ID: 1034278319

View in Genome Browser
Species Human (GRCh38)
Location 7:149834114-149834136
Sequence GTCCAGGTTCACCAGTCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034278319_1034278328 25 Left 1034278319 7:149834114-149834136 CCCCATGACTGGTGAACCTGGAC No data
Right 1034278328 7:149834162-149834184 GTTCCATCTGTAGCTGGACAGGG No data
1034278319_1034278327 24 Left 1034278319 7:149834114-149834136 CCCCATGACTGGTGAACCTGGAC No data
Right 1034278327 7:149834161-149834183 AGTTCCATCTGTAGCTGGACAGG No data
1034278319_1034278325 19 Left 1034278319 7:149834114-149834136 CCCCATGACTGGTGAACCTGGAC No data
Right 1034278325 7:149834156-149834178 GCCTCAGTTCCATCTGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034278319 Original CRISPR GTCCAGGTTCACCAGTCATG GGG (reversed) Intergenic