ID: 1034277154

View in Genome Browser
Species Human (GRCh38)
Location 7:149828991-149829013
Sequence CTCCGGGTATGGAGGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034277146_1034277154 -4 Left 1034277146 7:149828972-149828994 CCCTCTTGCCGCAGGGAGGCTCC 0: 1
1: 0
2: 0
3: 17
4: 134
Right 1034277154 7:149828991-149829013 CTCCGGGTATGGAGGGAACCTGG 0: 1
1: 0
2: 0
3: 10
4: 96
1034277142_1034277154 11 Left 1034277142 7:149828957-149828979 CCAGGGAGCTGCTGTCCCTCTTG 0: 1
1: 0
2: 6
3: 26
4: 330
Right 1034277154 7:149828991-149829013 CTCCGGGTATGGAGGGAACCTGG 0: 1
1: 0
2: 0
3: 10
4: 96
1034277147_1034277154 -5 Left 1034277147 7:149828973-149828995 CCTCTTGCCGCAGGGAGGCTCCG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1034277154 7:149828991-149829013 CTCCGGGTATGGAGGGAACCTGG 0: 1
1: 0
2: 0
3: 10
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034277154 Original CRISPR CTCCGGGTATGGAGGGAACC TGG Intergenic
900370506 1:2329989-2330011 CTCCGGGTGAGGGGGGACCCTGG + Intronic
900394049 1:2445951-2445973 GTCCGGGAACGGAGGGAGCCTGG + Intronic
900578533 1:3396065-3396087 CTCAGGGTGTGGAGTGAATCTGG - Intronic
901799269 1:11698026-11698048 TTCCGGGTATGGATGGAGCCCGG - Intronic
903136585 1:21313358-21313380 CTGGGGGGATGGAGGGAGCCCGG + Intronic
914703029 1:150150633-150150655 CGCAGGGCCTGGAGGGAACCTGG + Intronic
915076070 1:153308844-153308866 CTCCTGGAATGGAGGGAGGCTGG - Intronic
915148055 1:153807166-153807188 CTCTGGGGATGGAGGAAGCCAGG + Exonic
915674400 1:157517129-157517151 CTCCGAGTAAGGAGGCAGCCGGG + Intronic
916019063 1:160776859-160776881 CCCAGGGTCTGAAGGGAACCAGG + Intergenic
919935856 1:202250314-202250336 CTCAGAGTATAGAGGGAAACAGG - Intronic
920206032 1:204292713-204292735 CTCCTGGGATGGATGGAAACAGG + Intronic
922332844 1:224592862-224592884 CTCCAGGTGTGGAAGGAGCCAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1064161230 10:12948376-12948398 CTCAGGATATGGAGGAGACCAGG + Intronic
1077047297 11:552204-552226 CTCAGGGCCTGGAGGGAACATGG + Exonic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1082779410 11:57275000-57275022 CTTCAGGTATGGTGGGATCCAGG + Intergenic
1090251307 11:125253806-125253828 CTCCTGCGATGAAGGGAACCAGG - Intronic
1090467043 11:126944030-126944052 TTCCGGGTAGGGAGGGCACCTGG - Intronic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1096579186 12:52573522-52573544 CTCTGGGTATGGAGGGGGCCGGG - Exonic
1101833942 12:108281923-108281945 CTCAGAGTATGCAGGGAACGTGG - Intergenic
1101997771 12:109537316-109537338 CTCCTGGTGCGGAGGAAACCTGG - Intergenic
1102033938 12:109760346-109760368 CTCCGGTTATGGAGGAAAGAGGG + Intronic
1105829004 13:24147750-24147772 CTAGGGGTGTGGAGGGAACGGGG - Intronic
1105940970 13:25147692-25147714 CTGGGGGTAGGGAGGGAATCAGG + Intergenic
1116408256 14:44593017-44593039 CCCAGGGTAAGGATGGAACCAGG + Intergenic
1119115280 14:72014822-72014844 AGACGGGTATGGAGGGAAGCGGG - Intronic
1122468997 14:101953387-101953409 CTCTGGTTCTGGAGGGATCCTGG - Intergenic
1122627513 14:103091813-103091835 TTCCGGTTAGGGAGGGAGCCTGG + Intergenic
1126845384 15:52755248-52755270 CTCCAGGGATGGAGGGAGCCGGG - Intergenic
1128809993 15:70563788-70563810 CTCCGGGCATGGCAGGCACCTGG - Intergenic
1129853948 15:78811211-78811233 CGCCGGGCATGGCAGGAACCGGG + Exonic
1132927069 16:2436327-2436349 CTCTGGGGATGAAGGGATCCAGG - Intronic
1136070672 16:27785141-27785163 CCCCGGGAATGGAGGGAAGTGGG - Intergenic
1136403379 16:30030334-30030356 CTCAGGGAATGGAAGGGACCTGG - Intronic
1139821769 16:69726682-69726704 CTCCAGGAAGGGAGGGAGCCTGG + Exonic
1141425718 16:83943299-83943321 CTCCTGGTATGCAGGGGACCTGG + Intronic
1142285055 16:89168300-89168322 CTCGGGGTGTGGAGGAAGCCAGG - Intergenic
1142480342 17:215027-215049 CCCGGGGTGTGGAGGGCACCCGG - Intronic
1152544412 17:80993472-80993494 CTCCGTGGGTGGAGGGAACCGGG + Intronic
1154174568 18:12076824-12076846 CTCTGGGCCTGGAGGGAGCCAGG + Intergenic
1155117411 18:22783556-22783578 CTCCAGGTAGGGAGGGACCCAGG - Intergenic
1155147558 18:23096768-23096790 CTCAGTGAGTGGAGGGAACCAGG + Intergenic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163536154 19:17877792-17877814 CTCCATGTATGGCGTGAACCAGG + Exonic
1164670079 19:30067445-30067467 CTCCGGGTAGGGAGAGGCCCAGG + Intergenic
1165716093 19:38046681-38046703 TTCCGGGTGTGGAGGGGCCCAGG + Intronic
1167744570 19:51342936-51342958 CTCTGGGTATAGAAGGACCCTGG - Intergenic
925581195 2:5413370-5413392 CTCCAGGTATAGAGGGTACAGGG - Intergenic
925851966 2:8090740-8090762 CAGCGGGTTTGGAGGGAGCCCGG - Intergenic
930124314 2:47783817-47783839 CTCCGGGTGGGGAGGGGGCCTGG + Intronic
931784564 2:65607770-65607792 CACGGGGAATGGAGGAAACCTGG - Intergenic
933834338 2:86233023-86233045 CTGAGGGTAGGGAGGGATCCTGG - Intronic
942342582 2:174963600-174963622 CTCAGGCCCTGGAGGGAACCTGG + Intronic
946432904 2:219635051-219635073 CTGGGGGAATGGAGGGCACCTGG + Intronic
948827465 2:240579564-240579586 AAGCGGGTATGGAGGGCACCTGG + Exonic
1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG + Intergenic
1171197611 20:23212630-23212652 CTCCTGGTGTGGAAGGAGCCAGG - Intergenic
1175843587 20:62047280-62047302 CTCGGGGTAAGGAGGGAGCCTGG - Intronic
1176075986 20:63248409-63248431 CTCCTGCAATGCAGGGAACCAGG - Intronic
1181308500 22:21930774-21930796 CCCCGAGGCTGGAGGGAACCTGG - Intronic
1181558635 22:23686719-23686741 CGTCAGATATGGAGGGAACCAGG + Intergenic
1183858807 22:40654103-40654125 CACGGGGTATGGGGGGAAGCAGG + Intergenic
1183989629 22:41589427-41589449 CTCCGGGGAGGGAGGGAGCTAGG + Intronic
1185214473 22:49590561-49590583 CTCGGGGTAGGGAAGGAGCCTGG + Intronic
950205284 3:11075602-11075624 TTCCGGGTCGGGTGGGAACCTGG - Intergenic
954421829 3:50422979-50423001 CCCTGGGTCTGGGGGGAACCTGG - Intronic
956386404 3:68724663-68724685 CTCCAGGTATGGGAGGAACAAGG - Intergenic
958114929 3:89203300-89203322 TTCCGGCTAAGCAGGGAACCAGG - Intronic
958537168 3:95418558-95418580 GTGTGGGTAGGGAGGGAACCCGG + Intergenic
960465963 3:117997079-117997101 CTCCGGTTCTGGATGGAACAGGG - Intergenic
966039900 3:175470235-175470257 CCTGGGGTATGGAGGGAACGGGG + Intronic
968908339 4:3464516-3464538 CTCCGGGGCTGCAGGGGACCTGG + Intronic
983938340 4:173518346-173518368 CTCCAGGTAGGCAGGGAACCCGG + Intergenic
985191363 4:187376909-187376931 CTCCAGTTAAGGAGGGAAGCAGG + Intergenic
985423512 4:189807015-189807037 TTCCGGGTAGGGTGGGAACTCGG - Intergenic
995173460 5:109144678-109144700 CTCCAAGAATGGAGGGAAACTGG - Intronic
1000278226 5:159758600-159758622 AACTGGTTATGGAGGGAACCGGG - Intergenic
1001267635 5:170286181-170286203 CTCAGGGAATGGTGGGACCCTGG + Intronic
1004390576 6:15206225-15206247 CTCAGGGGATGGCGTGAACCCGG - Intergenic
1005227314 6:23657627-23657649 CTCCGGGCTTGGAGGGACCAAGG - Intergenic
1007704644 6:43783361-43783383 CTCAGGGGATGCTGGGAACCAGG + Intronic
1015451448 6:133371815-133371837 CTACGTGTATTGAGGAAACCAGG + Intronic
1018705839 6:166462545-166462567 GTCCTGGGCTGGAGGGAACCGGG - Intronic
1018872544 6:167794588-167794610 CTCCCAGTGTGGTGGGAACCAGG - Intronic
1020732304 7:11895944-11895966 CTTCCGGTAAGGAGGGAACTTGG + Intergenic
1023202122 7:37709952-37709974 CTGCGGGCGTGCAGGGAACCCGG - Intronic
1034277154 7:149828991-149829013 CTCCGGGTATGGAGGGAACCTGG + Intergenic
1035166476 7:156993354-156993376 GTCCGGGTATGGCGGGAGCTGGG + Intergenic
1035313208 7:157982920-157982942 CTCGGGGTTTGGGGGGAACCTGG - Intronic
1037581263 8:20247209-20247231 CTCTGTGTATGGAAGGTACCGGG + Exonic
1038359801 8:26865255-26865277 CTTCGGGTAGGGAGGGAGTCCGG - Exonic
1041292362 8:56319778-56319800 CTCCGGGTGGGGAGGGAGGCTGG + Intronic
1048898198 8:139013652-139013674 CTGGGGCTATGAAGGGAACCTGG + Intergenic
1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG + Intergenic
1050236431 9:3585952-3585974 CTCCAGGGCTGGAGTGAACCAGG + Intergenic
1060939247 9:127534291-127534313 CTCCAGGTACCGAGGGCACCTGG + Intronic
1061652743 9:132064247-132064269 CTCCGGGTATGCTGGGTTCCCGG - Intronic
1186154431 X:6710855-6710877 CTCCAGCTATGGAGGAAAACTGG - Intergenic
1187336750 X:18388244-18388266 CTTCAGGCATGGAGGGATCCAGG - Intergenic
1192210052 X:69122043-69122065 CTCCTGGTATGCAGGGAAAATGG + Intergenic
1194698084 X:97080367-97080389 TTCCAGGTATGGAGGCATCCAGG - Intronic
1195718597 X:107843391-107843413 CTCCAGGGATGGATGGAACATGG + Intronic
1195740545 X:108060888-108060910 CCAGGGGTATGGAGGGAACAGGG - Intronic
1200176985 X:154123807-154123829 GTCCTGGGATGGAGAGAACCAGG + Intergenic