ID: 1034280526

View in Genome Browser
Species Human (GRCh38)
Location 7:149850808-149850830
Sequence CAGGTGGATCAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 666
Summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 606}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034280520_1034280526 16 Left 1034280520 7:149850769-149850791 CCTTTATAGAGTAGGAAATGTTT 0: 1
1: 0
2: 0
3: 33
4: 282
Right 1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG 0: 1
1: 0
2: 6
3: 53
4: 606

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034280526 Original CRISPR CAGGTGGATCAGAAGGAGGA AGG Intronic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
901195715 1:7438757-7438779 CTGGTGGAGCAGAAAGAGCATGG + Intronic
901249882 1:7770125-7770147 CAGATGGATTAGATGGAAGAGGG - Intergenic
901461623 1:9395380-9395402 CAGGAGGATCAGAAAGAGAGAGG - Intergenic
901681534 1:10915733-10915755 CAGGTGGGTCAGAAGCAGGAGGG + Intergenic
901972341 1:12918033-12918055 CAGCTGTTTCAGGAGGAGGAGGG + Intronic
902012838 1:13283729-13283751 CAGCTGTTTCAGGAGGAGGAGGG - Intronic
902196662 1:14803460-14803482 CATCAGGGTCAGAAGGAGGATGG - Intronic
902396986 1:16137789-16137811 CAGGTGGGGCTTAAGGAGGACGG - Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903770518 1:25760911-25760933 CAGCTGGAGCAGAAAGAGGCTGG - Intronic
904314771 1:29653123-29653145 CAGGTGGAAAAGGTGGAGGAGGG - Intergenic
904855066 1:33491564-33491586 GAGATGGATGAGCAGGAGGAAGG + Exonic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905310688 1:37046903-37046925 GTGGGGGGTCAGAAGGAGGAGGG + Intergenic
905541850 1:38766184-38766206 CTGCTGGAACAGCAGGAGGAAGG + Intergenic
906192134 1:43905352-43905374 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192313 1:43906003-43906025 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906376535 1:45301157-45301179 CAGGTGGTACAGAAGGTGGTGGG + Intronic
906510071 1:46405742-46405764 CAGATGCCGCAGAAGGAGGAGGG - Exonic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
909694421 1:78450056-78450078 CAGGTGCAACAGAAGCAGCATGG - Intronic
909758592 1:79260596-79260618 GAGGTAGACCAGAATGAGGAAGG + Intergenic
910813555 1:91263943-91263965 TAGGTAAATCATAAGGAGGAAGG - Intronic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911182727 1:94875502-94875524 CAGGAGGCTCAGAAGGGGCAAGG - Intronic
912574699 1:110657272-110657294 CAGGTGGATCACAAGGTGTCAGG - Intergenic
912642207 1:111358052-111358074 AAGGTGGCTGACAAGGAGGAAGG - Intergenic
912795059 1:112688370-112688392 CAGGTGGAACCCAAGCAGGAAGG - Intronic
914257096 1:145969487-145969509 CAGGTGGATCACAAGGTCAAGGG - Intronic
914390271 1:147215001-147215023 CAGGATGATCAGAAGGCAGAAGG + Intronic
914806583 1:150996442-150996464 GAGGTGGGTCAGAGGCAGGAAGG - Intronic
914847900 1:151292919-151292941 CTGGTGGAGCAGATGGTGGATGG - Exonic
915057636 1:153149981-153150003 CAGGTGGACAAGGAGGAGGCAGG + Exonic
915287015 1:154859532-154859554 CAGATGGACCAGAATGAGCAAGG + Intronic
915347211 1:155203593-155203615 CTGGTTGGTGAGAAGGAGGAAGG + Intronic
915929215 1:160048378-160048400 CAGTTGGCCCAGAAGGAGCAGGG - Intronic
917667117 1:177235849-177235871 CAGGTGGATGGGAAAAAGGAAGG + Intronic
917882716 1:179354328-179354350 TAAGGGGATCAGAAGTAGGAAGG + Exonic
918547012 1:185696517-185696539 TAGCTGCAGCAGAAGGAGGACGG - Intergenic
919159329 1:193807898-193807920 TATGTGGAGCAGAAGGAAGATGG + Intergenic
919318912 1:196008901-196008923 CAGGTGGATCACAAGGTCAAGGG - Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
920095529 1:203484056-203484078 CAGGTGGAGCACAAGCAGGTTGG - Exonic
920377812 1:205518793-205518815 TGGGTGGCACAGAAGGAGGAAGG - Intronic
920860126 1:209699106-209699128 CAGGAGGAAGGGAAGGAGGAGGG + Intronic
920872863 1:209808401-209808423 CAGGTGTATGAGAGGGATGAGGG + Intergenic
920987053 1:210900834-210900856 TAGGTTGAGGAGAAGGAGGATGG - Intronic
921013319 1:211163258-211163280 AAGATGGATCATTAGGAGGAGGG - Intergenic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921569427 1:216760702-216760724 CAGAGGGATCAGAAGAAGGAGGG + Intronic
921657836 1:217761979-217762001 GAGGTGGAACAGCATGAGGACGG - Intronic
921842768 1:219846282-219846304 CAGGAGGATTAGGAGGAAGATGG + Intronic
922161552 1:223082118-223082140 CAGGCGGATTAGCAGGAGGAAGG + Intergenic
922658515 1:227407645-227407667 GAGGAGGAAAAGAAGGAGGAGGG + Intergenic
922822322 1:228493140-228493162 CAGGAGGCTGAGAAGGAGGAGGG + Exonic
923000397 1:230002283-230002305 CAGGTGCAGCAGGAGGAGCAAGG + Intergenic
923170881 1:231416076-231416098 CGGGTGGATCACAAGGTCGAGGG - Intronic
923774445 1:236965960-236965982 CAGGTGGATGAGAGGGTGGGAGG + Intergenic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
924437475 1:244054946-244054968 CAGGTGGATCTGCAGGATGTGGG - Exonic
924658870 1:245997962-245997984 CAGTGGGATCAGAAAGAGGTTGG - Intronic
924790058 1:247237747-247237769 GATGTGGAAAAGAAGGAGGAAGG + Intergenic
1062999871 10:1906324-1906346 CATGTGGCACAGAAGGAAGATGG + Intergenic
1062999885 10:1906425-1906447 CATGTGGCACAGAAGGAAGATGG + Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1065129011 10:22601822-22601844 CAGGTGGATAGAAAGGAAGATGG - Intronic
1065414384 10:25468541-25468563 CAGGTAGAGGAGAAGGAAGAAGG - Intronic
1065571147 10:27072119-27072141 CAGGCGGATCAGGAGGGGCATGG + Intronic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1065821568 10:29530364-29530386 CAGGTGGGCCAGAGGCAGGAGGG + Intronic
1065837221 10:29669573-29669595 GAGGTGGATGAGAAGAAGCATGG + Intronic
1065841253 10:29703368-29703390 CAGGTGGTGGAGAAGGAGAAAGG - Intronic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1066340371 10:34526696-34526718 CTGGTGGCACAGCAGGAGGAGGG - Intronic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1067799600 10:49349923-49349945 GAGGTGGAGCAGAAAGAGGAAGG + Intergenic
1068895719 10:62198201-62198223 GAAGTTTATCAGAAGGAGGAAGG + Exonic
1068900213 10:62259879-62259901 CAGGTAGGTGAGCAGGAGGAAGG - Intronic
1069668746 10:70183624-70183646 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1070332592 10:75429083-75429105 TAGAAGGAACAGAAGGAGGAAGG - Intergenic
1070385633 10:75921836-75921858 AGGAAGGATCAGAAGGAGGAAGG - Intronic
1070662189 10:78315001-78315023 CAGGTTGAACAGTAGAAGGAAGG - Intergenic
1070806003 10:79271075-79271097 TAGGCGGCTCAGAAGGAGGCAGG + Intronic
1071961378 10:90811403-90811425 CAGGTGGATCAGAGAGATGAAGG - Intronic
1071971897 10:90916061-90916083 CGGGTGGGGGAGAAGGAGGAGGG + Intronic
1072608348 10:97001420-97001442 CAGGAGGAAGAGGAGGAGGAGGG + Intronic
1072747982 10:97955181-97955203 CTGGTGAATCTGAAGGAGGGTGG - Intronic
1072791503 10:98321432-98321454 GAGGTGGTTAAGATGGAGGAGGG - Intergenic
1073054568 10:100690851-100690873 CAGGAGGATGTGAAGGAGGAAGG + Intergenic
1073184773 10:101609274-101609296 TAAGGGGATCAGAAGGAGAAGGG + Intronic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073381624 10:103082222-103082244 CATGTGGATCAGATGCCGGAAGG - Exonic
1073942919 10:108718562-108718584 CAGTTGGAGCAGGTGGAGGAGGG + Intergenic
1075148045 10:119899998-119900020 CAGGAGGAGAAGCAGGAGGAAGG - Intronic
1075293730 10:121253851-121253873 CAGGTGGATCACAAGGTCAAGGG + Intergenic
1075779459 10:125007517-125007539 CAGGTAGATCTCAGGGAGGATGG + Intronic
1075823138 10:125331204-125331226 CAGGTGGTTCAGCGGCAGGAAGG - Intergenic
1076744809 10:132507533-132507555 CAGGTGGGTCAGCAGGTGGGAGG - Intergenic
1077411809 11:2407177-2407199 CAGGTGGCTGAGCAGGATGAAGG + Exonic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1077900080 11:6480947-6480969 GAGGTGTATGAGACGGAGGAGGG - Intronic
1078153394 11:8777838-8777860 CAGGTAGATTACAGGGAGGATGG - Intronic
1078308012 11:10210377-10210399 GAGGAGGAAGAGAAGGAGGAAGG + Intronic
1078430948 11:11288057-11288079 CAGGTGGATCAGAAGGAAAGAGG - Intronic
1078469210 11:11573593-11573615 CAGCTGGATCAGCAAGAGGCTGG + Intronic
1078543760 11:12231449-12231471 CAGGTGGCTCAGGAAGAGGAGGG - Intronic
1078545492 11:12244043-12244065 CAGCTGGATCAGGAGACGGAAGG - Exonic
1078707411 11:13758543-13758565 CAGCTAGATCAGAGGGAAGATGG - Intergenic
1080555267 11:33410517-33410539 CAGGTGGTTCAGAACCAAGATGG - Intergenic
1081093281 11:38899860-38899882 GAGGTGGAGGAGGAGGAGGAAGG + Intergenic
1082084786 11:48041017-48041039 CAGGTGGAGGAGGAGCAGGAGGG - Intronic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082892430 11:58154195-58154217 AAGGGGGAGGAGAAGGAGGAAGG + Intronic
1083359274 11:62094588-62094610 GAGGTGGAGGAGAAGGAGGGAGG + Intergenic
1083360170 11:62101428-62101450 GAGGTGGAGGAGAAGGAGGGAGG - Intergenic
1083506686 11:63164302-63164324 CAGGTGGTTCAGAAGGTACATGG + Intronic
1083720121 11:64599792-64599814 CAGGTGGCTCAGCAGCAGCAGGG - Exonic
1084613022 11:70216050-70216072 CAGCTGGATCAGAGAGATGAAGG + Intergenic
1084785672 11:71440450-71440472 CAGGTGGATGAGATGGATGATGG + Intronic
1085324888 11:75598956-75598978 CAGGTGGAGAAGCAGGAGAAGGG + Intronic
1085643918 11:78210338-78210360 CAGGCGGAGCAGCAGGGGGATGG - Exonic
1085759978 11:79233445-79233467 CAGGGGGACGGGAAGGAGGAGGG + Intronic
1085777095 11:79376796-79376818 CATGTGGAGAGGAAGGAGGAGGG - Intronic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086550992 11:88051423-88051445 TAGGTGGAGCACAAGCAGGACGG + Intergenic
1087203721 11:95372322-95372344 CAGGAGGATGTGAAGGAGGAGGG + Intergenic
1087307073 11:96500597-96500619 CAGCTGAATGAGAAGGAGGAGGG - Intronic
1087949636 11:104204871-104204893 AAGGAGGATCAGAAGGGAGAAGG - Intergenic
1088322366 11:108567381-108567403 CAGGTGGATAAGTGGGAGGTAGG - Intronic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088972004 11:114781761-114781783 CTGGTGGAGGTGAAGGAGGAAGG - Intergenic
1090017317 11:123097749-123097771 CAGGAGGACAAGAAGGAGGAGGG + Intronic
1090867744 11:130716924-130716946 CAGGTGGAGGAGAAGGTGAAGGG - Exonic
1091284779 11:134402521-134402543 CAGGTGTAACAGAGGGAGGTGGG - Intronic
1091670676 12:2449989-2450011 CAGGTGGATGAGAAGGAAACAGG + Intronic
1091687355 12:2572826-2572848 GAGGAGGAAGAGAAGGAGGAGGG - Intronic
1093654151 12:21675702-21675724 TAGGAGGAAGAGAAGGAGGAGGG - Intronic
1094125519 12:27018878-27018900 CAGGAGGGAGAGAAGGAGGAAGG + Intergenic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1095048524 12:37535738-37535760 CAGGTGCACCAGAAGGTGAAGGG - Intergenic
1095214987 12:39537920-39537942 CAGATGAATCAGAATGAGGCAGG + Intergenic
1096178155 12:49536678-49536700 GAGGTGGAGGAGGAGGAGGAGGG - Intergenic
1096921250 12:55088044-55088066 AAGCTGGAGAAGAAGGAGGATGG + Intergenic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1098701321 12:73631222-73631244 GAGGTGGAAGAGAAGGAGGAGGG + Intergenic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1100335632 12:93626466-93626488 CAGGTGGATGAGGTGGAGAAGGG - Intergenic
1100487593 12:95045277-95045299 CAGCTGGGTCAGAATGTGGAGGG + Intronic
1102113991 12:110387123-110387145 CAGGAGGCTGAGCAGGAGGATGG + Intronic
1102132121 12:110540198-110540220 CAAGTGGCTGAGAAGGAGGGAGG + Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1104497027 12:129250489-129250511 CAGGAGGATCAGAGTTAGGAAGG - Intronic
1104754797 12:131262278-131262300 CAGGTGGATCGGAGACAGGATGG + Intergenic
1104809045 12:131609505-131609527 CTAGAGGCTCAGAAGGAGGAGGG - Intergenic
1106253860 13:28004155-28004177 CAGATGTATCAGAATGTGGATGG - Exonic
1106926098 13:34614787-34614809 AAGGTGGGGCAGAAGAAGGAAGG - Intergenic
1107279030 13:38712119-38712141 CAGGTGGATCACGAGGAACATGG - Intronic
1107509051 13:41062880-41062902 CAGGTTGATGAAAAGGAAGAAGG - Intronic
1108015485 13:46071087-46071109 AAGGTGGCTCAGAAAAAGGATGG + Intronic
1108298003 13:49044442-49044464 CAGGTGGATCACAAGGTGAGGGG + Intronic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1110678013 13:78273362-78273384 CTGGTAGTTCAGAAAGAGGATGG - Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113414465 13:110117562-110117584 CAGGAGGTTCAGAAGGCGGGAGG + Intergenic
1113433318 13:110268834-110268856 CAGGTGAGACACAAGGAGGAGGG + Intronic
1113788601 13:113015785-113015807 CAAGTGGCCCAGGAGGAGGAAGG + Intronic
1114228577 14:20760491-20760513 CAGGTGGTTTAGAACTAGGATGG - Intergenic
1114268142 14:21084750-21084772 CAGATAGATCTGAAGGAGCAGGG + Exonic
1114365784 14:22025981-22026003 CAGGTGGATCAGGAGGGGCATGG + Intergenic
1114444039 14:22774320-22774342 CAGGTGGAGCAGAGGTAGGATGG + Intronic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1115113208 14:29849219-29849241 CAGGAGGAAAAGAAAGAGGAGGG - Intronic
1115662140 14:35507108-35507130 CAGGTCTATCAGACAGAGGAGGG + Intergenic
1116070576 14:40039343-40039365 CAGGTGGACCTGTAGGAGGGAGG + Intergenic
1116755812 14:48946657-48946679 CAGGAGGATGGGCAGGAGGAGGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117541037 14:56746732-56746754 GAGGTGGATGATGAGGAGGAGGG + Intergenic
1118660633 14:68005920-68005942 CAGGTGGAAGAGAGAGAGGAGGG + Intronic
1119750656 14:77075209-77075231 CATGTGGATCAGATGGACCATGG + Intergenic
1119892671 14:78194647-78194669 CGGGTGGGTTAGAAGGAGAAGGG + Intergenic
1120388129 14:83871237-83871259 AAGGGGGAGAAGAAGGAGGAAGG + Intergenic
1120396331 14:83971439-83971461 TAGGTTGAAAAGAAGGAGGAAGG + Intergenic
1120880811 14:89413979-89414001 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1120899888 14:89566789-89566811 GAGGTGGAGAAGAAGGAAGATGG - Intronic
1121638737 14:95471359-95471381 CATGAGGATAAGAAGGACGAAGG - Intronic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1121978124 14:98425094-98425116 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1122642148 14:103166206-103166228 CGGGTGGATCGGGAGGAGCAGGG - Intergenic
1124593785 15:31077344-31077366 CACCTGGAGCAGAAGGAGGTGGG + Intronic
1127029567 15:54846991-54847013 CAGGTGGATCAGAAGGTCAGGGG - Intergenic
1128405716 15:67335736-67335758 CAGGTGAGTCAGAAGGGGAAAGG - Intronic
1128733598 15:70036957-70036979 CAGGAGGGTCAGCAGGTGGAGGG - Intergenic
1128762374 15:70226113-70226135 TAGGTAGACAAGAAGGAGGAGGG + Intergenic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1129410950 15:75349962-75349984 CAGGAGGCTAAGAAGGTGGAGGG + Intronic
1130075138 15:80682171-80682193 GAAGTGGATCACATGGAGGAAGG + Intronic
1130138231 15:81199382-81199404 CAGGTGGATGTGAAGGACGTTGG + Intronic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131081709 15:89542091-89542113 CAGGTGGTTAAGAAGGAGATTGG + Intergenic
1131278622 15:91003153-91003175 CAGGTGCATGAGAAAGAGGCCGG + Intronic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1132147694 15:99438187-99438209 CATGTGGACCAGCAGGAGGGCGG - Intergenic
1132242667 15:100270912-100270934 CAGATGGCTGAGAGGGAGGAGGG - Intronic
1132808268 16:1785774-1785796 GAGGCGGATCAGAAGGGGGCAGG + Intronic
1132885841 16:2181624-2181646 CAGGTGGACCAGGAGGCGGAGGG + Intronic
1133041864 16:3065180-3065202 CTTCTGGATCAGAAGGAGGCAGG - Intergenic
1133655828 16:7862691-7862713 CATGTGGCTGAGTAGGAGGATGG - Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1135970065 16:27066035-27066057 AAGTTGGCTCAGAAGGAGGCAGG - Intergenic
1136399036 16:30007847-30007869 CAGGTGGCTCAGAAGTGGCAGGG - Intronic
1138126174 16:54440503-54440525 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1139210102 16:65068363-65068385 CAGGTGGGTGAGAAGAATGAAGG + Intronic
1139436998 16:66942076-66942098 CAGGTGGATCAGGAAGAGGCAGG - Intronic
1139679569 16:68550800-68550822 CAGCTGGATTTGAAGGATGAAGG + Intronic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1140903546 16:79391914-79391936 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1141263754 16:82476907-82476929 CACGTGGATGAGAAAGAGAAGGG - Intergenic
1141302691 16:82832446-82832468 AAGGAGGATGAGAAGGAGGAAGG - Intronic
1141810449 16:86372194-86372216 CAGCTGGTGCAGAAGGAGGTGGG - Intergenic
1141819290 16:86434022-86434044 CAGGTGGAGAGGATGGAGGATGG - Intergenic
1141823926 16:86465995-86466017 TAGGTGGATAAAAAGAAGGAGGG - Intergenic
1141980720 16:87548261-87548283 CGTGTGGATCAGAGGGAGGAAGG + Intergenic
1142128594 16:88422161-88422183 CAGGTGGATGGGCAGGAGGATGG + Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142611691 17:1111930-1111952 AAGCTGTTTCAGAAGGAGGAAGG - Intronic
1143166247 17:4898628-4898650 CAGATTGATCAGCAGGGGGAAGG + Exonic
1143287325 17:5800063-5800085 AAGGTGGAGGAGAAGGAGGAAGG - Intronic
1143374468 17:6459074-6459096 CAGGTGAATGAGAAGGTGGAAGG - Intronic
1143483413 17:7239500-7239522 GAGGTGGAGGAGGAGGAGGAGGG - Exonic
1143921153 17:10331998-10332020 CAGGTGGACCAAAAGGAGAAGGG + Intronic
1144131458 17:12250971-12250993 CAGGTGGGTCAGGAGGCAGAGGG + Intergenic
1144201306 17:12944714-12944736 CAGGTGGATCACAAGGTCAAGGG - Intronic
1144504843 17:15821266-15821288 CAGGTGGAGAGGAAGGAGGGAGG - Intergenic
1144573181 17:16413328-16413350 CAGGTGGAACAGAAGAGGCATGG + Intergenic
1144636143 17:16910493-16910515 CAGGTGGAGAGGAAGGAGGGAGG - Intergenic
1144797610 17:17903007-17903029 CAGGTGGATGAAGGGGAGGAAGG - Intronic
1145169016 17:20639149-20639171 CAGGTGGAGAGGAAGGAGGGAGG - Intergenic
1145203579 17:20968588-20968610 CAGGTGGAGAGGAAGGAGGGAGG - Intergenic
1145411788 17:22671918-22671940 CAGGTGCACCAGAAGGTGAAGGG - Intergenic
1146000333 17:29126833-29126855 CAGGAGGCTGAGAAGCAGGAGGG - Intronic
1146930197 17:36771618-36771640 CAGGTGGATGAAAATGAGGCTGG + Intergenic
1147056401 17:37838602-37838624 AATGTGGATCAGAAGGAAGCGGG - Intergenic
1147308374 17:39579070-39579092 CAGATGGGTGAGGAGGAGGAAGG - Intergenic
1147522832 17:41190625-41190647 CAAGTGGATTAGCAGCAGGAAGG - Exonic
1148138554 17:45311734-45311756 CAGGTGGCTGAAAAGGAGGCAGG + Intronic
1148184775 17:45634182-45634204 CAGCTGGAACAGAATGAGCAGGG + Intergenic
1148384993 17:47228009-47228031 TAAGTGGGCCAGAAGGAGGAGGG + Intergenic
1148851369 17:50557049-50557071 GAGGTGGAAGAGAGGGAGGATGG + Intergenic
1150006680 17:61474119-61474141 GGGGAGGATCAGAAGGATGATGG + Intronic
1150080520 17:62234425-62234447 TAGGTGGAGAAGGAGGAGGATGG - Intergenic
1150222800 17:63506745-63506767 CAGTTGGACCAGGAGGTGGATGG + Intronic
1150411105 17:64941183-64941205 TAGGTGGATCAGTAGGTAGATGG + Intergenic
1150507542 17:65714990-65715012 CAGGTGGAGCAGAAGGAGCAAGG + Intronic
1150628600 17:66859822-66859844 AAGGGGGAGGAGAAGGAGGAGGG - Intronic
1150628620 17:66859880-66859902 GAGGTGGAGAAGAAGGAAGAAGG - Intronic
1151267489 17:72967995-72968017 GAGGTGGAGAAGAAGGAGGCTGG - Intronic
1151287859 17:73126337-73126359 CAGGAGGATCAAAAGGATTATGG - Intergenic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1153498938 18:5728826-5728848 CAGGAGGTACAGAAGGAGGTCGG - Intergenic
1153732223 18:8025934-8025956 CAGGGAGAGCAGAAGGAGAAAGG + Intronic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156525584 18:37764785-37764807 GAACTGGAGCAGAAGGAGGAGGG - Intergenic
1157198816 18:45641903-45641925 CAGGTGTATGAGAAGGACTATGG - Intronic
1157276069 18:46311896-46311918 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1157943965 18:51958162-51958184 CAGGTGGTTTAGAACTAGGAAGG - Intergenic
1158525505 18:58209349-58209371 GAGGTGGAGGAGGAGGAGGAGGG - Intronic
1159495264 18:69194532-69194554 CAGATGGATTAGAAGTGGGAAGG - Intergenic
1160500506 18:79399452-79399474 CATGTGGAATAGTAGGAGGATGG - Intronic
1160893817 19:1393526-1393548 CAGAGGGATCAGAGGGAGCAGGG + Intronic
1161086868 19:2339493-2339515 CAGGCGGCTCAGCAGGAAGAGGG - Intronic
1161415740 19:4145465-4145487 GAGGTGGGGAAGAAGGAGGAGGG + Intergenic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1161981703 19:7633426-7633448 CAGGAGGAGAAGACGGAGGAAGG - Exonic
1162053089 19:8046797-8046819 GAGGGGGAGGAGAAGGAGGAGGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162180891 19:8867927-8867949 CAGGTGAATGGGCAGGAGGATGG + Intronic
1162346214 19:10119513-10119535 CAGGCGGGTCCCAAGGAGGATGG + Intronic
1162936343 19:13983496-13983518 CAGGTGGTTCAGCAGGTGCAGGG - Exonic
1163197419 19:15732807-15732829 GAGGTGGACCAAGAGGAGGAGGG + Intergenic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1164718701 19:30415250-30415272 CAGGAGGAGGAGAAGGGGGAGGG - Intronic
1165741992 19:38210233-38210255 CGGGAGGAGGAGAAGGAGGACGG - Intergenic
1166103141 19:40583211-40583233 CAGATGCATCAAAGGGAGGAAGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166531532 19:43546246-43546268 CTCCTGGATCAGAGGGAGGAGGG - Intronic
1166552482 19:43675597-43675619 CAGGTGAGTCACGAGGAGGAAGG - Intergenic
1166679689 19:44759028-44759050 CTGGGGGGTCTGAAGGAGGAGGG - Intronic
1166802472 19:45467097-45467119 CGGGTGGATTAAAAGGTGGAAGG + Intronic
1167104573 19:47422389-47422411 AAGGAGGATGAGGAGGAGGACGG - Intergenic
1167162292 19:47776101-47776123 CAGGGGGATCAGACTGAGGTGGG + Intergenic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167260318 19:48454425-48454447 CAGATGGATCAGAGGCTGGATGG - Exonic
1167323910 19:48812588-48812610 CATCTGGATCAGAGGGAGGAGGG - Intergenic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167668946 19:50838837-50838859 CTGGGGGATCTGAGGGAGGAGGG + Intergenic
1168057337 19:53870455-53870477 CTCGTGGGTCTGAAGGAGGAAGG + Intronic
1168510190 19:56967471-56967493 GAGGAAGATCAGTAGGAGGAAGG - Intergenic
925005605 2:440954-440976 CAGGTGGAGCAGAGGGTGGGGGG + Intergenic
925132452 2:1503469-1503491 CAGGGGGAGCAGGAGCAGGAGGG + Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
926109080 2:10170682-10170704 CAGGTTGGAGAGAAGGAGGAGGG - Intronic
926126868 2:10277426-10277448 GTGGTGGACCAGATGGAGGACGG + Intergenic
926231583 2:11008234-11008256 GAGCTGCAGCAGAAGGAGGAAGG - Intergenic
926259544 2:11245754-11245776 CAGTGGGATCAGAATGAGGTTGG - Intronic
926753639 2:16219281-16219303 GGGGAGGAACAGAAGGAGGAGGG - Intergenic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
928262713 2:29782253-29782275 GAGGTGGATCAGAGAGAGGTAGG + Intronic
928379715 2:30807314-30807336 CAGGTGTGTCTGATGGAGGAGGG + Exonic
929073470 2:38057795-38057817 TGGCTGGATCAGAAGGAAGAGGG - Intronic
930294040 2:49530929-49530951 CAGAAGGCTCAGAAGAAGGAGGG - Intergenic
930820524 2:55642065-55642087 CAGGTGGATCAGGAAGTGGGGGG - Intronic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931701696 2:64914272-64914294 CAGGTGGGAGAGAAGGAAGAAGG - Intergenic
932296108 2:70624610-70624632 CAGGTGGATCAGAGAGATGAAGG - Intronic
932299703 2:70657631-70657653 AACGTGAATCAGAAGGAGGATGG - Exonic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
932494718 2:72140652-72140674 GAGGTGCCTCAGCAGGAGGACGG - Intronic
932668830 2:73719346-73719368 CAGGTGGACCTGATGGTGGATGG + Intergenic
933196043 2:79391270-79391292 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
933264575 2:80168508-80168530 GAAGGTGATCAGAAGGAGGAGGG - Intronic
933718179 2:85377386-85377408 CAGGTAGAGCAGATGCAGGAGGG - Exonic
933841856 2:86293304-86293326 CAGGTGTATCAGAACAAGAAAGG + Intronic
933946395 2:87289592-87289614 CACGTGGAACAGCAGGTGGAGGG - Intergenic
934473477 2:94576891-94576913 CAGGAGCATCAGAGAGAGGAGGG + Intergenic
934928621 2:98400731-98400753 CAGGAAGATCAGAGAGAGGAAGG + Intergenic
934991447 2:98924707-98924729 GAGGTGGAGGAGTAGGAGGAAGG - Intronic
935124041 2:100207402-100207424 CATGAGGGACAGAAGGAGGAAGG - Intergenic
936333800 2:111571949-111571971 CACGTGGAACAGCAGGTGGAGGG + Intergenic
936917869 2:117658685-117658707 CAGGTAGCCCAGATGGAGGAAGG + Intergenic
937067440 2:119028568-119028590 CAGGTAGATTAGAGAGAGGAAGG - Intergenic
937134771 2:119543240-119543262 CTGGTGGGTTAGAAGGAGGGTGG + Intergenic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
938161931 2:128993665-128993687 AAGGTGGATGAGGATGAGGAAGG + Intergenic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
940479210 2:154206565-154206587 CAGGTGGATCAGCTGAAGGCAGG + Intronic
941063827 2:160878450-160878472 CAGGAGGGTCAGAAGGAGATGGG - Intergenic
941684768 2:168437120-168437142 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
941693041 2:168521486-168521508 CAGGTGGAAGAAGAGGAGGAGGG + Intronic
941783844 2:169477719-169477741 CAGGTGGGGCAGAAGGATCAGGG + Intergenic
941873539 2:170410336-170410358 CAGGCGGATCACAAGGTGGGTGG + Intronic
942135486 2:172920874-172920896 CAGGTCTGTCAGAAAGAGGAAGG - Intronic
942430904 2:175910417-175910439 TAGATGGACCAGGAGGAGGAGGG - Intergenic
943433220 2:187830122-187830144 AAGGTGGGTCAGTAGGAGGTGGG + Intergenic
943731381 2:191306689-191306711 AAGGGGGATCAGAGGGAGAAAGG + Intronic
943811846 2:192196345-192196367 CGGGGGGAGAAGAAGGAGGAGGG - Intergenic
944229771 2:197380911-197380933 TAGGTGGGAGAGAAGGAGGACGG + Intergenic
945810904 2:214549126-214549148 CAGGTGGATCAGAGGAAGTGTGG - Intronic
946179629 2:217941775-217941797 CTGGTGGGTCAGCAGGAGGATGG - Intronic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946424509 2:219586018-219586040 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
948055076 2:235005051-235005073 CAGGGGGATCTGCAGGCGGATGG - Intronic
948088542 2:235270870-235270892 CAGTTGTATCAAAAGTAGGAAGG - Intergenic
948262243 2:236613018-236613040 CACATGGAGCAGAGGGAGGAGGG - Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
949006674 2:241653383-241653405 CAGGTGGAGCTGATGGAGGAGGG + Intronic
1169208383 20:3752532-3752554 CAGGAGGAGCCGCAGGAGGAAGG + Exonic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1169793678 20:9438617-9438639 CAGGTGGAGAAGAAGAAGGAGGG + Intronic
1170212104 20:13855825-13855847 CAGGTGGATCCAAAGGAGGCTGG + Intronic
1170647828 20:18212573-18212595 CAGGTGGAACAGAGAGAGAAAGG + Intergenic
1170690974 20:18614814-18614836 CAGGAGGAAGGGAAGGAGGAAGG - Intronic
1171543052 20:25979218-25979240 CAGGTGCACCAGAAGGTGGAGGG - Intergenic
1171846102 20:30275861-30275883 CAGGTGCACCAGAAGGTGAAGGG - Intergenic
1172726615 20:37048463-37048485 GTTGTGGATCAGAAGAAGGAAGG - Intronic
1173048760 20:39538503-39538525 CAGGTGCAAGAGAAAGAGGAAGG - Intergenic
1174118536 20:48244841-48244863 ATGGTGGATGAGAAGGGGGATGG - Intergenic
1174412207 20:50343565-50343587 CAGGAGGCTCTGAAGGAGGCAGG + Intergenic
1174631338 20:51960658-51960680 AAGGTGGAATAGAGGGAGGAGGG + Intergenic
1175203001 20:57290848-57290870 CAGGTGGAGCAGCAGCAGGCTGG - Intergenic
1175814892 20:61878209-61878231 CAGGGGGAACAGAAGGTGGGAGG - Intronic
1176047226 20:63099247-63099269 CAGGTGGGTCTGAGGGAGGAAGG - Intergenic
1176163866 20:63662815-63662837 CAAGTGGATCTGTGGGAGGAAGG - Exonic
1176720448 21:10388294-10388316 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1177291062 21:19111767-19111789 CAGGTGGATCACATGAAGTAGGG - Intergenic
1178285490 21:31322269-31322291 CAGGAGGAGAAGAAGGAGCAAGG - Intronic
1178348494 21:31852373-31852395 AAGGTGTATCAGATGGAGGGTGG - Intergenic
1178603453 21:34014924-34014946 CCAGTGGTTCAGAAGGAGGGAGG + Intergenic
1179904949 21:44418028-44418050 CAGGTGGCTGAGGAGGATGAAGG - Exonic
1180066264 21:45414060-45414082 GAGGAGGATCGGGAGGAGGAGGG + Intronic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180301652 22:11041143-11041165 CAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1180717599 22:17882353-17882375 GAGGTGGTTCAGAGGCAGGAGGG - Intronic
1181042637 22:20199502-20199524 CAGGTGGATGGGCAGGTGGATGG - Intergenic
1181410303 22:22713680-22713702 CAGGTGGGTCACATTGAGGAGGG - Intergenic
1181742942 22:24935874-24935896 CAGGTGGTTAAGTAGGAAGATGG - Intronic
1181781650 22:25198081-25198103 CAGCTGGGACAGAAGGAGGAAGG - Intergenic
1182096755 22:27630848-27630870 CAGGTGGCTTAGAGGGATGAAGG - Intergenic
1182796671 22:32995992-32996014 CAGCTGCACCAGAAGGAGGAGGG + Intronic
1182887328 22:33786523-33786545 GAGGTGCCTCAGAAGGAGGTTGG + Intronic
1182931456 22:34178253-34178275 GAGGGGGATAAGGAGGAGGAAGG - Intergenic
1183058607 22:35321845-35321867 CAGGTGGGGCACAGGGAGGATGG + Intronic
1183161248 22:36114788-36114810 CAGGTGCAGCAGAAGGGAGACGG - Intergenic
1183738333 22:39656236-39656258 CATGTGGGTTAAAAGGAGGATGG - Intronic
1184406705 22:44304628-44304650 CAGGAGGGCCAGAAGGAGGCTGG - Intronic
1184853164 22:47132337-47132359 AAGGTGGATCGGAAGGAAGCAGG - Intronic
1184859172 22:47163459-47163481 CAGGTGCATCTGAAGGTGGTAGG + Intronic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
1184900803 22:47445342-47445364 CAGGTGGACAGGCAGGAGGATGG - Intergenic
1185277714 22:49956950-49956972 CAGGTGGATCGGCAGGAGGGAGG + Intergenic
1185323100 22:50210848-50210870 CAGGTGGAGCTGGAGGAAGACGG + Exonic
949133936 3:539440-539462 CATGTTGATCAGAAGGAAAAAGG + Intergenic
949942011 3:9162535-9162557 CAAGTGGACCAGAAGGAGCAGGG - Intronic
950010151 3:9717308-9717330 CAGGTGGATGAGTAGGCTGATGG + Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950319973 3:12042569-12042591 CAAGTGGATCTAAAGAAGGAGGG + Intronic
950606898 3:14089751-14089773 GACGTGGAAGAGAAGGAGGATGG + Intergenic
952476685 3:33717947-33717969 CAGGTGCAGCAGAAGGACGTCGG - Intronic
953367186 3:42354835-42354857 GAGGTGGGAGAGAAGGAGGAGGG - Intergenic
953391222 3:42534989-42535011 CAGGGGGATCAGCAGGAGTGTGG - Exonic
953645480 3:44749893-44749915 CAGGAGGCTAAGCAGGAGGATGG - Exonic
954133102 3:48569968-48569990 GAGGAGGATCAGGGGGAGGAGGG + Intronic
955384933 3:58471810-58471832 CAGGTCCATCATCAGGAGGAGGG - Intergenic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955840773 3:63110445-63110467 GAGGAGGAAGAGAAGGAGGAGGG + Intergenic
956053906 3:65278272-65278294 CAGGAGGGTGAGAAGTAGGAAGG - Intergenic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
957335501 3:78822689-78822711 AAGTTGGACCAGAATGAGGAAGG - Intronic
959664135 3:108902688-108902710 CAGCTGGTCCAGGAGGAGGACGG - Intergenic
960062489 3:113338880-113338902 AAGGTGGATCCGGAGGAGCAAGG + Intronic
960139644 3:114139696-114139718 CCTGTGGATGAGAAGGGGGAAGG + Exonic
960936513 3:122907476-122907498 CAGCTGGCTCAGCAGGAGTAAGG - Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961413136 3:126737713-126737735 CAGGTGGAGAGGAGGGAGGAAGG + Intronic
961488243 3:127232510-127232532 CAGGGAGGTCAGCAGGAGGATGG - Intergenic
961633375 3:128317792-128317814 CAGCTGGAGCAGAAGGCTGAAGG - Intronic
961824776 3:129593259-129593281 CGGGTGGGGCAGAGGGAGGAGGG - Intronic
962920253 3:139943907-139943929 CAGGTTTATCAGAAGGGGTATGG - Intronic
963001739 3:140688027-140688049 CTGGTGGACCAGATCGAGGACGG + Exonic
965172184 3:165279927-165279949 GAGGTGAAGAAGAAGGAGGAGGG - Intergenic
966402543 3:179562687-179562709 CAGTGGGAGAAGAAGGAGGAAGG - Intergenic
966521915 3:180882423-180882445 GAGGAGGAGGAGAAGGAGGAAGG - Intronic
966905994 3:184526051-184526073 CAGGTGGAGCAAGAGGAGGGCGG + Intronic
966956497 3:184885822-184885844 CAGAGGGAGCAGAAGAAGGAGGG - Intronic
967056712 3:185835588-185835610 CAGGTGGATCACAAGGTCAAGGG + Intergenic
967066270 3:185919469-185919491 GAGGTGGAGGAGGAGGAGGATGG - Exonic
967131930 3:186478541-186478563 CAGGGGTTTCAGAAGGAGGTTGG - Intergenic
967826993 3:193884924-193884946 CGGGTGGAGGAGAAGGAGTAGGG + Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968331008 3:197870173-197870195 TAGGTGCAGCAGATGGAGGAAGG - Exonic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
969229874 4:5822480-5822502 TAGGTGGATCTGAAGGGGGGGGG + Intronic
969979534 4:11140494-11140516 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
970551526 4:17186388-17186410 TAGGTGGACCAGATGGAGCAGGG + Intergenic
971035875 4:22692428-22692450 AAGGTGGAAGAGAAGGAGGGAGG + Intergenic
972544364 4:40066154-40066176 CAGGTGGATCACAAGGTCAAGGG - Intronic
973581611 4:52349550-52349572 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
974087802 4:57279668-57279690 CTGGTGGAGGAGAGGGAGGATGG + Intergenic
974112201 4:57538051-57538073 GAGGAGGATCAGGAGGAGGAGGG - Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
975362350 4:73485675-73485697 GAGGTGGAAGAGAAGGAGGGGGG + Intronic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976468666 4:85401583-85401605 CAGCAGGATCAAAAGGAGGGAGG - Intergenic
977535185 4:98249238-98249260 CAGGTGGTTAAGGAGGAGTAGGG - Intergenic
981269543 4:142829015-142829037 TAGGTAGATCAGAGGGAGGAGGG + Intronic
981269567 4:142829335-142829357 CAGGTAGATCAGAGGGAGGAGGG + Intronic
982169159 4:152644383-152644405 CAGGTGGATCAGAAGCAGCAGGG + Intronic
982348115 4:154384334-154384356 CAGGTGGTGCATGAGGAGGAGGG - Intronic
982416581 4:155140405-155140427 AAGGAGGATGAGGAGGAGGAGGG - Intergenic
983098720 4:163597981-163598003 TTGGTGTATCTGAAGGAGGAGGG - Intronic
984097431 4:175449624-175449646 CAGCTGGACCAGAGGGAGAAAGG + Intergenic
984576229 4:181451621-181451643 CAGCTGGATCAGAAAGAGAATGG + Intergenic
984637885 4:182133019-182133041 CAGGCGAGTCAGGAGGAGGAGGG + Intergenic
985026414 4:185743709-185743731 CATCTGAATCAGGAGGAGGAGGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
985830196 5:2222415-2222437 CGAGTGGCTCTGAAGGAGGAAGG - Intergenic
986351976 5:6888803-6888825 CAGGTGGGTCAGGAGGGAGAGGG + Intergenic
986695586 5:10352260-10352282 GAGTTGGATCAGAAGGAGAGGGG + Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
989758309 5:44983151-44983173 CAGGAGGATCAGAAAGACCATGG + Intergenic
992896909 5:81253531-81253553 AGGGTGGACCTGAAGGAGGAGGG - Intronic
992950261 5:81851310-81851332 GAGGTGGATCAGAGGGAGGAAGG + Intergenic
993021136 5:82592477-82592499 GAGGAGGAGGAGAAGGAGGAAGG - Intergenic
993172066 5:84431556-84431578 CAGGTGGACCAGGAGGGGCATGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994427532 5:99610630-99610652 CAAGTGAGTCTGAAGGAGGAGGG + Intergenic
994553891 5:101272057-101272079 CAGGTGGAAAGGAAGGAGAAAGG + Intergenic
994636003 5:102344876-102344898 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
994920659 5:106039012-106039034 CATGGGGATGAGAAAGAGGAAGG - Intergenic
994947727 5:106417289-106417311 CAGGTAGCTCAGCAGCAGGAAGG + Intergenic
995404319 5:111777010-111777032 GAGGTGGAGGAGGAGGAGGAAGG + Intronic
996165729 5:120220686-120220708 GAAGTGGAGGAGAAGGAGGAGGG - Intergenic
996344173 5:122471810-122471832 CAGGGGGAGTAGAAGGATGAGGG - Intergenic
996673508 5:126148336-126148358 CAGGAGGATGAGGAGGAGGGGGG - Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
997102101 5:130980669-130980691 CAGCTGGATCTGAAGGAGCTGGG + Intergenic
997291380 5:132738042-132738064 CAAGTGGACTAGAAAGAGGATGG - Intergenic
997377598 5:133408473-133408495 CTGGTGGAGCAGAGGGAGAAGGG + Intronic
999127648 5:149258277-149258299 CAGGTGGCGCTGAAGGAGGCAGG - Exonic
999137219 5:149329952-149329974 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
1000747655 5:165055053-165055075 GAGGAGGAGTAGAAGGAGGAAGG - Intergenic
1000992205 5:167922814-167922836 CTGATGGATCTGAAAGAGGAGGG - Intronic
1001233575 5:170010457-170010479 CAGGAAGATGAGAAGGAGTAAGG + Intronic
1001573096 5:172743682-172743704 CAGGTGGTCCAGAGGAAGGAGGG + Intergenic
1001628880 5:173159987-173160009 CATGGGGATCAGCAGGATGATGG + Exonic
1001810941 5:174627772-174627794 CAGGTGGAGCTGAAGTGGGACGG + Intergenic
1002193455 5:177490443-177490465 CAGGAGGAACAGAAAGAGGGAGG + Intronic
1002214419 5:177619881-177619903 TAGGTGGCTCAGAAGAAGAAGGG + Intergenic
1002640112 5:180626703-180626725 CAGGTGTCTAAGAAAGAGGACGG - Intronic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1002761507 6:205988-206010 CAGGTGACTCAGCAGGAGGCTGG - Intergenic
1002857700 6:1052685-1052707 CAAGTGCATCAGAAGGATGGGGG - Intergenic
1003427846 6:6009120-6009142 CAGGTGGATAAGCAGGAGGAAGG - Intergenic
1003567596 6:7233808-7233830 GAGGTGGAACAGCAGGAGGGAGG + Intronic
1003725013 6:8751436-8751458 CAGATGGATACAAAGGAGGAAGG + Intergenic
1003886020 6:10522113-10522135 CAGGTGGATCACATGGAGTCAGG - Intronic
1004287901 6:14339613-14339635 CAGGTGGGTCAGGGGGAGGAGGG - Intergenic
1004516376 6:16325584-16325606 CAGGTGGGTCAGGAGGTGGAGGG - Intronic
1005081954 6:21965396-21965418 GAGGAGGAGAAGAAGGAGGAGGG - Intergenic
1005211641 6:23472245-23472267 CAGGTGAAGTAGAAGGAGTATGG + Intergenic
1005634535 6:27740694-27740716 TGGGTGGATGAGAAAGAGGAAGG - Intergenic
1005926783 6:30451506-30451528 CAGGAGGCTCTGAAGGAAGAGGG + Intergenic
1006262402 6:32886185-32886207 TAGGTAGATTAGAAGGTGGATGG + Intergenic
1006511692 6:34525149-34525171 CGGGTGGGTGAGAGGGAGGACGG - Intronic
1007827105 6:44608762-44608784 GAGGAGGAGGAGAAGGAGGATGG - Intergenic
1008365869 6:50678957-50678979 CAGGAGGCTCAGGGGGAGGATGG + Intergenic
1010737123 6:79455476-79455498 CAGGTGCAGGAGAAGGAAGAGGG + Intergenic
1010890953 6:81309771-81309793 CAGGTGGATTTGAAGAAGCATGG + Intergenic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1013722578 6:113048654-113048676 CAAGTGAATCATGAGGAGGAGGG - Intergenic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015416798 6:132958220-132958242 AAGGTGGAAAAGAAGAAGGAAGG + Intergenic
1015960174 6:138640483-138640505 GAGGAGGATGAGGAGGAGGAGGG - Intronic
1016120507 6:140337437-140337459 CAGGTGATTCTGGAGGAGGAAGG - Intergenic
1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG + Intergenic
1016544702 6:145207960-145207982 CAGGTGGATCACAAGGTCAAGGG + Intergenic
1018129761 6:160717915-160717937 CAGATGGATGTTAAGGAGGATGG - Intronic
1018839334 6:167507450-167507472 CAGGGGGGTCAGACAGAGGACGG - Intergenic
1018864232 6:167734965-167734987 GAGGAGGGTCAAAAGGAGGATGG + Intergenic
1018915904 6:168132201-168132223 CAGCTGGCTGAGAAGGAGGCAGG - Intergenic
1019105002 6:169660484-169660506 CTGCTGGATCCGAAGGACGAGGG - Intronic
1019854118 7:3587000-3587022 GAGGTGGAGGAGGAGGAGGAAGG + Intronic
1020100302 7:5390573-5390595 CAGGTGGTTCAGGTGGAGGTAGG + Exonic
1020437114 7:8176296-8176318 CATGTGGACCAAAAGGAAGAGGG - Intronic
1020577336 7:9949778-9949800 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1022529228 7:31056835-31056857 GAGGTGGATGAGAAGGTGGAGGG - Intronic
1023045174 7:36204423-36204445 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1023168762 7:37369901-37369923 AAGGAGGATCAGAAGGAGTAGGG - Intronic
1023561100 7:41474148-41474170 GAGGTGGAGCAGATGTAGGAGGG - Intergenic
1023818177 7:43965915-43965937 CGGGTGGCGCAGCAGGAGGAGGG - Intergenic
1024019130 7:45349209-45349231 CTGGAGGATCACCAGGAGGATGG + Intergenic
1024215045 7:47241395-47241417 CAGATGGGTCACAAGGAGCAAGG + Intergenic
1024312155 7:47979375-47979397 CAGGAGGATCAGAACGGGGATGG - Intronic
1025294436 7:57764322-57764344 CAGGTGCACCAGAAGGTGAAGGG - Intergenic
1026057276 7:66995613-66995635 CAGGTGGAGCAGAAGCCGGGAGG + Intronic
1026062651 7:67039886-67039908 CAGGTGGATCACAAGGTCAATGG - Intronic
1026594720 7:71724818-71724840 CAGGTGGATCACAAGGTCAAGGG - Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026720838 7:72829438-72829460 CAGGTGGAGCAGAAGCCGGGAGG - Intergenic
1026952243 7:74355304-74355326 CAAGTGAATCAGAAGCTGGATGG + Intronic
1027448615 7:78303407-78303429 CAGATGATTCAGGAGGAGGAGGG - Intronic
1027829246 7:83156039-83156061 AAAGTGGTTCAGAAGGAGCAAGG - Exonic
1027903430 7:84148733-84148755 GAGGAGGATCAGGAAGAGGAGGG - Intronic
1028097773 7:86783632-86783654 GAGGTGGATGAGAAAGAGAAAGG + Intronic
1029524551 7:101087077-101087099 GAGGAGGAGGAGAAGGAGGAGGG + Exonic
1029628291 7:101734115-101734137 CAGATGGGTGAGAAGGGGGATGG - Intergenic
1029667568 7:102005705-102005727 CAGGTGGAGTAGACAGAGGAGGG - Intronic
1029714398 7:102318052-102318074 CAGCTGGATCAGAGGCATGATGG + Intronic
1029742804 7:102500747-102500769 CGGGTGGTGCAGCAGGAGGAGGG - Exonic
1029760794 7:102599908-102599930 CGGGTGGTGCAGCAGGAGGAGGG - Exonic
1031339424 7:120580430-120580452 CTTGTGGAGCAGAAGGTGGAAGG - Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031780785 7:125961461-125961483 CTGATGGAACAGCAGGAGGAGGG - Intergenic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1032554126 7:132813779-132813801 CAGGTGGTGGAGAAAGAGGAGGG + Intronic
1033453903 7:141485200-141485222 CAAGTAGATCTGAAGGATGAGGG + Intergenic
1033648801 7:143324364-143324386 CAGGTGGAAGAGAGGGAGGTGGG - Intronic
1033832579 7:145271426-145271448 AAGGTGGAGGAGCAGGAGGAGGG + Intergenic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1033956389 7:146854054-146854076 CAGGGAGATGAGAAGGAGGCTGG + Intronic
1034070057 7:148175842-148175864 GAGGAGGATGATAAGGAGGATGG - Intronic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034300471 7:150010817-150010839 CAGATGGAACAGAATGAGAAAGG + Intergenic
1034805583 7:154086491-154086513 CAGATGGAACAGAATGAGAAAGG - Intronic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1036076145 8:5503042-5503064 CAGATGGAGCAAAATGAGGAAGG - Intergenic
1036165185 8:6426081-6426103 CGGGTGGAAGAGAACGAGGAAGG - Intronic
1036448727 8:8846288-8846310 GAGGAGGATAAGAAGGAGGAGGG + Intronic
1036561278 8:9902299-9902321 CAGGTGGAGGAAATGGAGGAGGG - Intergenic
1036707169 8:11054707-11054729 CTGGTGGGTGGGAAGGAGGAAGG + Intronic
1036798028 8:11769876-11769898 CAGGCGGCTGAGACGGAGGAGGG - Exonic
1037339817 8:17832286-17832308 CAGAAGGAACGGAAGGAGGAAGG + Intergenic
1037737902 8:21581649-21581671 CAGGTGGAGGAGACGGAGGCTGG + Intergenic
1038307895 8:26421167-26421189 CTGGTGGTCCAGAAGGAGGGTGG + Intronic
1038401341 8:27287096-27287118 ACGGTGGGTCAGAAGGCGGAAGG - Exonic
1039310647 8:36314515-36314537 CAGGTAGATCACATTGAGGATGG - Intergenic
1039588658 8:38728607-38728629 CAGGTGGCGCAGAAGGGAGAGGG + Intronic
1039737420 8:40347711-40347733 CAGGAGGTCAAGAAGGAGGAAGG - Intergenic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1040974635 8:53176461-53176483 AAAGGGGATGAGAAGGAGGAGGG + Intergenic
1041401366 8:57448750-57448772 GAGGGGGAGGAGAAGGAGGAGGG - Intergenic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1044352870 8:91186813-91186835 GAGGTGGATGGGATGGAGGATGG + Intronic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045435006 8:102153567-102153589 CATGTAGATCAGGAGGTGGAAGG + Intergenic
1048220096 8:132533183-132533205 GAGGAGGATGAGAAAGAGGAAGG + Intergenic
1048369880 8:133768028-133768050 CAGGAGGAAGAGATGGAGGAAGG - Intergenic
1048672302 8:136736758-136736780 CAGGTGAGTCAGAAGGCAGAGGG + Intergenic
1049233392 8:141495802-141495824 CAGGTGGATTAGTAGATGGAAGG - Intergenic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049889429 9:54840-54862 TGGCTGGAACAGAAGGAGGAGGG - Intergenic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1051278463 9:15418991-15419013 CAGGAGGATCAAAAGTAGTAGGG + Intergenic
1051694321 9:19751794-19751816 CTGGAGGATCAGACGTAGGAAGG + Intronic
1051807241 9:21008614-21008636 CTGGTGGTTAAGAAGGAAGAAGG - Intronic
1052295871 9:26895434-26895456 CGGGTGGATCATGAGGAAGATGG + Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053441621 9:38120958-38120980 GAGGGGGAGGAGAAGGAGGAGGG + Intergenic
1054161984 9:61679981-61680003 CAGGTGCACCAGAAGGTGAAGGG + Intergenic
1054991475 9:71331964-71331986 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1055078010 9:72237106-72237128 CAGGTGGAGCAGGAGCATGAGGG - Intronic
1056627240 9:88263933-88263955 CAGGTGGATCACAAGGTCAAAGG + Intergenic
1057115261 9:92514849-92514871 GAGGAGGATGAGGAGGAGGAGGG - Exonic
1057752355 9:97803239-97803261 CAGGCGGAAGAGAAGGAGGGAGG + Intergenic
1058176434 9:101740552-101740574 AAGGTGGACAAGAAGGAGAAAGG - Intergenic
1058567718 9:106304337-106304359 CAGATGCAGCATAAGGAGGAAGG + Intergenic
1058910371 9:109515340-109515362 CAGGTAGATCTCATGGAGGATGG - Intergenic
1059003638 9:110377364-110377386 CAGCTGGAAAAGAAGCAGGATGG + Exonic
1060628975 9:125139004-125139026 AAGGTGGAGCAGAGGGAGGGTGG + Intronic
1060931373 9:127491516-127491538 CAGGAGGGTCAGAGGAAGGAGGG + Intronic
1060968932 9:127727054-127727076 CAGCTGGAGCAGATGGTGGAGGG + Exonic
1061204814 9:129156750-129156772 CAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1061848842 9:133403021-133403043 CCGGTGGGACAGCAGGAGGAGGG - Intronic
1185624933 X:1474677-1474699 CAGATGGATGAGTGGGAGGATGG + Intronic
1185624994 X:1474975-1474997 CAGATGGATGAGTGGGAGGATGG + Intronic
1186709199 X:12174838-12174860 TAAGTGGACCAGAAGAAGGAAGG - Intronic
1186942517 X:14526456-14526478 CAGGTAGATTAGTAAGAGGATGG + Intergenic
1187055006 X:15734652-15734674 TAGGTGGATCAGAGTGAGAAAGG + Intronic
1187819085 X:23266134-23266156 CAGGTAGATCAGAATCAGAATGG - Intergenic
1191666329 X:63706415-63706437 CAGGAGGATGAGGTGGAGGAGGG - Exonic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192042933 X:67642394-67642416 CAGGTGGATATGAAGGAGAAGGG - Intronic
1192435247 X:71139358-71139380 CATGGGGACCAGAATGAGGATGG + Intronic
1192639091 X:72846163-72846185 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1192642620 X:72874642-72874664 GAGGAGGAGAAGAAGGAGGAGGG - Intronic
1195248186 X:103015725-103015747 CAGGAGGATGAGAAAGAGAAGGG - Intergenic
1195536342 X:106013025-106013047 TCGGTGGATCTGAAGGATGATGG - Intergenic
1195989894 X:110672064-110672086 CAGGAGGAACAGACAGAGGAGGG + Intergenic
1197906098 X:131427352-131427374 GAGAAGGATGAGAAGGAGGAAGG - Intergenic
1198064209 X:133080258-133080280 CAGGAGAATCAGAAGAAAGAAGG + Intronic
1198890336 X:141387828-141387850 CAGGGGGAGTTGAAGGAGGAGGG - Intergenic
1199080569 X:143572133-143572155 CTTGTGGACCAGAAGAAGGAAGG - Intergenic
1199156391 X:144553662-144553684 CAGGTGGATCATGAGCATGAGGG - Intergenic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1199559214 X:149145577-149145599 CATGTTGACCAGAAGTAGGATGG + Intergenic
1199635756 X:149809988-149810010 CAGGAGGCTGAGAAGGAGAATGG + Intergenic
1199717757 X:150518460-150518482 CAGGAGGAATAGAAGGAGGCTGG + Intergenic
1199986135 X:152952917-152952939 GAGGAGGATGAGGAGGAGGAAGG + Intronic
1200141243 X:153904132-153904154 CAGGTGGGGCAGGAGGAAGAGGG + Intronic
1201334887 Y:12869957-12869979 CAGGAGGGAGAGAAGGAGGAAGG - Intergenic
1201349120 Y:13019965-13019987 GAGGTGGAGGAGAAGGAGGGAGG - Intergenic
1201730455 Y:17197085-17197107 TAGGTGCATCAAAAGGAGAAGGG - Intergenic
1202043532 Y:20713028-20713050 CAGATGCATCAGAAGGAAGCTGG - Intergenic