTGCCCGGG + Exonic
1112768593 13:102772926-102772948 CCATTGAGGGCACTGAGGCCGGG - Intronic
1113025904 13:105940438-105940460 CAAATGAGGAAACTGAGGTCAGG - Intergenic
1113119841 13:106914431-106914453 CAAGTGAGGAAACTGAGGTTTGG + Intergenic
1113360897 13:109630646-109630668 CTACTGAGGAGACTGAGGTTGGG - Intergenic
1114447084 14:22797106-22797128 CACTTGAGAAAACTGAGGTCAGG + Intronic
1115161553 14:30402069-30402091 ACGATGAGGAAACTGAGGTACGG + Intergenic
1115236476 14:31212971-31212993 CCAGCCAGGAAACTGTGGTTTGG + Intergenic
1115518237 14:34206593-34206615 CCAGAGATAAAACTGAAGTCTGG + Intronic
1115714886 14:36092698-36092720 CCAGTAAAGAAACTCAGGTATGG - Intergenic
1116019223 14:39441140-39441162 CCAGAGTGGAAACTGAGAGCAGG - Intergenic
1118880507 14:69821833-69821855 CCAGTTAGAAAACTGAGGGGAGG - Intergenic
1119415437 14:74466494-74466516 CAAATGAAGAAACTGAGGCCAGG - Intergenic
1119515914 14:75248128-75248150 CAGATGAGGAAACTGAGGTTTGG + Intronic
1119709782 14:76813164-76813186 CAGGTGAGGAAACTGAGGGGCGG - Intronic
1120001258 14:79305789-79305811 CAGGTGAGGAAACTGAGGGCAGG - Intronic
1120404132 14:84072884-84072906 GCAAAGAAGAAACTGAGGTCTGG - Intergenic
1121120039 14:91370838-91370860 AGAGTCAGGAAACTGAGGTCCGG + Intronic
1121381716 14:93476307-93476329 CATATAAGGAAACTGAGGTCCGG - Intronic
1121528553 14:94637344-94637366 CGAGGGAAGAAACTGAGGCCTGG + Intergenic
1121540568 14:94722897-94722919 CTGATGAGGAAACTGAGGTTTGG - Intergenic
1121556916 14:94845092-94845114 CCTATGAGGAAACAGAGGCCAGG - Intergenic
1121632686 14:95432524-95432546 CCAATGAGGAAACTGAGGCACGG - Intronic
1121641850 14:95490001-95490023 CCATTGAGGAAACTGGGGTTTGG - Intergenic
1121661802 14:95640642-95640664 CAGATGAGGAAACTGAGGCCCGG + Intergenic
1121720959 14:96108394-96108416 CAGGTGGGGAAACTGAGGGCTGG - Intergenic
1121896438 14:97652474-97652496 CAAATGGGGAAACTGAGGTCAGG + Intergenic
1122036023 14:98949985-98950007 CCAGTGAGCACACAGAGGCCTGG - Intergenic
1122116665 14:99531047-99531069 CAGATGGGGAAACTGAGGTCTGG - Intronic
1122152727 14:99733442-99733464 CTGGTGAAGGAACTGAGGTCAGG - Intergenic
1122271216 14:100569127-100569149 CAGGTGAGGAAACTGAGGCCGGG - Intronic
1122392915 14:101402596-101402618 CAAGGGAGGAAACTGAGGCATGG - Intergenic
1122617952 14:103033840-103033862 CCAGTGAGGAAACTGCTGTGTGG - Intronic
1122822867 14:104355925-104355947 GCAGTGAGGACAATGAGGGCTGG - Intergenic
1122824036 14:104361020-104361042 CAGATGGGGAAACTGAGGTCTGG + Intergenic
1122971290 14:105153278-105153300 CAAATGGGGAAACTGAGGCCGGG + Intronic
1123117722 14:105902200-105902222 ACAGTGGGGAAACTGAGGCTTGG - Intergenic
1123980373 15:25596747-25596769 ACAGTGTGGAAGCTGAGGTCTGG - Intergenic
1124013894 15:25860767-25860789 CCGATGAGGAAACTGAGGTTGGG - Intronic
1124595579 15:31089122-31089144 ACAGTGTGGAAACTGAAGACAGG + Intronic
1125117999 15:36118392-36118414 CAGGTGAGGAAACTGAGGCATGG - Intergenic
1125195609 15:37042425-37042447 CCATTGAGGAAACTGAAGCCAGG + Intronic
1125502691 15:40249380-40249402 CAAATGAGGAAACTGAGGCTCGG - Intronic
1125534102 15:40433259-40433281 CAAATGAGGAAACTGAGACCTGG - Intronic
1125715053 15:41814970-41814992 CAGGTGAGGAAACTGAGGCTTGG - Intronic
1125968920 15:43896325-43896347 CAAATGAGGAAACCGAGGTTTGG - Intronic
1126173157 15:45711171-45711193 CAAGTAAGGAAACTGAGGCTTGG + Intergenic
1126369056 15:47926692-47926714 ACAGTGAGGAGGCTGAGGCCTGG - Intergenic
1126417021 15:48428298-48428320 CCAGTGTGGAGGCTGAGGTTAGG + Intronic
1127836640 15:62795900-62795922 CAGATGAGGAAACTGAGGTTTGG + Intronic
1127949362 15:63789500-63789522 TCAATAATGAAACTGAGGTCCGG + Intronic
1128098747 15:64980221-64980243 CAGATGAAGAAACTGAGGTCCGG - Intronic
1128114642 15:65097552-65097574 CAGATGAGGAAACTGAGGCCAGG - Intronic
1128134420 15:65252221-65252243 CCAGAGAGGAAGTTGAGGTATGG + Intronic
1128440004 15:67697980-67698002 CCAGTGAGGAGACTGAGACCTGG + Intronic
1128784908 15:70387671-70387693 CCAGTGAGGAAACTTGTGTCTGG + Intergenic
1128989869 15:72250825-72250847 CCAGTGAGGAGGCTGGGGGCTGG - Exonic
1129193902 15:73953108-73953130 CTCATGAGGAAACTGAGGCCCGG - Intergenic
1129312962 15:74725270-74725292 CTAGTGGGGAAACTGAGGCCAGG - Intronic
1129372905 15:75109261-75109283 CCAGTGAGGCAGCTGAGGCCAGG + Intronic
1129508233 15:76100853-76100875 CAGGTGAGGAAACTGAGGCCAGG + Intronic
1129538487 15:76333085-76333107 TCAGGAAGGAAACTGAGGCCTGG - Intergenic
1129692873 15:77723740-77723762 CAGGTGAAGAAACTGAGGCCTGG - Intronic
1129761347 15:78130979-78131001 CCGGTGGGGAAACTGAGGCACGG + Intronic
1129764309 15:78151719-78151741 CAGATGAGGAAACTGAGGCCAGG - Intronic
1130120268 15:81041903-81041925 GGAGAGAGGAAAGTGAGGTCAGG - Intronic
1130151973 15:81318098-81318120 CAAATGAGGAAACTGAGGTTTGG - Intronic
1130184594 15:81668318-81668340 AAGGTGAGGAAACTGAGGCCTGG - Intergenic
1130609256 15:85345773-85345795 CAATTGAGGAAACTGAGCTGGGG + Intergenic
1131020073 15:89089984-89090006 CAGGTGAGGAAACTGAGGCCTGG + Intronic
1131046548 15:89320046-89320068 CCAGTGGATAAAGTGAGGTCGGG - Intronic
1131768720 15:95710919-95710941 CAGGTGAGGAAACTGAGGCATGG + Intergenic
1131799100 15:96051517-96051539 CAAATGGGGAAACTGAGGTATGG - Intergenic
1132594178 16:740714-740736 CCAACAAGGAAACTGAGGCCAGG - Intronic
1132606927 16:797454-797476 CCAGATGGGAAACTGAGGCCTGG - Intronic
1132645410 16:997219-997241 CCAGTGGGGAGACAGAGCTCTGG - Intergenic
1132661169 16:1062193-1062215 CCGGTGGGGAAACTGTGGCCCGG - Intergenic
1132735660 16:1384566-1384588 CCAGTGAGGGCACTGAGGGTGGG - Intronic
1133075955 16:3281557-3281579 CAAATGAGGAAACTGAAGTTTGG + Intronic
1133197959 16:4184238-4184260 TTAGTGGGGAAACTGAGGCCCGG - Intergenic
1133210746 16:4262166-4262188 CCGATGGGGAAACTGAGGCCGGG + Intronic
1133622234 16:7537404-7537426 ACAGTGAGGAAACTGAGGCGTGG + Intronic
1133746096 16:8687793-8687815 CAGGTGAGGAAACTGAGGCCTGG - Intronic
1134016398 16:10891419-10891441 CCTGTGAGAAAACTGAGTTTGGG + Intronic
1134276667 16:12782449-12782471 CCTCTGAAGAAACTGAGGCCCGG + Intronic
1134339741 16:13334060-13334082 CAAATGAGAAAACTGAGGTTTGG + Intergenic
1134460776 16:14427542-14427564 CAGGTGAGGAAACTGAGGCTGGG + Intergenic
1135257820 16:20955350-20955372 CCAGTGAGGAAGCGGAGGCATGG + Intronic
1135279493 16:21141577-21141599 CAGTTGAGGAAGCTGAGGTCCGG - Intronic
1135288275 16:21212796-21212818 CCAGTGGGGAAACTGAGGCAAGG + Intronic
1135738295 16:24951298-24951320 ACAGAGAGGAAACTGAGGCTTGG - Intronic
1136117168 16:28101769-28101791 CCAGTGAGTAACCTGAGGGTGGG + Intronic
1136139547 16:28279798-28279820 ACAGTGGGACAACTGAGGTCCGG - Intergenic
1136315269 16:29451215-29451237 CCAGAGAAGAAACTGAGGCCGGG + Intronic
1136429846 16:30190557-30190579 CCAGAGAAGAAACTGAGGCCGGG + Intergenic
1136460989 16:30409901-30409923 CAAATGAGGAAACTGAGGCGTGG - Intronic
1136632746 16:31498585-31498607 CAAATGAGGACACTGAGGCCTGG - Intronic
1136655791 16:31708450-31708472 ACAGGCAGGAAGCTGAGGTCAGG - Intergenic
1137037802 16:35580971-35580993 CAGGTGAGGAAACTGAGGCCTGG + Intergenic
1137527507 16:49249324-49249346 CCAGTAGGGAAACTGAGGCCTGG + Intergenic
1137668490 16:50265892-50265914 CCAGTGGGGAAACTGAGGCCTGG + Intronic
1137707834 16:50548020-50548042 CAGGTGGGGAAACTGAGGTCGGG - Intergenic
1137729629 16:50680200-50680222 CAGATGAGGAAACTGAGGCCTGG - Intronic
1138265959 16:55659857-55659879 CAAGTGAGGAAACTGAGGCTTGG - Intronic
1138319615 16:56100958-56100980 CAGGTGAGGAAACTGAGGCTCGG + Intergenic
1138327163 16:56183908-56183930 TGATTGAGGAAACTGAGGCCTGG + Intergenic
1138436831 16:57005807-57005829 CTACTCAGGAAGCTGAGGTCGGG + Intronic
1138442687 16:57044583-57044605 CAGATGAGGAAACTGAGGCCTGG - Intronic
1138548534 16:57734732-57734754 CAGATGAGGAAACTGAGGCCCGG - Intergenic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1138585842 16:57970049-57970071 CCAGAGTGGGAACAGAGGTCAGG - Intronic
1138856317 16:60697576-60697598 CTACTTAGGAAACTGAGGTGGGG + Intergenic
1139159375 16:64485704-64485726 CAAGTGAGTAAACCGAGCTCCGG + Intergenic
1139298249 16:65921687-65921709 TAGGTGTGGAAACTGAGGTCAGG - Intergenic
1139423113 16:66861499-66861521 CAAATGGGGAAACTGAGGCCTGG - Intronic
1139453341 16:67049917-67049939 CAGCTGAGGAAACTGAGGCCAGG + Intronic
1139494713 16:67307995-67308017 CCAGTGAGGAACCTGAGGCTTGG - Intronic
1139954015 16:70684937-70684959 CAGGTGGGGAAACTGAGGCCTGG - Intronic
1140748630 16:78003315-78003337 CCAATGGTGAAACTGAGGCCTGG + Intergenic
1140999693 16:80296755-80296777 CTGGTGAAGAAATTGAGGTCTGG - Intergenic
1141115426 16:81304623-81304645 CCAATGAGGAACCTGAGGCTTGG + Intergenic
1141193999 16:81845954-81845976 CAAATGAGGAAACTGAGATGTGG - Intronic
1141360647 16:83392226-83392248 CAGATGAGGAAACTGAGGTTTGG - Intronic
1141364755 16:83432384-83432406 CAGATGAGGAAACTGAGGCCAGG + Intronic
1141369204 16:83471659-83471681 CCAGTGAGTAAACTGAAGGCAGG + Intronic
1141427306 16:83952701-83952723 CAGATGAGGAAACTGAGGTGCGG + Intronic
1141465081 16:84200227-84200249 CAAGTGGGGAAGCTGAGGACTGG - Intergenic
1141633917 16:85303769-85303791 CTCGTGAGGAAACTGAGGCAGGG - Intergenic
1141644275 16:85358935-85358957 CAAATGAGGAAACTGAGGCACGG - Intronic
1141668633 16:85479851-85479873 AGAGTGGGGAAACTGAGGCCCGG + Intergenic
1141745941 16:85926308-85926330 CAAGTGGGGAAACTGAGGCTTGG - Intergenic
1141813886 16:86396161-86396183 CAAAAGAGGAAACTGAGGTTAGG - Intergenic
1141882794 16:86871005-86871027 CCAGTGTGGAAACCGAGGCATGG + Intergenic
1141922150 16:87143503-87143525 ACAGTGGGGAAACTGAGGCTTGG - Intronic
1142154237 16:88525988-88526010 TGGGTGAGGAAACTGAGGCCTGG - Intronic
1142271173 16:89090153-89090175 CGAATGAGGAAACTGAGGCTCGG - Intronic
1203137455 16_KI270728v1_random:1737735-1737757 CCAGTGAGGAAGGAGAGGACAGG - Intergenic
1143084266 17:4404081-4404103 GCAGTGGGGAAACTGAGGCAGGG - Intergenic
1143262414 17:5609461-5609483 CAGGTGAGGAAACTGAGGCACGG + Intronic
1143372398 17:6448522-6448544 CAGGTAAGGAAACGGAGGTCCGG + Intronic
1143377763 17:6477467-6477489 CAGGTGTGGAAACTGAGGCCTGG - Intronic
1143558084 17:7674982-7675004 TCAGTGAGGAATCAGAGGCCTGG + Intronic
1143574784 17:7785857-7785879 TCAATGAGGAAACTGAGGCGTGG + Intronic
1143748318 17:9009919-9009941 CGAGTGAGGAAACTGACGTCAGG - Intergenic
1143960245 17:10711340-10711362 CCAGGGAGGAAACTGAGGCAGGG + Intronic
1144148313 17:12419708-12419730 TCTGTGAGGAAACAGAGGCCAGG - Intergenic
1144301622 17:13926776-13926798 CCTGTGGGGAGACTGAGGGCTGG - Intergenic
1144469648 17:15526386-15526408 CAAGTGAGGAAACTGAGGATTGG - Intronic
1144712487 17:17411012-17411034 CAAATGAGGAAGCTGAGATCTGG - Intergenic
1144747722 17:17626769-17626791 CAAATGGGGAAACTGAGGTCCGG + Intergenic
1144836464 17:18159008-18159030 CAGATGGGGAAACTGAGGTCCGG - Intronic
1144863454 17:18320190-18320212 CCAATGAGGACACAGAGGACTGG - Intronic
1144926703 17:18817267-18817289 CAAGTGAGGAAACTGAGGATTGG + Intergenic
1144952068 17:18999831-18999853 CAGTTGAGGAAACTGAGGGCAGG - Intronic
1145249937 17:21291779-21291801 GGAGTGAGTAAACTGAGGCCTGG + Intronic
1145757546 17:27403698-27403720 CCAGTAAGGAAGCTGTGGGCTGG - Intergenic
1146186728 17:30729082-30729104 CATGTGAGGAGACTGAGGTCTGG + Intergenic
1146603454 17:34238017-34238039 CAGATGAGAAAACTGAGGTCTGG - Intergenic
1146668363 17:34719939-34719961 AGAGTGCGGAAACTGAGGCCAGG - Intergenic
1146767309 17:35535071-35535093 CCAATGAGGAAACTGAGGTTGGG + Intronic
1146944301 17:36863528-36863550 CAGATGAGGAAACTGAGGCCCGG + Intergenic
1147165798 17:38592583-38592605 CCATTGGGGAAACTGAGGCCTGG - Intronic
1147443522 17:40461614-40461636 TAAATGAGGAAACTGAAGTCCGG - Intergenic
1147446318 17:40477379-40477401 TGATTGAGGAAACTGAGGCCCGG + Exonic
1147456367 17:40540721-40540743 CCAGTGGGGCAACTGAGTGCAGG - Intergenic
1148114832 17:45169454-45169476 CCAGTGGGGAGAGTGAGGCCGGG + Exonic
1148329953 17:46808143-46808165 CAGATGAGGAAACTGAGGCCCGG + Intronic
1148644682 17:49212653-49212675 ACAGTGAGGAAGCTGAGGTTTGG + Intronic
1149360027 17:55885375-55885397 CTAGTCAAGAAACTGAGGACAGG - Intergenic
1149423656 17:56534203-56534225 CAAATGAGGAAACTGAGGCAAGG - Intergenic
1149656634 17:58312581-58312603 ACACTCAGGAAACTGAGTTCAGG + Exonic
1150745592 17:67814105-67814127 CCATTAAAGAAACTGAGGCCGGG + Intergenic
1150857686 17:68768771-68768793 CCTGTGAGGAAACTGAGGCTTGG - Intergenic
1151109357 17:71656783-71656805 ACAGTGAGGAAAATGAGATAAGG + Intergenic
1151192372 17:72407806-72407828 CAAGGGAGGAAAATGAGGTTAGG + Intergenic
1151328008 17:73390735-73390757 CAAGTGAAGAAACTGAGGCCCGG + Intronic
1151785965 17:76275242-76275264 CAGACGAGGAAACTGAGGTCTGG + Intronic
1151901822 17:77021003-77021025 CAGGTGGGGAAACTGAGGTGTGG + Intergenic
1152101925 17:78306631-78306653 CCAGTTAGGAGGCTGAGGCCAGG + Intergenic
1152114704 17:78378517-78378539 CCAGAGGGGAAACTGAGGCTTGG + Intergenic
1152584419 17:81182608-81182630 TCAGTGGGGAAACTGAGGCACGG - Intergenic
1152635999 17:81430771-81430793 CCACCGAGGAAACCGAGGCCGGG - Intronic
1152733730 17:81986643-81986665 CAGGTGAGGAAACTGAGGCCCGG - Intronic
1152741933 17:82022268-82022290 CCAGTGGAGAAACTGAGGCACGG - Intronic
1152778841 17:82217628-82217650 AAAGTGAGGAAACTGAGGCTGGG + Intergenic
1152823687 17:82450354-82450376 GCAATGAGGCAACTGAGGCCCGG - Intronic
1153379412 18:4420581-4420603 CTAGTGAGAAAACTTAGGTGAGG - Intronic
1153489546 18:5632658-5632680 TCAGTGTGGAAACTGAGACCTGG + Intergenic
1153695933 18:7641875-7641897 CAGATGAGGAAACTGAGGCCTGG + Intronic
1153970987 18:10226952-10226974 CCAGAGAGGAGACTGTGGCCAGG + Intergenic
1153976038 18:10269175-10269197 CCAGTGAGGATAATTAGGCCAGG - Intergenic
1153999409 18:10471307-10471329 CAGGTGGGGAAACTGAGGTTAGG - Intronic
1155267788 18:24110853-24110875 CTAGTGAAGAAACTGAGGCTTGG + Intronic
1157070083 18:44396450-44396472 CAGATGAGGAAACTGAGGCCAGG - Intergenic
1157303110 18:46494676-46494698 CAAGTGAGGATACTGAGGCATGG - Intronic
1157321965 18:46641584-46641606 CAGATGAGGAAACTGAGGTTTGG + Intronic
1157563969 18:48667460-48667482 TCAGTGGGGACACTGAGGCCTGG + Intronic
1157583934 18:48789310-48789332 CCAGTGAGGAAACTGAGGCTTGG - Intronic
1157829476 18:50843744-50843766 TAATTGAGGAAACTGAGGCCTGG + Intergenic
1157952889 18:52060118-52060140 GCAGAGAGAAAACTGAGGGCTGG - Intergenic
1158105642 18:53882526-53882548 CCAGTGAGGAGAGAGAGGTCAGG + Intergenic
1158338146 18:56435581-56435603 ATAGAGAGGAAACTGAGGCCAGG - Intergenic
1158479085 18:57804445-57804467 CAAATGAGGAAACTGAGGCCTGG - Intergenic
1158668996 18:59457655-59457677 AAAATGAGGGAACTGAGGTCTGG + Intronic
1158930602 18:62321888-62321910 CAAATGAGGATACTGAGGTACGG - Intergenic
1158944813 18:62438865-62438887 CAGGTGAGGAAACTGAGGCACGG + Intergenic
1159310880 18:66707372-66707394 CCAGTGGAGAAAATGAGGTGAGG + Intergenic
1160381583 18:78461093-78461115 CCAGAGAAGAAGCTGAGGTGTGG - Intergenic
1160588904 18:79928852-79928874 CCAGTGAGCAAGCTGAGGCAGGG - Intronic
1160763296 19:796480-796502 CAGGTGGGGAAACTGAGGCCTGG - Intergenic
1161203733 19:3029430-3029452 CCGTTGGGGAAACTGAGGCCGGG + Intronic
1161217271 19:3100774-3100796 CCGATGGGGAAACTGAGGCCGGG - Intronic
1161262766 19:3346698-3346720 CCAGTGGGGAAACTGAGACAGGG + Intergenic
1161312616 19:3603363-3603385 CCAGAGGAGAAACTGAGGCCTGG + Intronic
1161331810 19:3692169-3692191 CAAATGAGGAAACTGAGGCACGG + Intronic
1161342815 19:3752346-3752368 CCCTTGGGGAAACTGAGGCCTGG - Intronic
1161443235 19:4304382-4304404 CAAGTGGGGAAACTGAGGCACGG + Intergenic
1161702559 19:5803572-5803594 CAAGTGGGGAAACTGAGGCACGG + Intergenic
1161718536 19:5891013-5891035 CAGATGAGGAAACTGAGGCCCGG - Intronic
1162095383 19:8306939-8306961 CAGGTGAGGAAACTGAGGCCAGG - Intronic
1162308302 19:9889131-9889153 TGGGTGAGGAAACTGAGGCCTGG + Intronic
1162332953 19:10041570-10041592 CTAATGAGGAAACTGAGGCTGGG - Intergenic
1162406195 19:10475410-10475432 CAATTGAAGAAACTGAGGGCTGG + Intergenic
1162512213 19:11126209-11126231 CCAGGGAGGACAGTGAGGCCAGG - Intronic
1162846749 19:13398682-13398704 CCTATGAGGAAACTGAGGCTTGG - Intronic
1162972172 19:14187410-14187432 CACGTGAGGAGACTGGGGTCTGG - Intronic
1163040158 19:14596258-14596280 CAAGTGAGTAAACTGAGGCTTGG - Intronic
1163041554 19:14606747-14606769 CAGGTGAGGAAACTGAGGCACGG + Intronic
1163063677 19:14777332-14777354 CAGATGAGGAAACTGAGGCCAGG + Intronic
1163152549 19:15423922-15423944 TGAGTGAGGAAATTGAGGTAAGG + Intronic
1163611029 19:18301653-18301675 CCAGGGAGGAAACTGAGGCACGG + Intergenic
1163632071 19:18422624-18422646 CACATGAGGAAACTGAGGCCTGG - Intronic
1163774723 19:19211537-19211559 ACAGAGAGGAAACTGAGGCACGG - Intergenic
1163828076 19:19534958-19534980 CTGGAGAGGAAACTGAGGCCCGG - Intronic
1164011399 19:21206100-21206122 CCAGTGAGGAATCTTGGGGCAGG - Intergenic
1164462378 19:28459990-28460012 CCAGTGAGGAAGCTGTGGGGAGG + Intergenic
1164478979 19:28597131-28597153 CCAGTGAGGAAACTGAGATTCGG - Intergenic
1164611621 19:29636439-29636461 TCAATGGGGAAACTGAGGCCCGG + Intergenic
1164985788 19:32647526-32647548 CCAGTGAGGACACTGTGGCCGGG - Intronic
1165106805 19:33475050-33475072 CAGGTGAGGAAACTGAGGCTGGG + Intronic
1165305342 19:34999973-34999995 CCAGGGAGGAACCTGAGAGCCGG - Intronic
1165462661 19:35953225-35953247 CCAGAGAAGAGACTGAGGCCAGG - Intergenic
1165931629 19:39362856-39362878 TGGGTGGGGAAACTGAGGTCAGG + Intronic
1165946470 19:39445808-39445830 CCAGCGGGGAAACTGAGGCTCGG + Exonic
1166797919 19:45439331-45439353 TAAATGAGGAAACTGAGGTCCGG - Intronic
1167111367 19:47463900-47463922 CAGTTGAGGAAACTGAGGCCTGG + Intronic
1167505969 19:49871243-49871265 CCAGTGGAGAAACTGAGGCTTGG - Intronic
1167526075 19:49984552-49984574 TCAGTGTGGACACAGAGGTCGGG - Intronic
1167539032 19:50073711-50073733 CCAGTGTGGAGCCTGAAGTCCGG + Intergenic
1167594775 19:50421840-50421862 CCAGTGAATCACCTGAGGTCAGG - Intronic
1168266325 19:55225604-55225626 CCAGGAAGGAAAGTGAGGACAGG - Intergenic
1168431850 19:56287729-56287751 CAGGTGGGGAAACTGAGGGCTGG + Intronic
1168669577 19:58230401-58230423 CGGATGAGGAAACTGAGGCCTGG + Intronic
1202700913 1_KI270712v1_random:163140-163162 CAAATGAGGAAACTGAGGCTGGG + Intergenic
925142497 2:1559635-1559657 CAGGTGAGGAAACTGAGGCACGG + Intergenic
925400226 2:3567356-3567378 CCAGCGAGGAAACTTAGGTTTGG - Intergenic
925902624 2:8519092-8519114 CAGATGAGAAAACTGAGGTCGGG - Intergenic
926142425 2:10375667-10375689 ACAGTGAGGGAACTAAAGTCTGG - Intronic
926158353 2:10470581-10470603 CTAATGAGGAAACTGAGGCAGGG + Intergenic
927055918 2:19365415-19365437 CCACTGAGGAAAGGGAGGGCCGG + Intergenic
927157097 2:20226661-20226683 CAACAGAGGAAACTGGGGTCAGG + Intergenic
927159262 2:20242507-20242529 CCAATGAGCAAACTGAAGCCCGG + Intergenic
927213668 2:20653763-20653785 CCTGGGTGGAAACTGAGGCCTGG - Intergenic
927645740 2:24875676-24875698 CAGGTGAGGAAACTGAGGCCGGG - Intronic
927857867 2:26538411-26538433 CCAGTGGGGAAAGTGGGGGCAGG - Intronic
927880506 2:26686964-26686986 CCCATGAGGAAACTGAGGTCTGG - Intergenic
927948131 2:27149577-27149599 CTCTTGAGGAAACTGAGGCCGGG + Intronic
928253967 2:29706104-29706126 CAGATGAGGACACTGAGGTCTGG - Intronic
928272812 2:29872309-29872331 CAAGTGAGGAAATTGAGGCTTGG - Intronic
928980783 2:37133429-37133451 ACAGTCAGGAAACTGGGTTCTGG + Intronic
929200355 2:39228709-39228731 CCGCAGAGGAAACGGAGGTCTGG - Intronic
929483980 2:42338681-42338703 CCAGTGAGGAATCTGACAGCAGG + Intronic
929569164 2:43009229-43009251 CCAGTGGGGAAGCTGGGGACTGG + Intergenic
929773796 2:44915184-44915206 CAAATGAGGAAACTGGGGCCTGG + Intergenic
930063152 2:47307623-47307645 CAAGTGAGGAAGCTGAGGCTTGG + Intergenic
930096290 2:47569576-47569598 CTGGAGAGGAAACTGAGGCCTGG + Intronic
931247169 2:60500850-60500872 CCAGTGAAGAAACTGAGGCTTGG - Intronic
932475970 2:72006118-72006140 CCAGGGAGGACCCTGAGCTCCGG + Intergenic
932502974 2:72200613-72200635 CACAGGAGGAAACTGAGGTCTGG + Intronic
932686772 2:73877152-73877174 CCAGGGAGCAGACTGAGGTTGGG + Intergenic
933636212 2:84711641-84711663 TCAATGAGGAAACTGAGGCATGG + Intronic
934171841 2:89546629-89546651 CAAATGAGGAAACTGAGGCTGGG + Intergenic
934282149 2:91620947-91620969 CAAATGAGGAAACTGAGGCTGGG + Intergenic
934563984 2:95328273-95328295 CCAATGAGGAAACTGAGGACTGG + Intronic
934950291 2:98571263-98571285 CAGGTGAGGAAACTGAGGCATGG + Intronic
934981919 2:98849899-98849921 CCTATGAGGATACTGAGGCCTGG - Intronic
935278336 2:101495516-101495538 CCAGTGAAGAAAATGACATCAGG - Intergenic
935319906 2:101876294-101876316 CCACTGAGGAAGCAGAGGGCAGG + Intronic
936560863 2:113538778-113538800 ATAGTGAGGACACTGAGGTTAGG + Intergenic
936945910 2:117930539-117930561 CCAATGAGGAAACTGAGGCTGGG + Intronic
937121328 2:119441713-119441735 CCAGTGAGGCAAGAGAGGTGGGG - Intronic
937257708 2:120566598-120566620 GCAGTGGGGAAACTGAGGTGGGG - Intergenic
937878918 2:126850554-126850576 GCAATGTGGAAACTGAGGCCGGG - Intergenic
937955427 2:127419440-127419462 CAAATGAGGAAACTGAGGCATGG + Intronic
937991543 2:127664839-127664861 ACAGTTAGGAAACCGAGGACCGG + Intronic
938106085 2:128530664-128530686 CAAGTGAGGAAATTGAGGCACGG + Intergenic
938108505 2:128549290-128549312 ACAGTGAGGAAACTGGGCTGAGG - Intergenic
938118812 2:128619868-128619890 CCAGTGGGGGAACTGAGGCCTGG + Intergenic
938742794 2:134248634-134248656 ACAGTGAGGACAGAGAGGTCTGG + Intronic
939588316 2:144032240-144032262 CCTATGAGGAAACTGAGGCTTGG - Intronic
939609209 2:144289564-144289586 CCAGTGGGGATAGTGAGGGCCGG + Intronic
940914620 2:159240685-159240707 TAAATGAGGAAACTGAGGTATGG + Intronic
941459374 2:165750299-165750321 CTAGTGAGAAAACTGAGGCATGG - Intronic
941548727 2:166888024-166888046 CAAGTGAGGAAACTAATGTTTGG + Intergenic
941735169 2:168966120-168966142 CCAGTTAGGTAACAGAGGTCAGG + Intronic
941930779 2:170936711-170936733 CCAATCAGGAGACTGAGGTGAGG + Intronic
941962083 2:171263514-171263536 CCAGGGAGGCAGCTGAGGTATGG - Intergenic
942371022 2:175284903-175284925 CTAATGAGGAAACTGAGGCTTGG + Intergenic
942394864 2:175536429-175536451 CAGATGAGGAAACTGAGGTTTGG + Intergenic
942481337 2:176391728-176391750 CAAGTGAGGAAACTGAGGTATGG + Intergenic
942605998 2:177691646-177691668 CACATGAGGAAACTGAGGTTTGG - Intronic
942895074 2:181042654-181042676 CAAATGAGGAAACTGAGGTCAGG - Intronic
943679750 2:190755791-190755813 AAAGTGAGAAAACCGAGGTCTGG + Intergenic
944356285 2:198792305-198792327 TCAGTGATGAGACTAAGGTCAGG - Intergenic
944648095 2:201800126-201800148 TCATTGAGGGAACTGAGTTCAGG - Intronic
944862208 2:203825900-203825922 CCGGTTAGGAGACTGAGCTCTGG - Intergenic
944887235 2:204075803-204075825 CAAGCGAGAAAACTGAGGTTTGG + Intergenic
945035672 2:205702019-205702041 CAGATGAGGAAACTGAGGCCTGG - Intronic
945067585 2:205960175-205960197 CTACTGAGGAAAGTGAGGGCTGG - Intergenic
945365751 2:208951459-208951481 CAGATGAGGAAACTGAGGCCAGG - Intergenic
945443809 2:209912307-209912329 CCTTTGAGGAAACTGGGATCTGG - Intronic
946783192 2:223214352-223214374 CAGGTAAGGAAACTGAGGTGAGG - Intergenic
948087836 2:235266096-235266118 CAAATGAGGAAAATGAGGCCTGG - Intergenic
948335153 2:237201713-237201735 CCAGTGAGGCAGCTGGGCTCTGG + Intergenic
948362427 2:237432573-237432595 CAAGTGATGACACGGAGGTCGGG - Intergenic
948399157 2:237670527-237670549 CCAATGTGGAAACTGAGGCTCGG - Intronic
948739452 2:240033346-240033368 CCAGAGAGGAAACAGAGGTCAGG - Intergenic
948910352 2:240999417-240999439 CCACTTGGGAAACTGAGGCCCGG - Intronic
1168840420 20:906605-906627 AAAATGAGGAAACTGAGGCCTGG - Intronic
1168870093 20:1120212-1120234 CCAGTGAGATAATTGAGGTCTGG - Intronic
1168947521 20:1773874-1773896 CAGATGAGGAAACTGAGGCCAGG + Intergenic
1169154308 20:3316425-3316447 CAAATGAGGAAACTGAGCTTAGG - Intronic
1169499669 20:6147454-6147476 CAGATGAGGAAACTGAGGTGAGG - Intergenic
1169674303 20:8136188-8136210 CCGTTGAGGAAACTGAAGTTGGG - Intronic
1169799463 20:9500033-9500055 TCCATGAGGAAACTGAGGCCTGG - Intergenic
1170550374 20:17471275-17471297 CCTGTAAGGAATCTGAGGTCCGG + Intronic
1170567544 20:17615534-17615556 CCGGAGAGGGAAGTGAGGTCTGG + Intronic
1170746778 20:19106616-19106638 CAGGTGAGGAAACTGAGCTTTGG + Intergenic
1171191232 20:23161207-23161229 CCTGTGAGGAAACCCAGGGCTGG - Intergenic
1171194405 20:23186297-23186319 CAGGTGGGGAAACTGAGGTGAGG + Intergenic
1171225963 20:23442357-23442379 CAGGTGAAGAAACTGAGGTCTGG - Intronic
1171427161 20:25056642-25056664 ACAATGAGGAGACTGAGGGCTGG + Intronic
1171431874 20:25088016-25088038 CCATTGAGGAAACTGCAGTAGGG - Intergenic
1171991461 20:31699745-31699767 CCAGTAAAGAAACTAAGGTTTGG - Intronic
1172112430 20:32554945-32554967 CCAATGAGGAAACCAAGGACTGG + Intronic
1172391773 20:34569975-34569997 CAAATGAGGAAACTGAGGCTTGG - Intronic
1172597376 20:36158701-36158723 CGAATGAGGAAACTGAGGTTTGG - Intronic
1172751081 20:37251736-37251758 CCTGTAAGGAAACTGAGGCTCGG - Intronic
1172775180 20:37403115-37403137 CCGGTGAGGAAAGTGGGGTGGGG - Intronic
1173310299 20:41891154-41891176 CAAATGAGGAAACTGAAGTAGGG + Intergenic
1173332479 20:42086830-42086852 CCTATGAGAAAACTGAGGCCTGG - Intronic
1173357263 20:42305755-42305777 ACAGAGGGGAAACTGAGGTTTGG + Intronic
1173646511 20:44636517-44636539 CAATTGAGGACACTGAGGTTCGG + Intronic
1173838570 20:46141276-46141298 CCAGTGAGAGATGTGAGGTCTGG - Intergenic
1173845925 20:46188755-46188777 CCAGTGAGCACTCAGAGGTCTGG - Intronic
1173914904 20:46700075-46700097 TAAGTGAGGAAACTGAGGCTCGG - Intergenic
1173952797 20:47006472-47006494 CAATTGAGGAAACTGAGGCCTGG - Intronic
1174050218 20:47762619-47762641 CAAATGAGGAAACTGAGGCTGGG - Intronic
1174123633 20:48286854-48286876 CTAAAGAGAAAACTGAGGTCTGG + Intergenic
1174203800 20:48825330-48825352 CAGGTGGGGAAACTGAGGTCAGG + Intronic
1174284651 20:49464195-49464217 CTACTCAGGAAACTGAGGTGGGG - Intronic
1174537990 20:51267526-51267548 CAGATTAGGAAACTGAGGTCTGG - Intergenic
1174693121 20:52529398-52529420 CAGATGAGGAAACTGATGTCTGG - Intergenic
1174780228 20:53382661-53382683 CCAGACAGGAAACTGTGGCCCGG - Intronic
1175129622 20:56779669-56779691 CAGATGAGGAAACTGAGGCCTGG - Intergenic
1175241698 20:57554426-57554448 CAAGTGAGGAGAATGAGGCCTGG + Intergenic
1175273027 20:57748303-57748325 CTGATGAGGAAACTGAGGCCGGG - Intergenic
1175317090 20:58056151-58056173 CCAATGAGGAAACTCAGCACAGG + Intergenic
1175373030 20:58505511-58505533 CCAGAGAGGGAAGGGAGGTCAGG - Intronic
1175621678 20:60452933-60452955 CAGGTGAGGAAACTGAGGCTTGG - Intergenic
1175796604 20:61775128-61775150 CCAGTGATCAAACTGTGGTTTGG - Intronic
1178271038 21:31190107-31190129 TAAGTGATGAAACTAAGGTCGGG + Intronic
1178282986 21:31299786-31299808 CCAGTGAGGAAACCGAGGCTTGG - Intronic
1178300470 21:31448904-31448926 CAAATGGGGAAACTGAGGTTGGG - Intronic
1178433319 21:32535530-32535552 CTACTCAGGAAACTGAGGTGGGG + Intergenic
1178502330 21:33136013-33136035 ACAGTGAGCAAACAGAAGTCAGG + Intergenic
1178704516 21:34862201-34862223 CTGATGAGGAAACTGAGATCTGG - Intronic
1178922132 21:36745654-36745676 CAGGTGAAGAAACTGAGGCCTGG - Intronic
1179474990 21:41637321-41637343 ACAGTGAGGGAACTGAGGGCAGG - Intergenic
1179564746 21:42240224-42240246 TCAGTGAGGAAACTGTGGCCTGG + Intronic
1179607648 21:42527593-42527615 CCTGTGAGGAAATTGAGGCTCGG + Intronic
1181185249 22:21098714-21098736 AAAGAAAGGAAACTGAGGTCAGG - Intergenic
1181513450 22:23399031-23399053 GTAGTGGGGAAACTGAGGACTGG - Intergenic
1181661159 22:24349994-24350016 CTAGAGAGGACACTGAGGCCAGG - Intronic
1181727720 22:24823114-24823136 CAGATGAGGAAACTGAGTTCCGG - Intronic
1181747342 22:24964763-24964785 CAGGTGAGGAAACTGAGTTTTGG + Intronic
1181776971 22:25166738-25166760 CCAGTGTGAAAACTGAGGCTTGG + Intronic
1181982625 22:26776430-26776452 CAGGTGAGGAAACTGAGGCTTGG + Intergenic
1182024394 22:27106626-27106648 CAAGTGAGCAAACTGAGGCTTGG - Intergenic
1182035001 22:27191197-27191219 TAGATGAGGAAACTGAGGTCTGG - Intergenic
1182069621 22:27454475-27454497 GCAGTGAGGAAACCAAGATCTGG + Intergenic
1182112504 22:27733536-27733558 CAGGTGAGGAAACTGAGGCTTGG + Intergenic
1182119648 22:27778624-27778646 CAGATGAGGAAACTGAGGCCCGG + Intronic
1182161672 22:28128647-28128669 CCACTGGGGAGACTGAGGTTAGG - Intronic
1182319582 22:29470087-29470109 CACGTGCAGAAACTGAGGTCTGG + Intergenic
1182341687 22:29627536-29627558 CAAATGAAGAAACTGAGGCCCGG + Intronic
1182353315 22:29710880-29710902 CAGATGAGGAAACTGAGGCCTGG + Intergenic
1182747126 22:32614605-32614627 CAAAGGAGGAAACTGAGGCCTGG + Intronic
1182764383 22:32748134-32748156 CAAGTGGGAAAACTGAGGTTTGG - Intronic
1182892483 22:33830537-33830559 CCCTTGAGGAAACTGAGGCAGGG - Intronic
1183059530 22:35327597-35327619 CAGATGAGGAAACTGAGGCCAGG - Intronic
1183070165 22:35390621-35390643 CGGGTGGGGAAACTGAGGTAGGG - Intronic
1183084973 22:35481104-35481126 CCTGGGAGGAGACTGTGGTCTGG + Intergenic
1183100488 22:35580739-35580761 CAGGTGAGGAAACTGAGGCCTGG - Intergenic
1183168608 22:36166895-36166917 CAGGTGAGGAAACTGAGGCAAGG + Intergenic
1183173657 22:36205980-36206002 CAAATGAGGAAACTGAGGCAAGG + Intergenic
1183250547 22:36727112-36727134 CAGGTGAGCAAACTGAGGCCTGG + Intergenic
1183405007 22:37626091-37626113 CAACTGAGGAAACTGAGGCTCGG + Intronic
1183546858 22:38458918-38458940 CCAATGGGGAAACTGAGGCACGG + Intergenic
1183599853 22:38833499-38833521 CCAATGGGGAAACTGAGGCATGG - Intronic
1183750305 22:39716247-39716269 CAAGTGAGGAAACCGAGGCTCGG - Intergenic
1183768837 22:39905705-39905727 ACAATGAGGAAACTGAGGTACGG + Intronic
1183802288 22:40176959-40176981 CCAATGAGAAAACGGAGGCCAGG + Intronic
1183976434 22:41515103-41515125 CAAATGAGGAAACTGAGGCATGG + Intronic
1184088161 22:42278310-42278332 CAGATGAGGAAACTGAGGCCCGG + Intronic
1184151849 22:42643979-42644001 CACGTGAGGAAACTGAGGCCAGG + Intronic
1184261008 22:43316215-43316237 CAAGTGAGGAAACTAAGGCATGG + Intronic
1184263592 22:43333809-43333831 CAAGTGAGGAAACTGAGGCATGG - Intronic
1184279721 22:43430056-43430078 CAAATGGGGAAACTGAGGCCTGG - Intronic
1184413728 22:44340174-44340196 CAGATGAGGAAACTGAGGCCAGG - Intergenic
1184479013 22:44736454-44736476 CAAGTGGGGAAACTGAGGCACGG + Intronic
1184651984 22:45923657-45923679 CTGGTGAGGAAACCGAGGTTTGG + Intronic
1184670223 22:46008336-46008358 CCTGAGGGGAAACTGAGGCCTGG - Intergenic
1184716246 22:46283437-46283459 CCAAGGAGGAAACTGAGGCTAGG - Intronic
1184772784 22:46607664-46607686 CCAGTTAGGAAACCGTGGCCAGG - Intronic
1185336094 22:50271539-50271561 CCAATGGGGAAACTGAGGCACGG - Intergenic
950414059 3:12858307-12858329 CCAGTCAGGAAGAAGAGGTCTGG + Intronic
950438537 3:12994306-12994328 CGAGGGGGGAAACTGAGGCCAGG - Intronic
950706376 3:14785007-14785029 CAGATGAGGAAACTGAGGCCTGG - Intergenic
951519430 3:23597581-23597603 CAAGTGAATAACCTGAGGTCAGG + Intergenic
952054969 3:29433330-29433352 CCAGTGGGGAAACTTTGGGCTGG - Intronic
952738959 3:36717014-36717036 CCAGTGAGGAAATAGAGGCTAGG + Intronic
952920799 3:38282600-38282622 CCAAAGAGGTAACTGAGGCCTGG - Intronic
953029036 3:39164652-39164674 CTAGTCAGGAAGCTGAGGTTGGG - Intergenic
953233979 3:41089865-41089887 CAAGTGAGGAAAATGAGGCTTGG - Intergenic
953389727 3:42527259-42527281 CAAATGAGGAGGCTGAGGTCTGG - Intronic
953679026 3:45025923-45025945 CCATTGAGGAAATTGAGGCTCGG - Intronic
954155467 3:48682749-48682771 CCAGTGAGCAAGGTGGGGTCGGG - Intronic
954435003 3:50491290-50491312 ACAGTGAGGACACTGAGGCTCGG + Intronic
954446730 3:50550808-50550830 CCAGAGAGGCAGCTGAGGACAGG - Intergenic
954451926 3:50576287-50576309 CCCATGAGGAAACTGAGGCCTGG - Intronic
954466595 3:50658798-50658820 GCAGTGAGGAACCTCAGGTCTGG - Intergenic
954627308 3:52029541-52029563 CAGATGGGGAAACTGAGGTCTGG + Intergenic
954649830 3:52154308-52154330 CCAGCGGGGAGACTGAGGCCTGG + Intronic
954806392 3:53223450-53223472 CAAATGAGGAAACTGAGGCTTGG + Intergenic
954841517 3:53515741-53515763 CAGGTGAGAAAACAGAGGTCAGG - Intronic
954866562 3:53734936-53734958 TGAGAGAGGAAACTGAGGCCAGG - Intronic
954993450 3:54860818-54860840 CAGCGGAGGAAACTGAGGTCAGG - Intronic
955457107 3:59135344-59135366 CCACTAAGGAACTTGAGGTCAGG - Intergenic
955723205 3:61905229-61905251 TCAGTGGGTAAACTGAGGTTAGG + Intronic
955804674 3:62721826-62721848 CAAATGAGGAAACAGAGGTAGGG + Intronic
956250775 3:67231596-67231618 CCATGGAGGAGACTGAGGACTGG - Intergenic
958703773 3:97627099-97627121 CCAGTGACCAAACTGAGGCAAGG + Intronic
959905844 3:111710473-111710495 CAGATGAGGAAACTGAGGTATGG + Intronic
960610183 3:119548550-119548572 CAAATGAGGAAACTGAGCTGAGG + Intronic
960638859 3:119809129-119809151 CCAGAGTGGAAACTGAGGGAAGG - Intronic
960829816 3:121834793-121834815 CTGGTGTGGAAACTGAGGCCTGG - Intronic
961133678 3:124491259-124491281 GCAGTGGGGAAACTTAGGGCTGG - Intronic
961255135 3:125543357-125543379 CCAGTGGATCAACTGAGGTCAGG - Intronic
961357821 3:126350035-126350057 GCAGACAGGAAACTGAGGTTTGG + Intronic
961414175 3:126745351-126745373 CATGTGAGGAAACTGAGGCTTGG - Intronic
961659377 3:128460397-128460419 TCCAAGAGGAAACTGAGGTCTGG - Intergenic
961753539 3:129112489-129112511 ACAGTGAGGAAACTGATGCAAGG + Intronic
961949378 3:130732160-130732182 CAGGTGAGGAAACTGGGGTTAGG - Intronic
962828788 3:139121764-139121786 CCGATGAAGAAACTGAGGTTCGG + Intronic
962942936 3:140142065-140142087 CAAATGAGGCAACTGAGGCCAGG - Intronic
963075240 3:141340156-141340178 CAACTGAGGAAACTGAGGCATGG + Intronic
963182104 3:142368981-142369003 CCAATGAGGAAACAGAGGTATGG + Intronic
964554096 3:157916980-157917002 CAAATGAGGACACTGAGGCCAGG + Intergenic
964666661 3:159182105-159182127 ACAGCAAGGAAACTGAGGTAAGG - Intronic
965911520 3:173783403-173783425 CAGGTGAGGACACTGAGGCCAGG - Intronic
966046421 3:175556341-175556363 CAGATGAGGAAACTGAGGTATGG - Intronic
966675710 3:182586133-182586155 CTTGTGAGGAAACTGAGGCCAGG + Intergenic
966870899 3:184290145-184290167 CAGTTGAGGAAACTGAGGTTTGG + Intronic
967055577 3:185825935-185825957 CCGGTCGGGAAACTGAGGCCCGG - Intergenic
967268580 3:187714077-187714099 CAAGTGACAAAACTGAGGTTCGG - Intronic
967330817 3:188287367-188287389 CTATTTAAGAAACTGAGGTCTGG + Intronic
967611113 3:191507045-191507067 CCAGTGAGTAAAATGAGGAGAGG - Intergenic
967803787 3:193694569-193694591 CCATTTAACAAACTGAGGTCAGG - Intronic
968058340 3:195710244-195710266 TGAGTGAGGTAACTGAGATCAGG + Intergenic
968916446 4:3498974-3498996 CCAGTGGGGAAACTGAGGCCAGG - Intronic
968953618 4:3707243-3707265 CAGATGAGGAAACTGAGGCCAGG - Intergenic
969083386 4:4637535-4637557 CAGATGAGGAAACTGAGGCCTGG + Intergenic
969088242 4:4672508-4672530 CCAGTGAGGACACTGTGGGCAGG + Intergenic
969096690 4:4737966-4737988 ACAGTGGGGAGACTGAGGCCTGG - Intergenic
969143738 4:5102172-5102194 CAAATGAGGAAACTGAGGCACGG - Intronic
969205050 4:5637376-5637398 CAGGTGAGGAAACTGAGCTGGGG - Intronic
969227742 4:5810166-5810188 CTAATGAGGAAACTGAGGCCTGG - Intronic
969314834 4:6375646-6375668 CTGGTGAGGAAACTGAGGCAAGG + Intronic
969397055 4:6928752-6928774 CATGTGAGGAAACTGAGGCAAGG + Intronic
969572576 4:8018370-8018392 CAAGTGGGGAAACTGAGGCCTGG - Intronic
969594794 4:8142876-8142898 CCCTTGAGGAACCTCAGGTCTGG + Intronic
969689890 4:8698608-8698630 CCAGAGTGGAAACTGAGTCCAGG - Intergenic
969693820 4:8723935-8723957 CCAAAGAGGAAACTGAGGCATGG - Intergenic
969930539 4:10626903-10626925 CAGGTGAAGAAACTGAGGTAGGG - Intronic
970411912 4:15817142-15817164 CCAGTGAGAAAACTGAGGGTTGG + Intronic
970586505 4:17519482-17519504 CAAATGAGGAAACTGAGGCTCGG - Intronic
971163809 4:24161495-24161517 CAGGTGAGGAAACTGGGGTTTGG - Intergenic
971236551 4:24847660-24847682 CAGATGAGGAAACTGAGGCCTGG + Intronic
971338850 4:25749176-25749198 CAAGTGATGAAACCGAGGCCCGG - Intronic
971791784 4:31178870-31178892 CAAGTGAGAAAACTGAGCCCTGG - Intergenic
972315522 4:37922300-37922322 CTATTGAGGAAACTGAGGCTCGG + Intronic
972712419 4:41610673-41610695 CAGATGAGAAAACTGAGGTCTGG + Intronic
972717198 4:41658151-41658173 CAAGTGAAGAAACTGAGGCCCGG - Intronic
972944213 4:44234159-44234181 CAAGTTAGGAAACTGAGGTGGGG + Intronic
972961034 4:44452035-44452057 CCCATGAAGAAACTGAGGTTCGG - Intergenic
973039923 4:45457260-45457282 ACAGGGAGGATGCTGAGGTCCGG + Intergenic
973262592 4:48179797-48179819 CAGATGAGGAAACTGAGGTCAGG - Intronic
974271478 4:59656349-59656371 CCAGTGAGGAAGGATAGGTCAGG - Intergenic
974397732 4:61360967-61360989 CCAGTGAAGAAACTGAGGCTAGG + Intronic
974958554 4:68672925-68672947 CCAATGAGGAAAAAGAGGTAGGG - Intergenic
975490734 4:74985503-74985525 CAAGTGAAGAAATTGAGGTTCGG + Intronic
978607024 4:110491946-110491968 CCAGTGGGTCACCTGAGGTCAGG - Intronic
980135437 4:128854151-128854173 TCAGTGAGTTAACTGATGTCAGG + Intronic
981009175 4:139907257-139907279 TAATTGAGGAAACAGAGGTCTGG - Intronic
981943883 4:150318039-150318061 CCAGTGAGGACACTGAGCCCAGG + Intronic
981944072 4:150320235-150320257 CCAGTGAGGACACTGAGCCCAGG - Intronic
982046253 4:151449299-151449321 CACATGAGGAAACTGAGGTATGG + Intronic
982199032 4:152942237-152942259 CAAATGAGAAAACTGAAGTCTGG + Intronic
982316899 4:154041200-154041222 CAGGTGAAGAAACTGAGGCCTGG + Intergenic
982678324 4:158400827-158400849 CCAGTGAGGAACTGGAGTTCAGG + Intronic
983436477 4:167721875-167721897 CCACTAAGGTAACTGAGGGCAGG - Intergenic
984932443 4:184858999-184859021 ACAGTGAGCTCACTGAGGTCTGG - Intergenic
984995511 4:185426449-185426471 CCAGAGAGGAAACGGAGGCTGGG - Intronic
985094529 4:186400546-186400568 TCAGTGAGGAAGCTGGGCTCTGG + Intergenic
985689316 5:1298405-1298427 TCCGTGAGGACCCTGAGGTCTGG - Intergenic
985886980 5:2687433-2687455 CATGTGGGGAAACTGAGGCCAGG - Intergenic
985961991 5:3309525-3309547 CCAGAGAGGAAGCTGAGGCTCGG - Intergenic
986000109 5:3623740-3623762 CCAGAGTGGAAGCTGAGGTCTGG - Intergenic
986007627 5:3681365-3681387 CAAATGAGGAAACTGAGACCTGG - Intergenic
986334176 5:6740918-6740940 CAGGTGAGGAAACTGAGATGCGG + Intronic
986376197 5:7134332-7134354 CAAGTGGAGAATCTGAGGTCAGG - Intergenic
987007421 5:13724634-13724656 CCAGTGATGAAAGTGGGGCCTGG + Intronic
987011214 5:13767568-13767590 CCAGTGAGGAAAGTAGGGTAGGG + Intronic
987123013 5:14785275-14785297 CCAGTGTGGGAGCTGAGGCCTGG + Intronic
987439000 5:17932707-17932729 CCACTGGAGAAACTGAGGACTGG + Intergenic
987473602 5:18363018-18363040 CCAGCAAGGAAACTGATTTCAGG - Intergenic
987576658 5:19737028-19737050 CCAGTGAGAACACAGAAGTCTGG + Intronic
988225749 5:28409723-28409745 CGAGCGAAAAAACTGAGGTCAGG - Intergenic
988869016 5:35367815-35367837 TCAGTGAGGAAATTGAGGTCTGG - Intergenic
989821336 5:45798130-45798152 CCAATGAGAAGACTGAGGGCTGG - Intergenic
991053395 5:62296439-62296461 CCGGTGAGTCACCTGAGGTCAGG + Intergenic
991403408 5:66277619-66277641 CCAGGGAGGACACTGAAGTTAGG + Intergenic
991414108 5:66374374-66374396 CCATCGAGAAGACTGAGGTCAGG + Intergenic
991505439 5:67319077-67319099 ACAGTGAGGCAGCTGAGGCCCGG - Intergenic
991957315 5:72008038-72008060 GCAGTGAAGAAACAGAGGCCTGG - Intergenic
992125841 5:73640253-73640275 CAGATGAGGAAACTGAGGACTGG - Intronic
992134424 5:73729199-73729221 CAAATGAGGAAACTGAGGCAGGG - Intronic
992249169 5:74860084-74860106 CAGATGAGGAAACTGAGGCCAGG + Intronic
992380156 5:76228810-76228832 CAGGTGAGGAAACTGAGGCCGGG + Intronic
992667927 5:79029559-79029581 CAGATGAGGAAACTGAGGTTTGG - Intronic
992672003 5:79070066-79070088 CAGGTGAGGAAACTGAGGCTCGG + Intronic
992783376 5:80147891-80147913 CAGCTGAGGAAACTGAGGTCAGG + Intronic
993348201 5:86812339-86812361 CCACTCAGGAGACTGAGGTTGGG - Intergenic
994096242 5:95850869-95850891 TCAATGAGGTCACTGAGGTCAGG + Intergenic
994400319 5:99271696-99271718 CTAGGGAGGAAGCTGAGGGCTGG + Intergenic
994743993 5:103656202-103656224 CAAATAAGGAAACTGAGGTATGG + Intergenic
994918224 5:106006273-106006295 CCAGTGGAGAAACTGAGTTGGGG + Intergenic
995324146 5:110872506-110872528 TATGTGAGGAAACTGAGGCCCGG - Intergenic
995481090 5:112594003-112594025 TAATTGAGGAAACTGAGGCCAGG - Intergenic
995578948 5:113574244-113574266 AAACTGAGGCAACTGAGGTCTGG - Intronic
996290944 5:121851926-121851948 GAAGTGGGGAAACTGAGGCCCGG - Intergenic
996546624 5:124685865-124685887 ACAGTGAGGAAAATGAAGTATGG - Intronic
996913558 5:128683022-128683044 CAGATGAGGAAACTGAGGACAGG + Intronic
997316960 5:132944534-132944556 CTACTCAGGAAACTGAGGTCTGG + Intronic
998145667 5:139726667-139726689 CAAATGAGGAAACTGAGGCTTGG + Intergenic
998370721 5:141659376-141659398 CCATTCAGGAGACTAAGGTCAGG + Intronic
998453127 5:142249987-142250009 TCAGTGGGGAAACTGAGGCCTGG + Intergenic
998521247 5:142802865-142802887 CAGGTGAGGAAACTGAGGTTTGG - Intronic
998953385 5:147414076-147414098 CAGGTGAGGAAACCGAGGTCTGG - Intronic
999093564 5:148958457-148958479 CTAATGTGGAAACTGAGGCCCGG + Intronic
999209427 5:149874955-149874977 CAGATGAGGAAACTGAGGTGAGG + Intronic
999301191 5:150491609-150491631 CAGATGAGGAAACTGAGGCCTGG + Intronic
999303883 5:150507696-150507718 CAGGTGGGGAAACTGAGGTCTGG + Intronic
999449539 5:151667722-151667744 CCTGTGAAGAAACTGTGGCCTGG - Intronic
999504667 5:152182292-152182314 GCAGATAGGAAATTGAGGTCCGG - Intergenic
999760850 5:154699884-154699906 CAAGTGGAGAAACTGAGGCCCGG + Intergenic
999905023 5:156131337-156131359 TGAATGAAGAAACTGAGGTCTGG - Intronic
1000015077 5:157268746-157268768 CCAGTGAGGTGACTGATGTCTGG - Intronic
1000294843 5:159904262-159904284 CAGGTGGGGAAACTGAGGCCAGG - Intergenic
1001050127 5:168407432-168407454 CCAGTGAAATATCTGAGGTCAGG - Intronic
1001086670 5:168704995-168705017 CAGCTGAGGAAACTGAGGTGAGG + Intronic
1001265467 5:170271058-170271080 CAGATGAGGAATCTGAGGTCAGG + Intronic
1001584078 5:172820917-172820939 CCAGTGGGCAAACTGAGGCACGG + Intergenic
1001598469 5:172913773-172913795 CCAGTGAGGTGACAGAGGGCAGG + Intronic
1001820675 5:174707799-174707821 CAGGTGAGGAAACTGAGGCTCGG - Intergenic
1002099678 5:176851177-176851199 CCAATGAAGAAACTGAGGCATGG - Intronic
1002165139 5:177339275-177339297 CAAGTGAGGAAAATCAGGCCGGG + Intronic
1002304489 5:178275134-178275156 CAAATGAGGAAACTGAGGCTCGG - Intronic
1002330019 5:178434736-178434758 CCGCTGAGGAAACTGAGGCCTGG + Intronic
1002861424 6:1082933-1082955 CAAATGAGGAAACAGAGGCCCGG + Intergenic
1003314607 6:5001196-5001218 ACAGTGAGGAAACTGAGGCTTGG - Intronic
1003462394 6:6342073-6342095 TCAGTGAGGACACTGAGGCCAGG - Intergenic
1003555203 6:7133178-7133200 CAGGTGAGGAAAGTGAGGCCTGG + Intronic
1003773606 6:9335604-9335626 CCAGTGTGGAGACTGAAGGCTGG - Intergenic
1003949848 6:11107231-11107253 GCAGTAAGGAAACTGAGTTAAGG + Intronic
1005425060 6:25693902-25693924 CAGATGAGGAAACTGAGGTTTGG - Intronic
1006007840 6:31017013-31017035 TCAGGGAGGCAGCTGAGGTCCGG - Intronic
1006379727 6:33690516-33690538 CAGGTGAGGAAACTGAGGCATGG - Intronic
1006383974 6:33718586-33718608 CCGAAGAGGAAACTGAGGTAGGG + Intergenic
1006474893 6:34247316-34247338 CCAGTGAGTAACCTGAGGCTGGG + Intronic
1006519405 6:34562769-34562791 TCAGGGAGGAAACTGAGGCACGG + Intergenic
1007104784 6:39276090-39276112 CAAGTGAGTCACCTGAGGTCAGG + Intergenic
1007164637 6:39820764-39820786 CAGATGAGGAAACTGAGGCCTGG - Intronic
1007227884 6:40327699-40327721 CAAGTGAAGACACTGAGCTCTGG + Intergenic
1007228763 6:40333488-40333510 TCGGTGAGGAAACTGAGGCATGG - Intergenic
1007301951 6:40874403-40874425 ACAATGAGGAAACTGAGGCCAGG + Intergenic
1007376796 6:41462491-41462513 CCATTGAGGCACCTGAGCTCTGG - Intergenic
1007569194 6:42877077-42877099 AAAGTGAGGTTACTGAGGTCAGG - Intergenic
1007629663 6:43265776-43265798 AAAGTCAGGAGACTGAGGTCTGG + Intronic
1007778223 6:44236004-44236026 CCTGTGAAAACACTGAGGTCAGG - Intergenic
1007784862 6:44273784-44273806 CAGATGAGGAAACTGAGGCCTGG + Intronic
1007926726 6:45655680-45655702 CCATTGAGGAAATTGAGGCTCGG - Intronic
1008556084 6:52673866-52673888 ACACTGAGAAAACTGAGGTAGGG - Intronic
1008827199 6:55710866-55710888 CCAGCTAGGAAACTGAAGTTAGG + Intergenic
1008837343 6:55850845-55850867 GCAATGAGGAAATTGAGGTTTGG - Intronic
1008853957 6:56058773-56058795 CCAATGAGGAAACTGAGACATGG + Intronic
1010055362 6:71558147-71558169 CCAGTGGGGATACTGGGCTCTGG + Intergenic
1010374452 6:75150435-75150457 CCAGTGAAGAAACTGAGATCTGG - Intronic
1010725651 6:79329373-79329395 CCAGGGGAGAAACTGAGGTGAGG - Intergenic
1011049942 6:83135081-83135103 CAAGTGAGGGAATAGAGGTCAGG + Intronic
1011362302 6:86540394-86540416 TCAGTGTGGAAAGTGGGGTCTGG - Intergenic
1011456066 6:87550924-87550946 CCACAGAGGAAACTGAGATGGGG + Intronic
1011643194 6:89433598-89433620 CCAGGGAGGCAACTGATGCCAGG - Intronic
1011669507 6:89669707-89669729 CAAATGAGGAAACTGAGGCTTGG + Intronic
1013023574 6:106245515-106245537 CATGTGAGGAAACTGAGGCTAGG - Intronic
1013419399 6:109952326-109952348 CAGGTGTGGAAACTGAGGTACGG - Intergenic
1013428050 6:110032926-110032948 CCTGTGAGGAAAGTGAGGCTAGG + Intergenic
1013530236 6:111012556-111012578 CAATTGAGAAAACTGAGGCCTGG + Intronic
1013819111 6:114134291-114134313 CAGGTGAAGAAAATGAGGTCAGG + Intronic
1014124260 6:117759109-117759131 CCAGTGAGGAGAAAGAGGACTGG - Intergenic
1014230971 6:118901842-118901864 GAAGTGAGAAAACAGAGGTCAGG - Intronic
1016529612 6:145043072-145043094 CCCCTGAGAAAAGTGAGGTCTGG - Intergenic
1016829316 6:148417697-148417719 CCAATGAGGAAACTGAGGCATGG - Intronic
1016999916 6:149989551-149989573 CCAGTGAATCACCTGAGGTCAGG - Intergenic
1017128981 6:151091849-151091871 CAAGGGAAGAAACTGAGGTTTGG - Intronic
1017678807 6:156842856-156842878 CCAGTGGGGAAACAGAGGTTAGG + Intronic
1017882509 6:158571837-158571859 CAGGTGGGGAAAGTGAGGTCTGG - Intronic
1017978738 6:159380133-159380155 ACAGTGAGCTAACTGAGGTGTGG - Intergenic
1018347980 6:162922303-162922325 CCCCTGAGGAAAGGGAGGTCTGG - Intronic
1018431030 6:163723082-163723104 CTAGTGAGGATACTGAAGTTAGG + Intergenic
1018970774 6:168527305-168527327 TGAGTGGGGAAACTGAGGCCCGG - Intronic
1019147346 6:169983849-169983871 CAAGTGGGTAAACTGAGGCCTGG - Intergenic
1019197889 6:170292505-170292527 ACAGTGAGGACACTGTGGCCAGG - Intergenic
1019502191 7:1369852-1369874 CAAACGAGGAAACTGAGGCCCGG + Intergenic
1019520968 7:1460285-1460307 CCAGAGGAGAAACTGAGGCCAGG + Intergenic
1019564871 7:1674253-1674275 CCAGTGGGGAAACTGAGCCATGG + Intergenic
1019570680 7:1710596-1710618 CAGGTGGGGAAACTGAGGCCCGG + Intronic
1020029600 7:4923683-4923705 CAAGGGAGGAAACTGAGGCTTGG - Intronic
1020076184 7:5260493-5260515 CAAATGAGGAAACTGAGGCATGG + Intergenic
1021615377 7:22498296-22498318 CCAGTGCGGGAGCTGGGGTCTGG - Intronic
1022421295 7:30226191-30226213 CCAGGGAGGGAGCTGAGGCCTGG - Intergenic
1022984625 7:35639382-35639404 GAAGTGAGGAAACTGAAGTATGG - Intronic
1024274761 7:47668695-47668717 CCAGTGAGAAAACAGAGGCATGG + Intergenic
1024558439 7:50623429-50623451 CCTATGAGCAGACTGAGGTCAGG - Intronic
1025202904 7:56973078-56973100 CAAATGAGGAAACTGAGGCATGG - Intergenic
1025635625 7:63317391-63317413 CAGCTGAGGAATCTGAGGTCTGG + Intergenic
1025647071 7:63430789-63430811 CAGCTGAGGAATCTGAGGTCTGG - Intergenic
1025669040 7:63603848-63603870 CAAATGAGGAAACTGAGGCATGG + Intergenic
1025780043 7:64593406-64593428 CACGTGGGTAAACTGAGGTCAGG + Intergenic
1026123223 7:67555872-67555894 CAAGTGAGGAAACTGAGGCATGG - Intergenic
1026157972 7:67843906-67843928 CAAGAGAGGAAACACAGGTCAGG + Intergenic
1026426954 7:70304274-70304296 TGAGTGAGGAAACTGAGGCCAGG + Intronic
1026918025 7:74134297-74134319 ACAGTGATGAAACTGACCTCTGG + Intergenic
1028264092 7:88701996-88702018 CCAGTTAGGATACTAAGATCTGG + Intergenic
1028265145 7:88714709-88714731 CCACTCAGGAAGCTGAGGTGGGG - Intergenic
1028377120 7:90156336-90156358 CCAGTGAGGGAGCTGGGGTCTGG + Intronic
1029026561 7:97423027-97423049 CAGATGAGGAAACTGAGATCTGG + Intergenic
1029270489 7:99374490-99374512 CCAATGGGGAAACTGAGGCTGGG - Intronic
1029612876 7:101636699-101636721 CGGCTGAGGAAACTGAGGCCTGG + Intergenic
1030125520 7:106149355-106149377 CTGATGAGGAAACTGAGGCCAGG - Intergenic
1030358367 7:108569042-108569064 CTCCTGAGGAAACTGAGGCCCGG - Intronic
1031035723 7:116785576-116785598 CCAGTGTGGGAGCTGAGGCCTGG - Intronic
1031206842 7:118769969-118769991 CATTTGAGGAAACTGAGGTTTGG - Intergenic
1031368291 7:120930783-120930805 GAAGTGAGGAAACTGAGGCAAGG + Intergenic
1031980816 7:128123165-128123187 CTGATGAGGAAACTGAGGCCAGG + Intergenic
1032223293 7:130010364-130010386 GGAGTGGGGAAACTGAGGTGTGG - Intergenic
1032256894 7:130304676-130304698 TCAGGGAGGAAAGCGAGGTCAGG + Intronic
1032456078 7:132074605-132074627 CAGGTAAGGAAACTGAGGCCAGG - Intergenic
1032492470 7:132333733-132333755 TCAGTGAGGAAAATCAGCTCCGG + Intronic
1032503252 7:132415767-132415789 CAGGTGAGGAAACTGAGGTCTGG + Intronic
1032551870 7:132791859-132791881 ACAGTGAGGAACTTGGGGTCAGG - Intronic
1033646711 7:143310545-143310567 TTTCTGAGGAAACTGAGGTCAGG + Intergenic
1033761234 7:144438765-144438787 CCAGTGAGGAAGCTGAGTCCAGG - Intergenic
1033820801 7:145131922-145131944 CCAGTGGAGAAACTGAGCCCTGG - Intergenic
1034017329 7:147601185-147601207 CCAGTGAAAATACTGATGTCTGG - Intronic
1034107605 7:148503633-148503655 CAAATGAGGAAACTGAGGCACGG + Intergenic
1034252093 7:149700990-149701012 CCACTGTGGGCACTGAGGTCTGG + Intergenic
1034272455 7:149809758-149809780 CCAGTGAGGAAACAGAGATTAGG - Intergenic
1034276761 7:149827240-149827262 CCAGTGAGGAAACTGAGGTCTGG + Intergenic
1034545292 7:151785203-151785225 CCAGAGAGGAAGCTGGGGCCAGG + Intronic
1034974167 7:155438350-155438372 CCAATAGGGAAACTGAGGCCTGG - Intergenic
1035403984 7:158586955-158586977 CCGGGGAGGAAACTGAGGCAGGG + Intronic
1036637044 8:10558339-10558361 CCAGTGTTGAAGGTGAGGTCTGG - Intergenic
1036811352 8:11869019-11869041 CCGGTGAGTCACCTGAGGTCGGG + Intronic
1037085292 8:14841805-14841827 CAAGTGAGGAAATTGAGACCTGG + Intronic
1037097574 8:15004002-15004024 CCCCTGAGAAAAGTGAGGTCTGG + Intronic
1037430089 8:18802685-18802707 CAAATCAAGAAACTGAGGTCTGG - Intronic
1037508245 8:19554688-19554710 CCAGTGAATCACCTGAGGTCAGG + Intronic
1037697494 8:21238056-21238078 CAGGTGAGGAAACTGAGGCTTGG - Intergenic
1038439157 8:27559707-27559729 ACAGGGAGGGGACTGAGGTCTGG - Intergenic
1038449575 8:27631333-27631355 CAGATGAGGAAACTGAGGTATGG - Intergenic
1038664599 8:29527220-29527242 CAGGTGAGGAAACTGAGGGGCGG + Intergenic
1038972913 8:32657470-32657492 CCAGTGAGAAACCACAGGTCTGG - Intronic
1039876455 8:41590520-41590542 CAGGTGAGGACACTGAGGTTGGG - Intronic
1039917909 8:41873341-41873363 CAAGTGAGGAAAGTGAGGCCTGG - Intronic
1039919050 8:41880493-41880515 CAAATGAGGAAACTGAGACCTGG - Intronic
1039929881 8:41976172-41976194 TCAGGGAGGAAACCAAGGTCAGG + Intronic
1039936837 8:42052374-42052396 CCGCTGGGGAAACTGAGGGCAGG + Intergenic
1039951907 8:42179533-42179555 CCAACGAGGAAACTGAGGCTGGG + Intronic
1040555777 8:48476404-48476426 CCAGTGGGGAAACTGTGGTGTGG - Intergenic
1040559583 8:48512516-48512538 CAGGTGAAGAAACAGAGGTCAGG - Intergenic
1041200400 8:55448527-55448549 TCAGTGAGGAAAATGTGGTTTGG + Intronic
1041539744 8:58970186-58970208 CCAGTAAGAAAACTGAGTCCTGG + Intronic
1042253413 8:66778742-66778764 CAAATGAAGACACTGAGGTCTGG + Intronic
1042502924 8:69529097-69529119 CTAATAAGGAAACTGAGATCCGG + Intronic
1044582774 8:93838633-93838655 CCAGTGTGGGAAGTGAGGCCTGG - Intergenic
1044873294 8:96641453-96641475 AAAGTGAGGCAACTGGGGTCTGG - Intergenic
1045653944 8:104367694-104367716 CCAGCGAGGAACCTGCGGTCCGG + Intronic
1045828657 8:106431386-106431408 ACAGGGAGGAAACTGAGCACAGG - Intronic
1045976374 8:108134147-108134169 CAGATGAGGAAACTGAGGTTCGG - Intergenic
1046121099 8:109848434-109848456 CCATTGAGGAACCTGAGGACAGG - Intergenic
1046520940 8:115324786-115324808 CCAGAGAGGAACCAGAGGTCTGG + Intergenic
1047179061 8:122569844-122569866 CAAGTGTGGAAACTGAGGCATGG + Intergenic
1047372612 8:124268290-124268312 CACATGAGTAAACTGAGGTCTGG - Intergenic
1047534058 8:125703233-125703255 ACAGAGAGGAAGCTGAGGCCTGG - Intergenic
1048000812 8:130378053-130378075 CCAGTGAGGTAAAAGAGCTCTGG + Intronic
1048021667 8:130545317-130545339 CAGGTGAGGAAACTAAGTTCTGG + Intergenic
1048197525 8:132344552-132344574 CAGATGAGGAAACTGAGGCCTGG + Intronic
1048321754 8:133405598-133405620 CAGGTGAGGAAACTGAGGCCTGG + Intergenic
1048630302 8:136234957-136234979 CCAGTGAAGAAACATATGTCAGG - Intergenic
1048883681 8:138891331-138891353 CCAGTGATGAACCTGGGTTCAGG + Intronic
1048980363 8:139700321-139700343 CAGGTGGGGAAACTGAGGTCAGG + Intronic
1049003905 8:139842913-139842935 CAGATGAGGAAGCTGAGGTCCGG + Intronic
1049197011 8:141321181-141321203 CAGATGAGGAAACTGAGGCCTGG + Intergenic
1049246062 8:141563224-141563246 GCAGTGAGGAAACTGAGGTAGGG - Intergenic
1049278844 8:141733843-141733865 CAGATGAGGAAACTGAGGCCCGG - Intergenic
1049310329 8:141930775-141930797 CAGATGAGGAAACCGAGGTCTGG + Intergenic
1049346132 8:142139726-142139748 ACACTGAGGAAACTGAGGCAAGG - Intergenic
1049348958 8:142153910-142153932 CAGATGAGGAAACTGAGGCCGGG - Intergenic
1049353962 8:142178624-142178646 CAAGTGGGGAAACTGAGGCTTGG - Intergenic
1049694113 8:143975343-143975365 CGGGTGAGGACGCTGAGGTCCGG - Intronic
1049695512 8:143982634-143982656 CAAATAAGGAAACTGAGGCCTGG + Intronic
1049696782 8:143987951-143987973 CCAGAGAAGGGACTGAGGTCTGG - Intronic
1049759643 8:144326284-144326306 CCTGTGGGGAAACTGAGGCTTGG - Intronic
1049891819 9:76548-76570 ATAGTGAGGACACTGAGGTTAGG - Intergenic
1050049228 9:1581506-1581528 CAGGTGAGGAAACTGAGGCTTGG - Intergenic
1050139364 9:2501647-2501669 CCTGGGAGGAAACTGAAGTGAGG - Intergenic
1050561565 9:6839789-6839811 CTACTCAGGAGACTGAGGTCAGG + Intronic
1050780545 9:9328863-9328885 CAAGTGAGTAACTTGAGGTCAGG - Intronic
1050786640 9:9411943-9411965 CAAGTGAAGAAACTGAGGCCAGG + Intronic
1051147034 9:14037795-14037817 CAGATGAGGAAACTGAGTTCTGG - Intergenic
1051521383 9:17992529-17992551 CTACTCAGGAGACTGAGGTCGGG + Intergenic
1051538606 9:18188922-18188944 CTAGTGAGGAAACTGAGGCTTGG + Intergenic
1051594263 9:18808643-18808665 CCAGTGGGGAAAATGAGGTTAGG - Intronic
1051604173 9:18904521-18904543 CCACTCAGGAGGCTGAGGTCGGG + Intronic
1052778853 9:32760080-32760102 GGAATGAGGAAACTGAGGCCTGG - Intergenic
1053489633 9:38488959-38488981 CAGGTGTGGAAACTGAGGTGCGG + Intergenic
1053733243 9:41077639-41077661 ATAGTGAGGACACTGAGGTTAGG - Intergenic
1054695177 9:68353924-68353946 ATAGTGAGGACACTGAGGTTAGG + Intronic
1054934081 9:70668273-70668295 CAATTGAGGAAACTGAGGTATGG - Intronic
1055670359 9:78599135-78599157 TAAATGAGGAAACTGAGGCCTGG + Intergenic
1055947336 9:81703430-81703452 TAAGTGAGGAAACTGAGGCCCGG - Intergenic
1056213009 9:84382429-84382451 TAAATGAGAAAACTGAGGTCTGG - Intergenic
1056229574 9:84528635-84528657 GCAGTGAAGCCACTGAGGTCAGG + Intergenic
1056495770 9:87153815-87153837 CAGATGAGGAAACTGAGGTTTGG + Intronic
1056873807 9:90308576-90308598 CAGGGGAGGAAACTGAGGGCTGG - Intergenic
1057739293 9:97697676-97697698 CCACTGAAGAAACTGAACTCTGG - Intergenic
1057874997 9:98747020-98747042 TCAGTGGGGAAACTGAGGTAAGG - Intronic
1058674740 9:107390643-107390665 CCGGTGAGGTGTCTGAGGTCAGG - Intergenic
1058901063 9:109442795-109442817 CAGGTAATGAAACTGAGGTCTGG + Intronic
1059540446 9:115125027-115125049 CAAGTGAGAAAGCTGAGGTGAGG + Intergenic
1059618068 9:115972428-115972450 CAGGTGAGAAAACTGAGGTTTGG - Intergenic
1059770190 9:117416574-117416596 CATGTGAGGAAACTGAGATCAGG + Intergenic
1060147846 9:121267924-121267946 CCCTGGAGGAAACTGAGGCCCGG - Intronic
1060148712 9:121272886-121272908 CCAGTGAGGAAACTCAGGCCTGG + Intronic
1060152065 9:121295207-121295229 GAGATGAGGAAACTGAGGTCTGG + Intronic
1060269988 9:122133434-122133456 CAGATGAGGAAACTGAGGCCAGG + Intergenic
1060273189 9:122162146-122162168 CAGATGAGGAAACTGAGGTATGG - Intronic
1060666350 9:125434250-125434272 CAGATGAGGAAACTGAGGCCAGG - Intergenic
1060882248 9:127125451-127125473 CAAGTGAGGAAACAGAGCTTCGG - Intronic
1060882662 9:127129212-127129234 CAAGAGAGGAGACTGAGGACTGG + Intronic
1061014973 9:127976285-127976307 CAGGTGAGGAAGCTGGGGTCAGG - Intronic
1061139284 9:128754507-128754529 CAGATGAAGAAACTGAGGTCTGG - Intronic
1061140087 9:128760839-128760861 CAGATGAGGAAACTGAGGTCTGG - Intronic
1061397899 9:130353388-130353410 CCTGTAAGGAAACTGAGGCCAGG + Intronic
1061433946 9:130548727-130548749 CAGGTGAGGAAACTGAGGCTTGG - Intergenic
1061515841 9:131089917-131089939 CAGATGAGGAAACTGAGGTGAGG + Intronic
1061551467 9:131337173-131337195 CAGATGAGGAAACTGAGCTCAGG - Intergenic
1061616118 9:131780262-131780284 CTGATGAGGAAACTGAGGCCTGG - Intergenic
1061673933 9:132204750-132204772 CAGATGAGGAAACTGAGGCCAGG + Intronic
1061674914 9:132210229-132210251 CAGGTGGGGAAACTGAGGCCTGG - Intronic
1061720244 9:132546838-132546860 CAGCTGAGGAAACAGAGGTCTGG - Intronic
1061773134 9:132943596-132943618 CAAATGAAGAAACTGAGGCCCGG - Intronic
1061808354 9:133148796-133148818 ACAGTAGGGAAACTGAGGACAGG - Intronic
1061948148 9:133920294-133920316 GCAGTGGGGACACTGAGGCCTGG - Intronic
1062002865 9:134225583-134225605 CAGGTGAGGAAACTGAGGCTGGG - Intergenic
1062022391 9:134325841-134325863 CACGTGGGGAAACTGAGGCCCGG - Intronic
1062291367 9:135796704-135796726 TCAGTGGGGAAACTGAGGCACGG + Intergenic
1062454341 9:136628679-136628701 CAGGTGGGGAAACTGAGGCCTGG - Intergenic
1185737476 X:2504146-2504168 CAGATGAGGAAACTGAGGCCAGG + Intergenic
1186835245 X:13431028-13431050 CCAGGAAGGAAACTGAGGCATGG + Intergenic
1187386515 X:18853561-18853583 CCAGTGAGGAAGCTGAAGAAAGG - Intergenic
1188662319 X:32775324-32775346 CCAGTGAGGACTCTGTGGTGGGG + Intronic
1188865282 X:35306191-35306213 CTAGTGAGGACACTGTGGTGTGG - Intergenic
1189004034 X:36976983-36977005 CCAGTAGGGAAACTGAGGCACGG - Intergenic
1189094270 X:38121418-38121440 GAAGTGAGGAAATTGAGGTCAGG - Intronic
1189294345 X:39908307-39908329 CCACAGAGGAATCTGAGGCCCGG - Intergenic
1189328802 X:40130268-40130290 CAGGTGAGGAAACTGAGGCATGG + Intronic
1189498952 X:41536333-41536355 CCAGTGAATCACCTGAGGTCAGG - Intronic
1189861335 X:45275772-45275794 AAACTGAGGCAACTGAGGTCTGG - Intergenic
1190241937 X:48663722-48663744 CAAGTGAGAAGACTGAGCTCAGG - Intergenic
1190456054 X:50628736-50628758 CCAGATAGGAAACTGAGGTGAGG - Intronic
1190844600 X:54180736-54180758 CAAATGAGGAAACTGAGGCACGG - Intronic
1190931204 X:54950854-54950876 CCAGTGGGGGAGCTGAGGGCAGG + Intronic
1191716969 X:64200412-64200434 CAAGTGAGGAAACTGAAGCTTGG + Intronic
1192026352 X:67456849-67456871 CCAGTGAGGAAGGAGGGGTCAGG - Intergenic
1192072957 X:67960533-67960555 CCAGTGTTGAAAGTGTGGTCTGG - Intergenic
1194259736 X:91678540-91678562 CCAATGAGGAAACTGAGAAACGG + Intergenic
1194489117 X:94525232-94525254 CCACTGGGGATCCTGAGGTCAGG + Intergenic
1195153422 X:102097475-102097497 CCAGTGAGGAGAAATAGGTCAGG - Intergenic
1195458248 X:105093848-105093870 CAAGTGAGGAGACTGAGGGTTGG - Intronic
1195675069 X:107501857-107501879 TGAGTGAGGAAACTGAGGCTTGG - Intergenic
1195771606 X:108357458-108357480 CAGGTGGGGAAACTGAGGCCAGG - Intronic
1195846527 X:109235014-109235036 CCAGTGCTGAAAGTGGGGTCTGG - Intergenic
1196036713 X:111153224-111153246 CAGGTGAGAAAACTGAGGTTTGG + Intronic
1196103462 X:111871497-111871519 CCGATGAGGAAACTGAGGGCTGG - Intronic
1196120399 X:112044434-112044456 TAGGTGAGGAAACTGAGGTTTGG - Intronic
1196688552 X:118533540-118533562 CCAGTGTGGAAAATGATGTGTGG + Intronic
1197330880 X:125152925-125152947 CCAGTGAGAAAACTGCAGTTGGG - Intergenic
1198573847 X:137988265-137988287 CAAGTGGAGAAGCTGAGGTCTGG + Intergenic
1198675308 X:139124660-139124682 CAGATGAGGAAACTGAGGTGAGG - Intronic
1199665692 X:150094828-150094850 CCCTTGAGGAAACTGAGGCTCGG + Intergenic
1199828419 X:151523871-151523893 CCAGGGAGGAAACTCACGGCTGG - Intergenic
1200032433 X:153307237-153307259 CAGATGAGGAAACTGAGGCCGGG + Intergenic
1200051310 X:153433317-153433339 CAGATGAGGAAACTGAGGCCAGG + Intergenic
1200066294 X:153505645-153505667 CGTGTGAGGAAACTGAGGCTTGG + Intronic
1200578437 Y:4917733-4917755 CCAATGAGGAAACTGAGAAACGG + Intergenic
1202380389 Y:24271910-24271932 CAATTGAGGAAACTGAGATGGGG + Intergenic
1202490394 Y:25398215-25398237 CAATTGAGGAAACTGAGATGGGG - Intergenic