ID: 1034278922

View in Genome Browser
Species Human (GRCh38)
Location 7:149838441-149838463
Sequence ACGTCGGGGGGCGGTAGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034278922_1034278929 -4 Left 1034278922 7:149838441-149838463 CCGGCGCTACCGCCCCCCGACGT 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1034278929 7:149838460-149838482 ACGTGAGAGAGCGAAGTTCTTGG 0: 1
1: 0
2: 1
3: 2
4: 55
1034278922_1034278931 18 Left 1034278922 7:149838441-149838463 CCGGCGCTACCGCCCCCCGACGT 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1034278931 7:149838482-149838504 GGCCGCGCTCCCTCCCTACCTGG 0: 1
1: 0
2: 0
3: 18
4: 199
1034278922_1034278932 19 Left 1034278922 7:149838441-149838463 CCGGCGCTACCGCCCCCCGACGT 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1034278932 7:149838483-149838505 GCCGCGCTCCCTCCCTACCTGGG 0: 1
1: 0
2: 1
3: 17
4: 151
1034278922_1034278930 -3 Left 1034278922 7:149838441-149838463 CCGGCGCTACCGCCCCCCGACGT 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1034278930 7:149838461-149838483 CGTGAGAGAGCGAAGTTCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034278922 Original CRISPR ACGTCGGGGGGCGGTAGCGC CGG (reversed) Exonic