ID: 1034280479

View in Genome Browser
Species Human (GRCh38)
Location 7:149850487-149850509
Sequence AAAGCACAGTTACCCCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034280479 Original CRISPR AAAGCACAGTTACCCCAAGC AGG (reversed) Intronic
902101724 1:13996162-13996184 AAAGCACAGTTTCCCCAGCTGGG - Intergenic
904473021 1:30747573-30747595 CAAACACAGCTTCCCCAAGCTGG + Intronic
906550211 1:46659378-46659400 AGAGCACAGTAATCCCAAGCAGG - Intronic
907205449 1:52766689-52766711 AAAGAACATTAACCCCAATCTGG - Intronic
908594366 1:65670909-65670931 AAAGCACAGTTACTAAAATCAGG + Intergenic
909219563 1:72938454-72938476 AAAGCACAGTTTAAGCAAGCTGG - Intergenic
909697446 1:78483827-78483849 AAAGCACAGTTTCCCCAGCTGGG - Intronic
913541245 1:119822784-119822806 AAAGCACAGTTTCCCCAGCTGGG + Intergenic
917456004 1:175186599-175186621 ATAGCACAGCTTCCCAAAGCTGG - Intronic
920630534 1:207647282-207647304 AAAGCACAGATGCCCCAAAGTGG - Intronic
924008315 1:239636842-239636864 AAAGCTGAGGTACCCAAAGCAGG - Intronic
1066525524 10:36274918-36274940 AAAGCACAGTTTCCCCCACTGGG - Intergenic
1070730360 10:78823409-78823431 AAAGCACAGATTCCCCAAATGGG + Intergenic
1072832503 10:98673870-98673892 AAAGCATACTTACCCCATGGAGG + Intronic
1082826859 11:57586388-57586410 AAATCACATTTACCACAAGAGGG - Intergenic
1085483555 11:76842657-76842679 AAGGCTGATTTACCCCAAGCTGG - Intergenic
1085741942 11:79084932-79084954 AAAGAACAGATAACACAAGCAGG - Intronic
1086303803 11:85458997-85459019 AAAGCACAGGTGCCCCATCCAGG - Intronic
1087002469 11:93434716-93434738 AAAGCACAGATTCTCCAAGTGGG + Intronic
1091695614 12:2626213-2626235 AGAGCACAGGTACGCCAGGCAGG - Intronic
1094052169 12:26232333-26232355 AAAGCACAAATGCCCCAAGGTGG + Exonic
1095184217 12:39182739-39182761 AAATTTTAGTTACCCCAAGCAGG - Intergenic
1096258294 12:50075799-50075821 AAAGCACAGCCACCCCAACTTGG + Intronic
1096693628 12:53335613-53335635 AGGGGACAGTTACCTCAAGCAGG + Exonic
1099684384 12:85866359-85866381 AAAGCACAGTTTCCCCAGCTGGG + Intergenic
1099685737 12:85886141-85886163 AAAACACAGATTCACCAAGCAGG + Intergenic
1100852982 12:98732972-98732994 GAACCACACTTACCCCAAGGGGG + Exonic
1102001980 12:109563132-109563154 AAAGTGCAGAGACCCCAAGCAGG - Intronic
1104296825 12:127523462-127523484 AAAGCAGAGCCACCCCTAGCAGG - Intergenic
1110812882 13:79829905-79829927 AAAGCACATATTCCCCAAGTGGG - Intergenic
1114399295 14:22394843-22394865 AATGCACAGTTGCCCAAAGGAGG + Intergenic
1119556391 14:75556510-75556532 CAAGCAAAATTTCCCCAAGCTGG - Intergenic
1120986222 14:90337579-90337601 ATAGCACAGTAAACCCAAGCAGG - Intergenic
1122176230 14:99921493-99921515 CAAGCACAGTGACCCAAAGGAGG - Intronic
1123716153 15:23034034-23034056 AGAGCTCAGTTACCACAAGCTGG - Intronic
1131077764 15:89506562-89506584 AAAGCACTGGTACCACAAGCTGG - Intergenic
1132219150 15:100092157-100092179 AAAGAAAACTTACCCCCAGCAGG + Intronic
1135288455 16:21214130-21214152 GCAGCACAGAGACCCCAAGCAGG + Intronic
1138260080 16:55612536-55612558 AAAGCCCAGTTAACCTGAGCTGG - Intergenic
1139973879 16:70793539-70793561 ATAGCACAGCTACCACCAGCTGG + Intronic
1141322647 16:83026223-83026245 AAAGGACAGTTGCCCCAACATGG - Intronic
1141599059 16:85114285-85114307 ATAGCAAAATTACCCCAAACTGG - Intergenic
1141744159 16:85914568-85914590 AAAGCCCAGATAACCCAAGCAGG + Intronic
1143027095 17:3947357-3947379 AACGCACAGCAACACCAAGCTGG + Intronic
1145222096 17:21097755-21097777 AAAACACCCTTACCCCAGGCTGG - Intergenic
1146210507 17:30938850-30938872 TAAGCATAGTTACCCCACTCTGG - Intronic
1148565313 17:48629190-48629212 AAAGCACTGCTGCCCCAAACTGG + Intronic
1149240960 17:54648563-54648585 AAAGGACAGTTACCAGAGGCTGG + Intergenic
1153922388 18:9803450-9803472 AAAGCACAGTCATCCCAGCCTGG - Intronic
1154450296 18:14470186-14470208 AAGGCAGACTTACCCCAAGAGGG - Intergenic
1156539661 18:37897274-37897296 AAAGCAGAGTGACCCAAAGATGG + Intergenic
1156907537 18:42371790-42371812 AAATCACAGTTAAGGCAAGCTGG - Intergenic
1157991739 18:52504586-52504608 AAAATACAGTCACCCCAAGCTGG - Intronic
1158053030 18:53246682-53246704 CAAGAACAGTTTCCCAAAGCAGG + Intronic
1160884033 19:1336510-1336532 ATGGCACAGGTAGCCCAAGCTGG - Intergenic
1164924215 19:32114424-32114446 ACAGCTCAGTTACCCAAATCAGG - Intergenic
1164924228 19:32114596-32114618 ACAGCTCAGTTACCCAAATCAGG - Intergenic
1166181488 19:41112349-41112371 AAATCCCAGTTTCCCCAATCAGG + Intergenic
1168373851 19:55859183-55859205 AAAACAGAGTTTCCTCAAGCTGG - Exonic
925281169 2:2686244-2686266 AAAGCACAGAGAACCCAGGCAGG + Intergenic
928435145 2:31250044-31250066 ATAGCACAGTGACCCTCAGCAGG + Intronic
936827530 2:116600431-116600453 AAAGCACAAATTCCCCAAGCAGG + Intergenic
937366370 2:121264737-121264759 AAAGCAGAGTGTCCCAAAGCTGG - Intronic
937931432 2:127208331-127208353 AAAGCACAGTTTCCCCAGCTGGG - Intronic
938262112 2:129903665-129903687 AAAGCCCAGGTGCCACAAGCTGG + Intergenic
945892384 2:215443350-215443372 AAAGCACTGTTACCCCAGTGTGG - Intergenic
947137957 2:226993961-226993983 AAAGCACAGTTAAGCCAGGAGGG - Intronic
1168827091 20:821422-821444 AAATAACAGTTACCCCAACCTGG - Intergenic
1168986459 20:2053165-2053187 AAAGAACAGTCACCTCCAGCAGG + Intergenic
1169617422 20:7464544-7464566 AAAGCATCGTTACCAGAAGCTGG - Intergenic
1172596286 20:36153408-36153430 GAAGCACAGAGGCCCCAAGCTGG - Intronic
1174560655 20:51428551-51428573 AAAGCACAGATGCCCCATGAGGG + Intronic
1178365835 21:31988072-31988094 ACTGCACGGTTACCCCAAGAGGG - Intronic
1182132924 22:27871655-27871677 AAAGCAAATTTACATCAAGCAGG + Intronic
949240041 3:1859927-1859949 AAAGCACAGTTTTCCCTGGCTGG + Intergenic
951208165 3:19946605-19946627 AAATCGCATTTACCCCAAGGAGG - Intronic
952974808 3:38684715-38684737 AAAGCACTGTTACCAAAAGGAGG - Intergenic
953650528 3:44798915-44798937 AAAGCACAGATAGGACAAGCTGG - Intronic
955521638 3:59780864-59780886 AAAACACAGATACCTCAAGATGG + Intronic
955622273 3:60877431-60877453 AAAGCACTGTTTCCCCAGGAGGG - Intronic
957916992 3:86698191-86698213 AAAGAACAGTTACCAGAGGCTGG + Intergenic
958577121 3:95965278-95965300 AAAGCAGTGTTTCCCCAAGCTGG + Intergenic
959605859 3:108241498-108241520 AAAGCAATGTTCCCCCAAGCTGG - Intergenic
959606943 3:108251122-108251144 AAAGCAGTGTTTCCCCAAGCTGG - Intergenic
961398083 3:126611714-126611736 AGAACACAGCAACCCCAAGCTGG - Intronic
963532631 3:146489958-146489980 AAGGCACATTTACCCCATTCCGG + Intronic
965946871 3:174253570-174253592 AAAGGACAGTGACTTCAAGCAGG + Intronic
970952814 4:21776121-21776143 AAAGCACAGTTTCCCCAGCTGGG + Intronic
971274358 4:25181980-25182002 AAAGCACAGTTAGCAGAAGTAGG + Intronic
976151420 4:82096343-82096365 GAAGCACAGTTACCAGAGGCTGG + Intergenic
977125127 4:93155795-93155817 AAATGACAGTTACCCAATGCTGG + Intronic
978206079 4:106082912-106082934 AAAGCACAGTTTCCCCTGGCTGG - Intronic
978360512 4:107926668-107926690 CAAGCACAGTTACCTAAACCAGG + Intergenic
979978419 4:127224977-127224999 AAAGCACAGTTTCCCCAGCTGGG + Intergenic
981219710 4:142217277-142217299 AAAGCACATTTGCCCCATGTTGG - Intronic
983204801 4:164901318-164901340 AAATTACAGTCACACCAAGCAGG + Intergenic
984365748 4:178798124-178798146 AAAGCACAGTTCCCCAGAGATGG + Intergenic
985874991 5:2587545-2587567 AAAGCAGAGTTTTCCCCAGCTGG + Intergenic
988611852 5:32734403-32734425 ATGGCACAGTTACCCCAACATGG + Intronic
990919978 5:60952685-60952707 AAATGTCAGTTAGCCCAAGCTGG + Intronic
993461883 5:88192196-88192218 AAAGAACAGTAACCACATGCAGG + Intronic
999550671 5:152683853-152683875 AAAGTACATTTCCCCAAAGCAGG + Intergenic
1000921530 5:167144098-167144120 AAAGCTTAGTTTCCCCAAACGGG + Intergenic
1001788754 5:174436761-174436783 AAAGCACAGTTTCCCCAGCTGGG - Intergenic
1003802884 6:9691224-9691246 CATGCTTAGTTACCCCAAGCAGG - Intronic
1006839005 6:37016091-37016113 AAAGCACAGAAAGGCCAAGCTGG - Intronic
1006840142 6:37023154-37023176 AGAGGACAGTTAGCCGAAGCGGG - Intronic
1008002706 6:46377178-46377200 AAAACACAGTCTCCCCCAGCTGG + Intronic
1008487635 6:52052997-52053019 AAAAAACAGTAACCCCTAGCAGG + Intronic
1008895921 6:56555081-56555103 AAATCTCAGGTACCCCAAACTGG - Intronic
1011049461 6:83128123-83128145 AAAGCCCTGTTGCCCAAAGCTGG - Intronic
1011099032 6:83701370-83701392 AAAGCAAAACTACACCAAGCAGG + Intronic
1011612228 6:89163747-89163769 AAAACAAAGATACCTCAAGCAGG - Exonic
1011923925 6:92618109-92618131 AAAGCAAAGTTGCCCTAGGCTGG + Intergenic
1013007792 6:106090181-106090203 AAACCACAGTGACACCAAGAGGG - Intronic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1020633866 7:10672567-10672589 AATGCACAGTCACCCCAACTGGG + Intergenic
1024770138 7:52712939-52712961 CAAGCACAGATAAACCAAGCTGG + Intergenic
1025113491 7:56238658-56238680 AAAGCGCAGTTACACCTTGCAGG - Intergenic
1025955785 7:66181928-66181950 AAAGCACACTTAGCCAAGGCTGG - Intergenic
1028442449 7:90879919-90879941 AAAGCACAGTTTCCCCAGCTGGG - Intronic
1029957601 7:104656151-104656173 AAAGCACATTTATCCCATTCAGG - Intronic
1032699821 7:134369680-134369702 AAAGCCCAGCTTCCCCAGGCAGG - Intergenic
1034217604 7:149420474-149420496 GCACCACAGTTACCCTAAGCTGG + Intergenic
1034280479 7:149850487-149850509 AAAGCACAGTTACCCCAAGCAGG - Intronic
1036031283 8:4976839-4976861 TAAGCACAGTTGCCCCAAAGTGG - Intronic
1037978313 8:23230310-23230332 AAAGCAGAGTTTCCCCAACTAGG - Intergenic
1038012707 8:23487456-23487478 AAAGCACAGGGACACCACGCTGG - Intergenic
1038156049 8:24991637-24991659 AAAGCAGTGTCTCCCCAAGCAGG + Intergenic
1038240048 8:25799987-25800009 TTAGCACAGTATCCCCAAGCGGG - Intergenic
1038435748 8:27534858-27534880 AAAGCAGAGTTACCCCTTGGTGG + Intronic
1043436343 8:80239522-80239544 AAGGCACATTTACCCCACACAGG + Intergenic
1044779722 8:95731773-95731795 AAAGCAAAGTAACCCCAAGCAGG + Intergenic
1044794863 8:95886503-95886525 AAAGAAAAGTTGCCCCAAGACGG + Intergenic
1049113568 8:140665932-140665954 AAAGCACAGTTAATCCATTCTGG - Intronic
1052225360 9:26078306-26078328 AAAGCACAGTTTCCCCAGCTGGG + Intergenic
1054987779 9:71282458-71282480 AAGGCTCACTCACCCCAAGCAGG + Intronic
1055787264 9:79884239-79884261 AAAGCAGAGTTTGCCCAAGGAGG + Intergenic
1060280825 9:122214324-122214346 ACAGGACAGTCAACCCAAGCCGG - Exonic
1187407353 X:19015846-19015868 AAAGCACCTTTACCCCAACTTGG - Intronic
1189344375 X:40229486-40229508 AAAGCTCAGTGACCACAACCTGG - Intergenic
1193768609 X:85561599-85561621 GAAGCACAGTTTCCCCAGGTGGG + Intergenic
1195020002 X:100817877-100817899 AAAGCAGAGTTCTCCCCAGCTGG + Intergenic
1197602225 X:128543801-128543823 AAAGCACAGTTTCCCCGACTGGG + Intergenic
1201721944 Y:17108741-17108763 ATAGTCCAGTTTCCCCAAGCAGG - Intergenic
1202075343 Y:21031882-21031904 AAAGCACAGTTCCCCCAGCTGGG + Intergenic