ID: 1034279282

View in Genome Browser
Species Human (GRCh38)
Location 7:149840966-149840988
Sequence CTGAGGTTTCACTTAGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034279282_1034279289 19 Left 1034279282 7:149840966-149840988 CCAACCACTAAGTGAAACCTCAG 0: 1
1: 0
2: 1
3: 11
4: 129
Right 1034279289 7:149841008-149841030 TGATTATAATCTTGATTTTAGGG No data
1034279282_1034279288 18 Left 1034279282 7:149840966-149840988 CCAACCACTAAGTGAAACCTCAG 0: 1
1: 0
2: 1
3: 11
4: 129
Right 1034279288 7:149841007-149841029 TTGATTATAATCTTGATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034279282 Original CRISPR CTGAGGTTTCACTTAGTGGT TGG (reversed) Intronic