ID: 1034279735

View in Genome Browser
Species Human (GRCh38)
Location 7:149844720-149844742
Sequence GCTGGTGGCACCACTGGGTA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034279728_1034279735 10 Left 1034279728 7:149844687-149844709 CCAGCAACAGAAGGAGCTCTGTG 0: 1
1: 0
2: 0
3: 24
4: 219
Right 1034279735 7:149844720-149844742 GCTGGTGGCACCACTGGGTATGG 0: 1
1: 0
2: 0
3: 20
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034279735 Original CRISPR GCTGGTGGCACCACTGGGTA TGG Exonic
900977910 1:6028586-6028608 GCTGGTGGCCGCTCTGGGTGCGG + Intronic
901338831 1:8476374-8476396 TCTGGTGGGAGCAATGGGTACGG + Intronic
901626020 1:10625554-10625576 GCAGGTGGCACCTCTGTGTGTGG - Intronic
902188227 1:14741340-14741362 GCTGGTGGCACAGGTGGCTATGG + Intronic
902528939 1:17077898-17077920 GCTGGTGGGTCAACTGGGCAGGG + Intronic
905900957 1:41581700-41581722 GCTGGTGGAGCCACTGGGGCTGG + Exonic
906680757 1:47724162-47724184 GCTGGTGACAGCTCTGGGGATGG - Intergenic
909172956 1:72318031-72318053 GATGTTGCCACTACTGGGTATGG + Intergenic
910934497 1:92476296-92476318 GCTGGTTGCACCACAGTCTAAGG + Intronic
912977367 1:114342685-114342707 GCTGCTGGCACCACTGGCGCTGG - Intergenic
918814767 1:189168657-189168679 GATGTTGCCACCACTGGGGATGG - Intergenic
919878803 1:201889051-201889073 GCTGGGGGCTCCCCTGGGTAAGG + Exonic
921054620 1:211534545-211534567 GGTGGAGGCACCACTGGCTGGGG + Intergenic
924456070 1:244219743-244219765 GCTCGTGGCAGCAATGGGTGGGG + Intergenic
1067829406 10:49601643-49601665 GCTGGTGTCAACACCGGGTGAGG + Intergenic
1069096802 10:64269165-64269187 GCAGTTGGCACTACTGGCTATGG + Intergenic
1073224570 10:101906753-101906775 ACTTGTGGGACCTCTGGGTAGGG + Intronic
1073556980 10:104463328-104463350 GATGTTGCCACTACTGGGTATGG - Intergenic
1074858237 10:117489353-117489375 GCTGATGGCAGCACTGAGTCTGG - Intergenic
1075606521 10:123815537-123815559 GATGTTGCCACTACTGGGTATGG - Intronic
1076763568 10:132617774-132617796 GCTGGAGGCAAAACTGGGGAAGG - Intronic
1076798976 10:132811968-132811990 GCTGATGGCCCCACTGTGTGGGG - Intronic
1077077445 11:707982-708004 GCTGGGTGCACCAGGGGGTATGG - Intronic
1077997153 11:7463946-7463968 GCTAGTGGTATCCCTGGGTATGG + Intronic
1079003411 11:16776069-16776091 GCTGGTGACACTACAGGGTGGGG - Intergenic
1080403909 11:31961579-31961601 GCTGGGGGCGGCAGTGGGTATGG + Intronic
1080643780 11:34173786-34173808 GCTGGTGGCAGCCCTGGGTTTGG - Intronic
1083294515 11:61707855-61707877 GCTGGTGGCAGGGCTGGGCAGGG + Intronic
1083757979 11:64801676-64801698 GCTGGGGGCACTCCTGGGGAGGG - Intronic
1083828874 11:65218362-65218384 CCTGGGGACACCACTGGGCACGG + Intergenic
1083871068 11:65488910-65488932 GCTGGTGACGTCACTGGGCAGGG + Intergenic
1085294882 11:75425716-75425738 GGTGGTGGCAGCACTGGGCTCGG - Intronic
1085741221 11:79079939-79079961 GCTGGTGTGACCACTCAGTAGGG - Intronic
1088711684 11:112514150-112514172 GCTGGAGGCAGCACGGGGGAAGG - Intergenic
1089860474 11:121586118-121586140 ACTGGTACCACCACTGGGGAGGG - Intronic
1090631093 11:128648883-128648905 GCTGCTGCCAACACTGGGGAGGG - Intergenic
1094080901 12:26534082-26534104 GCTGGTGTCTCCACGGGGTTAGG - Intronic
1100408312 12:94290502-94290524 GGTGGGGGCAGCACTGGGCAGGG - Intronic
1102646416 12:114406698-114406720 TCTGGTGGCCCCACTGGGTGGGG - Intronic
1102971952 12:117175597-117175619 GCTGGTGGCAACACTGGGACTGG - Intronic
1103172837 12:118836257-118836279 ACTGGGGGCACCACAGGGAAAGG + Intergenic
1103564326 12:121807925-121807947 GCGGGTGGCACCTCTGGGTTTGG + Intronic
1104156288 12:126136226-126136248 ACTGGTGGCAACAGTGGGTAAGG + Intergenic
1104408054 12:128534837-128534859 GCTGGTGTCACCTCTGGATGGGG - Intronic
1106551517 13:30775569-30775591 GCTGGTGGCAGAACTGTCTATGG + Intergenic
1106911674 13:34469817-34469839 GCTGGTGTCATCACCGTGTATGG + Intergenic
1109951360 13:69504755-69504777 GATGCTGCCACCACTGGGGATGG + Intergenic
1111687726 13:91522058-91522080 GATGGTGGCACTCCTGGGGAGGG - Intronic
1114692894 14:24601284-24601306 GATGGTAGCAGCAATGGGTAGGG + Intergenic
1118308115 14:64673117-64673139 ACTGGTACCACCAATGGGTAAGG + Intergenic
1119876418 14:78063520-78063542 GCTGCTGGAGCCTCTGGGTAAGG + Intergenic
1120845325 14:89120039-89120061 GCTGGTGGCAGTATTGTGTATGG + Intergenic
1121088799 14:91167215-91167237 GCTGGTCGGAGCTCTGGGTATGG - Exonic
1121239277 14:92416362-92416384 GCTGGTGGCACCAAAGGAAATGG + Intronic
1122516470 14:102312393-102312415 GCTGGTGGCTCCCCTGGGCTTGG + Intergenic
1122663388 14:103312438-103312460 GCCTGTGCCACCACTGGGTGAGG - Intergenic
1126375172 15:47990392-47990414 TCTGGTGGCACTACTGGGTGTGG - Intergenic
1129297700 15:74608952-74608974 GCTGCTAGCAGCACTGGGTGTGG - Intronic
1129316989 15:74751016-74751038 GCTGGTAGCAGCCCTGGGTATGG - Intronic
1129738089 15:77976733-77976755 GTGGGTGGCAGCACTGGGTAGGG + Intergenic
1129882989 15:79019219-79019241 GCTGGTGTCCCCACAGGGCAGGG + Intronic
1130057250 15:80537148-80537170 GCTGGTGGCAGAACTGGTGAAGG - Intronic
1131283636 15:91040183-91040205 GATGGGGGCAGCACTGGGGAGGG - Intergenic
1134445952 16:14331519-14331541 GCAGGGGGCACGACTGGGCATGG + Intergenic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1137456232 16:48620003-48620025 GCTGATGGCATCACAGGGTCAGG - Intronic
1137456481 16:48621678-48621700 GCTGATGGCATCACAGGGTCAGG - Intergenic
1141699220 16:85634848-85634870 GCTGCTGGCACAAATGGGGAGGG + Intronic
1142681950 17:1555148-1555170 GCTAGTGGTACCACTTGGGAAGG + Intronic
1143015465 17:3889123-3889145 GCTGGTGGGACCAGTGACTATGG - Intronic
1143527711 17:7482104-7482126 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1144102396 17:11953280-11953302 GCTGGTAGAACCACTGAGTCTGG - Intronic
1145811290 17:27765704-27765726 GATGGTGGCACGGCTGGGGAAGG + Exonic
1145988851 17:29065994-29066016 GCTGGTGGCACTACTAGCTCCGG + Intergenic
1146731047 17:35194166-35194188 GCTGGTGGCCCTGCTGGGTGGGG - Exonic
1147563060 17:41520724-41520746 CCAGGTGGCACCACTGGTAAGGG + Exonic
1147897128 17:43758155-43758177 GCTGCTGGTACCACTGGGAAGGG - Intronic
1148386468 17:47238194-47238216 CCTGGAGGCACCCCTGGGCAGGG - Intergenic
1149242632 17:54668253-54668275 TCTGATGGCTCCACTGGGGATGG - Intergenic
1150278613 17:63915692-63915714 GGTGGTGGCACTACTAGGCATGG + Intronic
1150279713 17:63922309-63922331 GATGGTGGCACTACTAGGCATGG + Intergenic
1151151862 17:72095283-72095305 GCTGGTGGCGCCTTTGGGAAGGG - Intergenic
1152901299 17:82942539-82942561 GCTGGAGGCACCACTGTGCGAGG - Exonic
1154115454 18:11609715-11609737 GCTGGTGGCCCTGCTGGGTGGGG + Intergenic
1156675701 18:39524948-39524970 GCTGATGGCACCACAGGGAGGGG - Intergenic
1157494067 18:48142747-48142769 GGGGGTGGCACCACTAGCTAGGG + Intronic
1157754544 18:50206238-50206260 GAGGGTGGCACCACTGGAGATGG - Intergenic
1160074277 18:75657687-75657709 CCTGGTGACACCCCTGGGAATGG - Intergenic
1161354889 19:3813521-3813543 GCAGGTGCCAGCCCTGGGTAAGG + Intronic
1162142289 19:8592091-8592113 GTTTGTAGCACCACTGGGTGGGG + Exonic
1162184310 19:8892755-8892777 GCAGCTGGCACCAGTGGGCAGGG + Intronic
1162783667 19:13020889-13020911 TCTGGTGGTACAACTGGGTCAGG - Intronic
1165424366 19:35737849-35737871 GCTGGTGGCACGTCTGGTGAGGG - Exonic
1166214980 19:41328936-41328958 GCTGTTGGCAGCACTGGGTCTGG - Intronic
1167159060 19:47755850-47755872 GATGGTGTCATCACTGGGCACGG - Intronic
1168305187 19:55431464-55431486 GATGGTGACACCATTGGCTATGG + Exonic
925325075 2:3012441-3012463 GGTGGTGGCAGCAATGGGTGGGG - Intergenic
925907355 2:8547439-8547461 GCTGGAGGTACCACTGGGAGAGG - Intergenic
926190886 2:10726766-10726788 GCTGGAGGCAGCACTTGTTAAGG + Intronic
928706381 2:33954130-33954152 GGTGGTGCCACCACTGGTAATGG - Intergenic
938169974 2:129066849-129066871 GCAGGAGGCACCACTGGGGCTGG + Intergenic
938418376 2:131123475-131123497 ACAGGTGGAACCACTGGGTCAGG - Intronic
943689948 2:190859537-190859559 GCTGTTGGCTGCTCTGGGTATGG + Intergenic
945146336 2:206742426-206742448 GATGTTGCCACTACTGGGTATGG - Intronic
945726156 2:213474066-213474088 GCTGTTGCCACTACTGGGCATGG + Intronic
947806706 2:232973696-232973718 GCTGGTGGCTCTTCTGGGTTTGG - Intronic
948575272 2:238945899-238945921 GCTGGTGGCACCAGAGAGCAAGG - Intergenic
948627014 2:239275631-239275653 GCGGGTGGCACACCTGGGTTCGG + Intronic
949017829 2:241723431-241723453 GCTGGTGGCTGCTCTGGGTGTGG + Intronic
1169808458 20:9583724-9583746 GCTGGTGGCACTAATTTGTATGG - Intronic
1170627918 20:18043539-18043561 GCTGGTGGCAGCCCTGAGTTGGG - Intronic
1170712812 20:18807650-18807672 GCTGTAGGCACCACTGTGTTGGG - Intergenic
1170804259 20:19616276-19616298 GCTGTTGGCTCCACTGGGCTGGG - Intronic
1176304781 21:5117690-5117712 GCAGGTGGCACAACTGGGGCCGG + Intronic
1176412307 21:6455634-6455656 GCTGGTGGCTTCAGTGGGCACGG - Intergenic
1179687801 21:43063956-43063978 GCTGGTGGCTTCAGTGGGCACGG - Exonic
1179852273 21:44144340-44144362 GCAGGTGGCACAACTGGGGCCGG - Intronic
1180177896 21:46098887-46098909 GCTGGTGGAACCGCTGGGCCTGG + Intronic
1181282779 22:21731636-21731658 GCAGGTGGCACCACGAGGGAGGG + Intronic
1181313577 22:21958302-21958324 GAGGGTGGCACCACTGGCTGAGG + Intronic
1181346685 22:22224374-22224396 GAGGGTGGCACCACTGGCTGAGG + Intergenic
1181441763 22:22939761-22939783 GCTGGTGGCACCTCTGTGCCAGG - Intergenic
1181777858 22:25172368-25172390 GCAGGTGGCACCACTGTCCAAGG - Intronic
1182300731 22:29335502-29335524 GCTGGTGGCACCTCTGGAGATGG - Intronic
1183193930 22:36340335-36340357 GCTGGTGGAAGCACAGGGTAGGG + Intronic
1183305836 22:37082607-37082629 GATGGGGGCACCTCTGGGAACGG - Intronic
1183952552 22:41359702-41359724 GCTGGAGCCCCCACAGGGTAAGG + Exonic
1184306279 22:43604593-43604615 GCTGGTGGAACCTCTGGACAGGG - Intronic
1185244532 22:49765993-49766015 GCTGGTGGCCCCTGTGGGGAGGG + Intergenic
953714063 3:45300962-45300984 GCTGCTGCCACCACTCAGTATGG - Intergenic
954365479 3:50143856-50143878 GCTGGTGCCAACACAGGGTTGGG + Intergenic
965622208 3:170653255-170653277 TTTGCTGGCACCACTGGGAAAGG + Intronic
966430867 3:179830491-179830513 GCTGGTGGCATCACGTGGGAAGG + Intronic
968235446 3:197028204-197028226 CCTGGTGGGAGCACTGGCTAGGG + Intronic
969616081 4:8253266-8253288 CCTGGTGACAGCACTGGGCATGG + Intergenic
969854866 4:9991026-9991048 GCTGCAGGCAGCACTGGGAAAGG - Intronic
971108865 4:23559892-23559914 GCAGGTGGCAGCACTGTGAAAGG - Intergenic
978742534 4:112153640-112153662 GCCGGGGGAAACACTGGGTATGG - Intronic
985386216 4:189450977-189450999 TCAGGTGCCACCACTGGGCAGGG - Intergenic
985591543 5:767964-767986 GCTGCTGGCACCAGATGGTAGGG - Intergenic
985609459 5:878923-878945 GCTGCTGGCACCAGATGGTAGGG - Intronic
985789210 5:1916260-1916282 CCTGGTGGCCCCACATGGTACGG - Intergenic
986959501 5:13196633-13196655 GCTGATGGCAGCACTGGGATGGG - Intergenic
990827541 5:59918803-59918825 TCTGGAGGCACCACTGGTGATGG - Intronic
991030589 5:62078196-62078218 GCTGCTGGCACCACTGAGTGGGG - Intergenic
991045420 5:62217974-62217996 GCTGATGGCACATCTGGGCAAGG - Intergenic
992089098 5:73302117-73302139 GCTGGTGGGGCGACTGGGCAGGG - Intergenic
993494074 5:88587355-88587377 ACTGGTGGTACCTCTGGGAATGG + Intergenic
998148660 5:139744883-139744905 GCAGCTGCCACCACTGGGAATGG + Intergenic
1000568716 5:162883440-162883462 GCTAGGGGCACAACTGGGTTGGG + Intergenic
1002496912 5:179621897-179621919 GCAGGGGGCAACACTGGGTTTGG - Intronic
1002577138 5:180180559-180180581 GCTCCTGGCACCTCTGGGCAGGG - Intronic
1002608325 5:180397002-180397024 CCTGGTGGCTCGACTGGGGAGGG + Intergenic
1004858283 6:19774061-19774083 GCTGGTGGCAGCTGTGGGCATGG - Intergenic
1005317910 6:24621986-24622008 CCTGGTGGCAGCACTGGGCCTGG + Intronic
1005893665 6:30160579-30160601 GCTGGTGTCCACACTGGGTTTGG - Exonic
1006784112 6:36653483-36653505 GATGGTGGTACCAGTAGGTAAGG - Intergenic
1007545332 6:42689171-42689193 GCTGGTGACATCTCTGGGCAAGG + Intronic
1008231285 6:48987176-48987198 CCTGGTAGCTCCACTGGGTGTGG + Intergenic
1010590977 6:77711616-77711638 GCTGCTGGCACAGCTGGGTTTGG + Intronic
1015854212 6:137606143-137606165 GCTGGTCACACCACTGGGGCAGG + Intergenic
1018599521 6:165524925-165524947 GATGTTGCCACCACTGGGGATGG - Intronic
1021520932 7:21538438-21538460 GCTGGTGGTACCTCTAAGTATGG - Intergenic
1022267588 7:28772339-28772361 GCTTGAGGCAACACTGGGAATGG + Intronic
1024241739 7:47440803-47440825 GCTGGTGGCAGCACTTTGGAGGG - Intronic
1026098991 7:67369160-67369182 GCTGGAGGCACAACTGGGCTGGG + Intergenic
1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG + Intronic
1027238550 7:76312550-76312572 GCTGGTGGGACCACAGGATAAGG + Intergenic
1032019095 7:128396683-128396705 GCTGCTGTCACCACTGGGGGTGG + Exonic
1033081847 7:138306182-138306204 GAGGGTGGCACTCCTGGGTAGGG - Intergenic
1034279735 7:149844720-149844742 GCTGGTGGCACCACTGGGTATGG + Exonic
1034579665 7:152031630-152031652 ACTGGTGGCACACCTAGGTAAGG - Intronic
1035741249 8:1930057-1930079 GCTTGTGGGAGCTCTGGGTACGG + Intronic
1036737488 8:11331226-11331248 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1036982873 8:13490490-13490512 CCTGTTGGCACCACTGTGTCTGG + Intronic
1037898335 8:22673158-22673180 GCAGGTGGCAGCACCGGGCAGGG + Intergenic
1037906638 8:22719384-22719406 GCTTGTGACACCTCTGGGTGAGG + Intronic
1038077000 8:24087467-24087489 GCTGCAGGCACAACTGGATATGG + Intergenic
1038164598 8:25073202-25073224 TCTGGTGGCACCATTCTGTATGG - Intergenic
1038320051 8:26517644-26517666 GCTGGTGGAGCCACTGGTTCTGG - Intronic
1045221419 8:100204058-100204080 GATGTTGCCACTACTGGGTATGG - Intronic
1048329057 8:133459979-133460001 GCTGGTGGCACCTCTGAGAAAGG + Intronic
1048366982 8:133746667-133746689 GCTGGTGTTACCAGTGGGAAAGG + Intergenic
1049541239 8:143210149-143210171 GCTGGTGTCAACACGGGGGAGGG + Intergenic
1049595433 8:143481211-143481233 GCTGGTCGCACCACTGGGCCTGG - Intronic
1052718445 9:32146516-32146538 GATGTTGCCACCACTGGGGATGG - Intergenic
1057963972 9:99485410-99485432 GGAGGTAGAACCACTGGGTATGG - Intergenic
1060724738 9:125999376-125999398 GCTGGCGGCAGCAAGGGGTATGG + Intergenic
1062730198 9:138104279-138104301 GCTGATGGCACCCCTGGGGAGGG + Intronic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1186137365 X:6533957-6533979 GCTGGAGGAACCACTGAGTCAGG - Exonic
1186267069 X:7843722-7843744 GCTGGAGGAACCACTGAGTCAGG + Exonic
1186324758 X:8465969-8465991 GCTGGAGGAACCACTGAGTCAGG + Exonic
1187604528 X:20869456-20869478 GATGTTGCCACCACTGGGGATGG - Intergenic
1190358462 X:49627264-49627286 CTGGGAGGCACCACTGGGTAGGG + Intergenic
1191941573 X:66486465-66486487 AATGTTGGCACTACTGGGTATGG + Intergenic
1192416528 X:70985985-70986007 GCTGTTGGCGCCATTTGGTAAGG + Intergenic
1193574018 X:83177578-83177600 GATGTTGCCACCACTGGGGATGG + Intergenic
1196236390 X:113285717-113285739 GCTGTTGTCAACACAGGGTACGG - Intergenic
1199847618 X:151702437-151702459 GCTGGTGGCCTCACTGGGGTAGG - Exonic
1201438711 Y:13985900-13985922 GCTGGAGGAACCACTGAGTAAGG - Exonic
1201445862 Y:14056808-14056830 GCTGGAGGAACCACTGAGTAAGG + Exonic