ID: 1034282934

View in Genome Browser
Species Human (GRCh38)
Location 7:149866150-149866172
Sequence TCAAAGGCAGAAAGCAAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1394
Summary {0: 1, 1: 0, 2: 7, 3: 132, 4: 1254}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034282934_1034282941 14 Left 1034282934 7:149866150-149866172 CCTTTCTTGCTTTCTGCCTTTGA 0: 1
1: 0
2: 7
3: 132
4: 1254
Right 1034282941 7:149866187-149866209 TCCCAGCCCTGTGGGTCTGGCGG 0: 1
1: 0
2: 1
3: 64
4: 473
1034282934_1034282939 6 Left 1034282934 7:149866150-149866172 CCTTTCTTGCTTTCTGCCTTTGA 0: 1
1: 0
2: 7
3: 132
4: 1254
Right 1034282939 7:149866179-149866201 GAAATGTCTCCCAGCCCTGTGGG 0: 1
1: 0
2: 1
3: 21
4: 248
1034282934_1034282946 21 Left 1034282934 7:149866150-149866172 CCTTTCTTGCTTTCTGCCTTTGA 0: 1
1: 0
2: 7
3: 132
4: 1254
Right 1034282946 7:149866194-149866216 CCTGTGGGTCTGGCGGTCAGAGG 0: 1
1: 0
2: 1
3: 21
4: 198
1034282934_1034282940 11 Left 1034282934 7:149866150-149866172 CCTTTCTTGCTTTCTGCCTTTGA 0: 1
1: 0
2: 7
3: 132
4: 1254
Right 1034282940 7:149866184-149866206 GTCTCCCAGCCCTGTGGGTCTGG 0: 1
1: 0
2: 3
3: 26
4: 275
1034282934_1034282938 5 Left 1034282934 7:149866150-149866172 CCTTTCTTGCTTTCTGCCTTTGA 0: 1
1: 0
2: 7
3: 132
4: 1254
Right 1034282938 7:149866178-149866200 GGAAATGTCTCCCAGCCCTGTGG 0: 1
1: 0
2: 0
3: 29
4: 310
1034282934_1034282947 22 Left 1034282934 7:149866150-149866172 CCTTTCTTGCTTTCTGCCTTTGA 0: 1
1: 0
2: 7
3: 132
4: 1254
Right 1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG 0: 1
1: 0
2: 1
3: 8
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034282934 Original CRISPR TCAAAGGCAGAAAGCAAGAA AGG (reversed) Exonic
900286050 1:1901151-1901173 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
900286051 1:1901159-1901181 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
900286052 1:1901167-1901189 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
900788085 1:4662247-4662269 TCAAAGGCTGGAGGCAGGAACGG - Intronic
900926028 1:5706537-5706559 TCTAAGGAAGATAGCAAGAATGG - Intergenic
901338344 1:8471309-8471331 TCAAAGAGAGAAAAAAAGAAGGG - Intronic
901396463 1:8985609-8985631 GCAAATGCAGAAAGCAAGGCTGG + Intergenic
901809765 1:11761136-11761158 TAAAAGAAAGAAAGAAAGAAAGG - Intergenic
902944770 1:19826975-19826997 TCAAAGAAAGAAAGAAAGGAGGG + Intergenic
903594887 1:24486453-24486475 TGAAAGGCAGGAAGCTACAAGGG - Intergenic
904147033 1:28401207-28401229 TTCAAGGCTGAAAGCAAGAAAGG + Intronic
904352012 1:29914582-29914604 TAAATGGGAGAAAGAAAGAAGGG + Intergenic
904535285 1:31195420-31195442 GGCAAGGCAGAAAGAAAGAAAGG - Intronic
904958312 1:34307625-34307647 TTAAAGGCAGCTAGAAAGAAAGG + Intergenic
905053483 1:35073320-35073342 AGAAAGGGAGAAAGAAAGAAAGG + Intronic
905549300 1:38823318-38823340 GCAAAGGCAGAAAGAAATACAGG + Intergenic
905592223 1:39174118-39174140 TAAAAGACAGGAAGAAAGAAAGG - Intronic
905958071 1:42015904-42015926 CAAAAGGCACAAAGCATGAAAGG - Intronic
906097168 1:43231999-43232021 TCTAAGGCATAAAACAGGAAAGG - Intronic
906443143 1:45868538-45868560 GCAAAGGCAAAAAGCAAGCAGGG - Intronic
906644844 1:47467102-47467124 GCAATGGAAGAAAGGAAGAAAGG - Intergenic
906708153 1:47909823-47909845 AGAAAGAAAGAAAGCAAGAAAGG - Intronic
906795584 1:48693989-48694011 ACAAAGGCGGAACGTAAGAAGGG - Intronic
907148189 1:52256016-52256038 AGAAAGACAGAAAGAAAGAAAGG - Intronic
907350971 1:53830459-53830481 CCAAAAACAGAAAGCAAGCAAGG + Intronic
907387003 1:54132495-54132517 ACAAAGGAAGGAAGGAAGAAAGG + Intergenic
907601609 1:55776810-55776832 TATAAGGCAGAAAGAAAAAATGG - Intergenic
907703346 1:56811319-56811341 TTCAAGGCTGAAAGCAAGAAAGG - Intronic
907819351 1:57952023-57952045 TAAAAGGAAGAAAGAATGAATGG - Intronic
908462325 1:64357464-64357486 TCAAAAGCAGGAAGCAGAAAGGG - Intergenic
908530400 1:65028454-65028476 TGGAAGGAAGAAAGGAAGAAAGG + Intergenic
909104051 1:71386579-71386601 TAAAAGGAAGACAGGAAGAAAGG + Intergenic
909141737 1:71875858-71875880 TCAAAGTCAGAAGGAAAAAATGG + Intronic
909201713 1:72697748-72697770 ACAAAGACAGAAATCAAGGAAGG - Intergenic
909203782 1:72726869-72726891 TTAAAGGCAGCTAGAAAGAAAGG + Intergenic
909231838 1:73101311-73101333 TTAAAGGCAGCAAGAGAGAAGGG + Intergenic
909271825 1:73631804-73631826 TAAAAGGCAGGCAGGAAGAAAGG + Intergenic
909555976 1:76954682-76954704 TCAGAGGGAGGAAGCAGGAATGG + Intronic
909874526 1:80785238-80785260 TCAAGGGCAGCCAGAAAGAAAGG + Intergenic
909985080 1:82151545-82151567 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
910064723 1:83139764-83139786 TTAAAGGCAGCTAGAAAGAAAGG - Intergenic
910417532 1:87016433-87016455 GAAAAGAAAGAAAGCAAGAAAGG - Intronic
910508227 1:87975057-87975079 AAAAAGACAGAAAGCAAAAAAGG - Intergenic
910510282 1:87996019-87996041 TCTACAGCAGAAAGAAAGAAGGG - Intergenic
910944719 1:92577889-92577911 ACAAAGCCAGAAAGCAAAAATGG - Intronic
911124948 1:94332675-94332697 TTGAAGGCTGAAAGCCAGAAGGG + Intergenic
911310553 1:96287736-96287758 TTAAAGGCAGCAAGAGAGAAAGG - Intergenic
911720242 1:101182994-101183016 TGAAAGAAAGAAAGAAAGAAGGG + Intergenic
911777511 1:101833152-101833174 TCAAAGGCAGAAATAAAGACAGG - Intronic
912023086 1:105131478-105131500 GCAAAGACAGAAAGTATGAAAGG + Intergenic
912099867 1:106191887-106191909 TCAAAGCCAAAAGGCTAGAATGG - Intergenic
912114552 1:106389157-106389179 AGAAAGGAAGAAAGAAAGAAAGG - Intergenic
912161056 1:106985694-106985716 TCAAATGCAGACATCCAGAATGG + Intergenic
912194195 1:107378444-107378466 ACAAATGCAGAAACCAAGGATGG + Intronic
912763853 1:112391230-112391252 TCAAAGTCTGAAAGCCAGAGAGG - Intergenic
913078148 1:115359057-115359079 TTAAGGGCAGAAAGAAAGACTGG + Intergenic
913480112 1:119280092-119280114 ACACATGCAGAAAGAAAGAAGGG - Intergenic
913705626 1:121419278-121419300 AGAAAGGAAGAAAGAAAGAAAGG - Intergenic
915026933 1:152839802-152839824 AGAAAGGAAGAAAGAAAGAAAGG + Intergenic
915893141 1:159789837-159789859 TCAAAAAAAGAAAGAAAGAAAGG + Intergenic
916136787 1:161661257-161661279 AGAAAGGAAGGAAGCAAGAAAGG + Intronic
916278390 1:163021305-163021327 ACAAAGGAAGACAGCAAGAGGGG - Intergenic
916355850 1:163906983-163907005 ACAAAGGAAGATAGTAAGAAGGG - Intergenic
916522689 1:165579382-165579404 GCCAAGGCAGAAAGGCAGAAAGG + Intergenic
916536700 1:165709997-165710019 CCAAAGGCAGCAAGAAAGAGTGG + Intergenic
916882903 1:169038104-169038126 ACAAAGGAAGACAGTAAGAAAGG + Intergenic
916953950 1:169811934-169811956 ACAAAGAAAGAAAGAAAGAATGG + Intronic
916997078 1:170312613-170312635 TCAGTGGCAGAGAGCAAGGAGGG - Intergenic
917036139 1:170749212-170749234 TTAAATGTAGAAAGAAAGAATGG + Intergenic
917096135 1:171400971-171400993 ACAAAGGAAGACAGCAAGATTGG + Intergenic
917140687 1:171832527-171832549 AAAAAGACAGAAAGAAAGAAAGG - Intergenic
917625554 1:176842485-176842507 TCAGAGGCAGTAAGAAAGAGAGG + Exonic
917931743 1:179827178-179827200 ATAAAGGCAGAAAGTTAGAATGG - Intergenic
918203890 1:182292008-182292030 CCAAGGGCAGAAAGCAAGAACGG - Intergenic
918232113 1:182545069-182545091 ACAAAGGAAGACAGTAAGAAAGG - Intronic
918488905 1:185059042-185059064 TCAAAGGCTGAAAGAAAGCCAGG - Intronic
918907917 1:190523596-190523618 ATATAGGCAGAAATCAAGAATGG - Intergenic
919417816 1:197333147-197333169 TAAAAGGCAGAGAGGTAGAAGGG + Intronic
919646363 1:200098806-200098828 TCAAAGACAGAAAACTAGATAGG + Intronic
919993327 1:202724798-202724820 GCAAGGGCAGAAAGGAAGCATGG + Exonic
920555023 1:206898422-206898444 AGAAAGGGAGAAAGTAAGAAAGG + Intronic
920708217 1:208270794-208270816 TCAGAGACTGACAGCAAGAAAGG + Intergenic
920891877 1:209994723-209994745 TTAAAGGCAGCTAGAAAGAAGGG + Intronic
920974828 1:210776001-210776023 TTATAGGCAGAAGGAAAGAATGG + Intronic
921090696 1:211839440-211839462 TATAAGGAAGAAAGAAAGAATGG - Intergenic
921214532 1:212925696-212925718 TGAAAGAAAGAAAGAAAGAAAGG + Intergenic
921377669 1:214491004-214491026 AGAAAGGAAGAAAGGAAGAAAGG + Intronic
921407440 1:214796499-214796521 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
921547273 1:216487237-216487259 TTAAAGGCAGCCAGAAAGAAAGG + Intergenic
922181150 1:223233910-223233932 TTATAGGCAGAATCCAAGAAAGG + Intronic
922231143 1:223687636-223687658 TAAAAAAAAGAAAGCAAGAAAGG - Intergenic
923081218 1:230657474-230657496 TTAAAGGCAGACAGAGAGAAAGG - Intronic
923194719 1:231653947-231653969 TCACAGGCCCAAAGCAACAATGG + Intronic
923223781 1:231920458-231920480 TCAAATGCATAGAGCCAGAAAGG - Intronic
923298802 1:232621373-232621395 GAAAAGACAGAAAGGAAGAAGGG - Intergenic
923396196 1:233567408-233567430 TTAATAGCAGAAAGCAAAAAAGG - Intergenic
924021901 1:239792169-239792191 TGAAAGTCAGAAAGGAAGAAAGG - Intronic
924159974 1:241220913-241220935 GGAAAGGAAGAAAGGAAGAAAGG + Intronic
924674245 1:246159588-246159610 TAGCAGGAAGAAAGCAAGAATGG + Intronic
924722494 1:246636621-246636643 TCGAAGACAGAAAGAGAGAATGG - Intronic
924761367 1:246990000-246990022 TGAAAGGGAGAAAGGGAGAAAGG + Intronic
1063432653 10:6004735-6004757 GCAAAGAAAGAAAGAAAGAAAGG - Intergenic
1063666623 10:8064721-8064743 TCAAATGCTGAGACCAAGAAAGG - Intronic
1063713130 10:8500076-8500098 AGAAAGACAGAAAGAAAGAAGGG - Intergenic
1064173682 10:13055840-13055862 TCAAAGGCAGGCAGCTAGCAAGG - Intronic
1064460349 10:15529055-15529077 AGAAAGGAAGAAAGGAAGAAAGG - Intronic
1064460350 10:15529063-15529085 AGAAAGGAAGAAAGGAAGAAAGG - Intronic
1064481805 10:15747384-15747406 TACATGGCAGAAAGCAAGAGAGG + Intergenic
1065248456 10:23784538-23784560 ACAAAGGAAGACAGCAAGAAAGG - Intronic
1065517556 10:26539453-26539475 AGAAAGGAAGAAAGGAAGAAAGG + Intronic
1065924137 10:30421038-30421060 TGAACTTCAGAAAGCAAGAAGGG - Intergenic
1066290493 10:34010064-34010086 ACAAAGGAAGAAAGGAAGAAAGG + Intergenic
1066317423 10:34261687-34261709 TCAAAGAAAGAAAGGAAGAAAGG + Intronic
1066346791 10:34595195-34595217 TCAAAGCCGGAATGGAAGAAGGG - Intronic
1066423162 10:35280360-35280382 AGAAAGGAAGAAAGGAAGAAGGG + Intronic
1066644836 10:37595838-37595860 TGAAAGACAGGGAGCAAGAAGGG - Intergenic
1067399381 10:45956978-45957000 ACAAAGGCAAAATGGAAGAAAGG + Intergenic
1067462442 10:46467635-46467657 ACAAAGAAAGAAAGGAAGAAAGG + Intergenic
1067624754 10:47917002-47917024 ACAAAGAAAGAAAGGAAGAAAGG - Intergenic
1067732746 10:48823803-48823825 TCACAGACAGCAAGCAAGAGAGG - Intronic
1067867700 10:49926194-49926216 ACAAAGGCAAAATGGAAGAAAGG + Intronic
1068144259 10:53046004-53046026 TACAAGGTAGAAAGCAAGAAGGG + Intergenic
1068156991 10:53212797-53212819 ACAAAGGGAGACAGCAATAAAGG - Intergenic
1068309693 10:55262214-55262236 CAAAAGGAAGAAAGAAAGAAAGG + Intronic
1068426845 10:56877478-56877500 TCAAAGCAAGAAAGCATAAATGG - Intergenic
1068428485 10:56899784-56899806 TAAAATGCAGAAAGGAAGCAGGG - Intergenic
1068485825 10:57657198-57657220 TAGAAGGAAGAAAGGAAGAAGGG + Intergenic
1068596091 10:58904740-58904762 CCAAAGCCCGAAAGCAAGAAGGG - Intergenic
1068819055 10:61352196-61352218 ACAAAGGAAGAAAGGAAGGAAGG + Intergenic
1069078045 10:64059063-64059085 TGATAGGCAGAAAGAATGAATGG - Intergenic
1069266922 10:66470726-66470748 TGAAGGAGAGAAAGCAAGAAAGG + Intronic
1069272026 10:66540664-66540686 AGAAAGGAAGAAAGGAAGAAAGG - Intronic
1069272027 10:66540672-66540694 AGAAAGGAAGAAAGGAAGAAAGG - Intronic
1069667608 10:70173984-70174006 TCAAATACAGAAGTCAAGAAAGG + Intergenic
1069791537 10:71025898-71025920 TAAAGGACAGAAAGAAAGAATGG - Intergenic
1069876689 10:71567492-71567514 TCAAGGGCAGAAGGCAGGAGAGG + Intronic
1069934955 10:71908964-71908986 GAAAAGACAGAAAGGAAGAAAGG + Intergenic
1070244480 10:74717825-74717847 ACAAAGGAAGAAAGCAATAGAGG - Intergenic
1070953634 10:80450453-80450475 TCAAAGGAAAAAAAAAAGAATGG + Intergenic
1071217076 10:83418609-83418631 ACAAAGGAAGACAGTAAGAAAGG - Intergenic
1071387563 10:85137733-85137755 TCACAGGCTAACAGCAAGAAAGG + Intergenic
1071410720 10:85391199-85391221 TTAAATGCAGATAGCAATAAAGG + Intergenic
1071441558 10:85702240-85702262 TCAAAGCAAGAAAGAATGAAGGG + Intronic
1071519518 10:86320481-86320503 TCAAAGTCAGAAGGAGAGAAAGG + Intronic
1071728259 10:88221115-88221137 GCAAAGGTAGAGAGGAAGAAAGG - Intergenic
1071764650 10:88649155-88649177 GGAAAGGAAGAAAGAAAGAAGGG + Intergenic
1071784932 10:88888433-88888455 ATAAAGGCAGAAAGAAACAAGGG + Intronic
1071814421 10:89218461-89218483 TGAAAGGAAGAAGGCAAGAATGG - Intronic
1071926127 10:90411285-90411307 ACAAAGGAAGACAGCAAGAAAGG + Intergenic
1071956508 10:90766613-90766635 ACAAAGGAAGACAGCAAGAGAGG - Intronic
1071969891 10:90893424-90893446 TCAAAAGAATAAAGAAAGAATGG - Intronic
1072125322 10:92440711-92440733 AGAAAGGAAGAAAGAAAGAAAGG - Intergenic
1072310256 10:94147478-94147500 AGAAAGGAAGAAAGAAAGAAGGG + Intronic
1072536009 10:96363546-96363568 AGAAAGGAAGAAAGAAAGAAAGG - Intergenic
1072624771 10:97104172-97104194 TCAAAGACCTAAAGGAAGAAGGG + Intronic
1072658859 10:97349811-97349833 TGAAAGGCAGAAAGGATGCATGG - Intergenic
1072901740 10:99413673-99413695 TTAAAGGCAGCCAGAAAGAAAGG + Intronic
1073643831 10:105279157-105279179 GGAAAGGAAGAAAGAAAGAAAGG - Intergenic
1073988801 10:109240516-109240538 TGGAAGGAAGGAAGCAAGAAAGG + Intergenic
1074078267 10:110149120-110149142 GCAATGGCAGAAAGCAGGAGAGG - Intergenic
1074586079 10:114768494-114768516 CCAGAGAGAGAAAGCAAGAAAGG + Intergenic
1075612800 10:123866888-123866910 TCAAAGGGAAAAATAAAGAATGG - Intronic
1075893988 10:125978666-125978688 CCAAAGCCTGAAAGCTAGAATGG + Intronic
1076977065 11:181415-181437 TTAATGGCAGAATGCATGAATGG + Intronic
1077757438 11:5047875-5047897 TAAAAGGAAAAAAGAAAGAAAGG - Intergenic
1077997432 11:7466116-7466138 GCAAAGGCAGAATGCAATAAAGG - Intronic
1078284938 11:9942846-9942868 ACAAAGAAAGAAAGGAAGAAAGG + Intronic
1078367587 11:10719503-10719525 GCATAGGCAGAGAGCAACAAGGG - Intergenic
1078494370 11:11801296-11801318 TTAAAGGGAGAAAGGAAGTAAGG + Intergenic
1078571724 11:12464323-12464345 ACAAGGGGAGAAAGCTAGAATGG - Intronic
1078681590 11:13481698-13481720 TTAAGGGCAGCAAGAAAGAAAGG + Intergenic
1078695480 11:13627439-13627461 TTAAGGGCAGCAAGAAAGAAAGG - Intergenic
1078790813 11:14540171-14540193 GCAAATGCAGAGAGCAAGTAGGG - Intronic
1078817111 11:14836797-14836819 ACAAAGAAAGAAAGAAAGAAAGG - Intronic
1078831415 11:14980749-14980771 TTTATGGCAGAAAGAAAGAATGG + Intronic
1079267235 11:18944981-18945003 TTAAAGGCAGCAAGAGAGAAAGG + Intergenic
1079962179 11:26938389-26938411 AGAAAGGCAGAAAGGAAGAGAGG - Intergenic
1080037900 11:27728525-27728547 AGAAAGGAAGAAAGCAAGAGGGG - Intergenic
1080627803 11:34046388-34046410 AAAAAGGAAGAAAGAAAGAAGGG - Intergenic
1080748434 11:35129798-35129820 TGAAAGGCAGAATGAAAGATAGG + Intergenic
1080788450 11:35497906-35497928 TCAAAGGCTGAGAGAATGAAGGG + Intronic
1081089256 11:38842238-38842260 GCAAATGTAGAAAGCAAGAGAGG - Intergenic
1081322173 11:41704679-41704701 TGAAAGACAGAAATCAAGAGAGG - Intergenic
1081462126 11:43281538-43281560 TCAAATCCTTAAAGCAAGAAGGG - Intergenic
1081508274 11:43740860-43740882 GCAAAGGAAGAAGGGAAGAATGG + Intronic
1081688691 11:45060284-45060306 TGAAAGAAAGAAAGAAAGAAAGG + Intergenic
1082094328 11:48115986-48116008 TCAAAGGAAGATAGTAAGAGAGG + Intronic
1082707810 11:56514268-56514290 TGAGAGGCAGAAAAGAAGAAGGG - Intergenic
1083587377 11:63870099-63870121 TCAACGGCAGAAGGCAAGCTGGG + Intronic
1083725336 11:64625114-64625136 TCTAAGGCAAAAAGGAAGGAGGG + Intronic
1083772472 11:64876021-64876043 TATATGGCAGAAAACAAGAAAGG + Intronic
1084704631 11:70808949-70808971 TCAATGACATACAGCAAGAACGG - Intronic
1084897508 11:72284596-72284618 TAAAAAACATAAAGCAAGAAAGG - Intergenic
1085466100 11:76724281-76724303 CCACAAGCAGAAAGGAAGAAGGG + Intergenic
1085810902 11:79680199-79680221 TCAAAGCCAGAAAGCAAGGGTGG - Intergenic
1085986011 11:81789391-81789413 TCAAATGAAGAATGCAAGAATGG + Intergenic
1086079209 11:82885672-82885694 TCAAAAGCAGAATGCAAGATAGG + Intronic
1086498726 11:87430682-87430704 TCAAAGGCAGAGACCCAGATTGG - Intergenic
1086568975 11:88261484-88261506 TCAAAGGCAGCTAGAGAGAAAGG - Intergenic
1086785036 11:90958214-90958236 TTAAAGGCAGCTAGAAAGAAAGG + Intergenic
1086880186 11:92144510-92144532 ACAAAGGAAGACAGAAAGAAAGG - Intergenic
1087012323 11:93525779-93525801 TCAAAGCCAAAAAACAAGACAGG + Intronic
1087178403 11:95117839-95117861 TAAAAGGAAGACAGGAAGAAAGG - Intronic
1087326995 11:96736980-96737002 TCAAAGGCAGATAGAGAGAAGGG - Intergenic
1087408839 11:97765094-97765116 TTACAGTCAGAAAGCAAAAAAGG + Intergenic
1087594195 11:100233286-100233308 TAAAAGGGAGGAAGAAAGAAAGG + Intronic
1087725345 11:101709267-101709289 TCAAAGACAGTTAGAAAGAAAGG + Intronic
1087729001 11:101757552-101757574 TAGAAGCCAGAAAGCAAGAAAGG + Intronic
1087789219 11:102389739-102389761 ACAAAGGAAGACAGCAAGAGAGG - Intergenic
1087817272 11:102673370-102673392 TTAAAGGCAGCTAGAAAGAAAGG - Intergenic
1087870927 11:103292170-103292192 ACAAAGGAAGACAGGAAGAAAGG - Intronic
1088101383 11:106159841-106159863 TCAAAGTCAGCATGGAAGAAAGG - Intergenic
1088394884 11:109355888-109355910 TAAAAGGAAGAAAGAAAGAAGGG - Intergenic
1088772258 11:113046881-113046903 GGAAAGGAAGAAAGGAAGAAAGG + Intronic
1089452292 11:118607188-118607210 TCTAAGGCAAAAAGAAAGAGGGG + Intronic
1089617543 11:119703441-119703463 TCCAAGGCAAACACCAAGAAGGG - Intronic
1090011604 11:123050362-123050384 TCAAAAAGAGAAAGAAAGAAAGG - Intergenic
1090017309 11:123097705-123097727 TCAGAGCCAGAAAGAAAGACTGG + Intronic
1090515469 11:127421603-127421625 TAAAAGGAAGACAGGAAGAAAGG - Intergenic
1090684685 11:129101939-129101961 TGAAAGGCAGCTAGAAAGAAAGG + Intronic
1090980156 11:131712896-131712918 AGAAAGGAAGAAAGCAGGAAGGG + Intronic
1091204745 11:133812472-133812494 TCAGAGGCAGATAGGAAGAGAGG + Intergenic
1091850686 12:3694390-3694412 ACAAATTCAGAAAGCAGGAAAGG - Intronic
1091868370 12:3863353-3863375 TCTAAGGAAAAAGGCAAGAAAGG - Intronic
1092092215 12:5812441-5812463 AGAAAGGAAGAAAGGAAGAAAGG + Intronic
1092631521 12:10383068-10383090 ACAAAGGAAGACAGGAAGAAAGG + Intronic
1092902933 12:13076644-13076666 TCAAAGGAAGAAAGAAAAATTGG + Intronic
1092937415 12:13376948-13376970 GCAAAGGCAGAATGGCAGAAGGG + Intronic
1093100956 12:15028728-15028750 TTAAAGGCAGCTAACAAGAAGGG - Intergenic
1093117748 12:15232934-15232956 AGAAAGGCAGAAAGGAAGAGAGG + Intronic
1093119270 12:15248280-15248302 TCAAAGGAAGACAGTAAGAAAGG + Intronic
1093785672 12:23189383-23189405 CCAAAGGCAGAAAGGAACACAGG + Intergenic
1093890966 12:24520548-24520570 AAAAAGGAAGACAGCAAGAAAGG + Intergenic
1094117210 12:26929714-26929736 AGAAAGACAGAAAGGAAGAAAGG + Intronic
1094163168 12:27413564-27413586 ACAAAGGAAGACAGTAAGAAAGG + Intronic
1094296397 12:28911709-28911731 TCAAAACCAGAAGGGAAGAAAGG - Intergenic
1094584796 12:31768018-31768040 TGAAAGCAAGAAAGAAAGAAAGG + Intergenic
1094615117 12:32029447-32029469 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
1094656834 12:32428472-32428494 TTAAGGGCAGACAGAAAGAAAGG - Intronic
1094770845 12:33657528-33657550 ACAAAGGCAGAAAGGAAAAAGGG - Intergenic
1095654661 12:44654932-44654954 TCAAAGCCAACAATCAAGAAAGG + Intronic
1096496341 12:52041498-52041520 TCAAAGGCCGAGAGCCAGGAAGG + Intronic
1096734152 12:53639632-53639654 TCAAAGGAAGGAAGGAAGGAAGG - Intronic
1096959356 12:55562162-55562184 TCAAGGGCAGACAGAGAGAAAGG + Intergenic
1097407238 12:59204179-59204201 ACAAAGGAAGACAGAAAGAAAGG + Intergenic
1097639516 12:62162940-62162962 CCAAAGGCATAAATCAAAAAAGG + Intronic
1097646017 12:62235619-62235641 ACAAAGGAATAAAGGAAGAAAGG - Intronic
1097764295 12:63506616-63506638 ACAAAGGAAGACAGCAAGAGAGG + Intergenic
1097869775 12:64591566-64591588 TAAAAGGAAGAAAAAAAGAATGG - Intergenic
1098314243 12:69176785-69176807 TCAAAGGCAGTTTGGAAGAAGGG + Intergenic
1098340458 12:69445417-69445439 ACAATGGAAGAAACCAAGAAAGG - Intergenic
1098446477 12:70570910-70570932 TAAAAGGGAGACAGCAAGAAGGG - Intronic
1098478167 12:70929732-70929754 TCAAAGCCAGGCATCAAGAAGGG + Intergenic
1098532110 12:71553047-71553069 TGGAAGAAAGAAAGCAAGAATGG - Intronic
1098678733 12:73323036-73323058 TTAAAGGTAGCTAGCAAGAAAGG + Intergenic
1098733527 12:74067648-74067670 TTAAGGGCAGCCAGCAAGAAAGG + Intergenic
1099077437 12:78128401-78128423 TCAAAAGCACAGGGCAAGAAAGG - Intronic
1099127887 12:78788906-78788928 TCAGAGGCATAAGGCAATAAAGG - Intergenic
1099184563 12:79503570-79503592 CCAAAACCAGAAGGCAAGAATGG - Intergenic
1099248973 12:80228697-80228719 TGAAAGGAAGAAAAGAAGAAAGG - Intronic
1099323673 12:81183374-81183396 ACAAAGGTAGACAACAAGAAAGG + Intronic
1099570506 12:84311326-84311348 AGAAAGGAAGAAAGAAAGAAAGG - Intergenic
1099572856 12:84347372-84347394 TCAAAGGCAGCTAGAGAGAAGGG - Intergenic
1100043111 12:90344434-90344456 TCAAAGACATAAAACAAGATGGG + Intergenic
1100174294 12:92011928-92011950 ATAAAGGCAGAAAGGAAAAAAGG + Intronic
1100214019 12:92428848-92428870 AGAAAGGCAGAAAGAAAGAAAGG - Intronic
1100946615 12:99790825-99790847 TAAAAGGAAGACAGGAAGAAAGG + Intronic
1101017178 12:100513791-100513813 TCAAAGACAGAAAGGAAGGAAGG + Intronic
1101037821 12:100722409-100722431 TCAAAGGCAACAAGAGAGAAGGG - Intronic
1101255611 12:102973872-102973894 ACAAAGGCAGGAAGGAAGGAGGG - Intergenic
1101394194 12:104329783-104329805 TGCAAGGCAGAAAACCAGAAAGG - Intronic
1101502495 12:105317039-105317061 AGAAAGGAAGAAAGGAAGAAAGG + Intronic
1101875803 12:108596456-108596478 TCAGAGGCAGAGGGCAAGAAAGG + Intronic
1102307900 12:111820111-111820133 TCACAGGAAGAATGAAAGAATGG + Intergenic
1102501009 12:113352415-113352437 AGAAAGGCAGAAAGACAGAAAGG - Intronic
1102564664 12:113787892-113787914 TGAAAGAAAGAAAGAAAGAAAGG + Intergenic
1102748601 12:115272120-115272142 TCAAAAAAAGAAAGAAAGAAAGG + Intergenic
1103009749 12:117448987-117449009 TCAAAGCCACACAGCTAGAAAGG - Intronic
1103200057 12:119080765-119080787 TCAAAGCCACACAGCAACAAAGG + Intronic
1103863486 12:124032721-124032743 ACAAAGGCATAAAGAGAGAAGGG - Intronic
1104062678 12:125281482-125281504 TCAAACACAGAAAGCAAGAGGGG - Intronic
1104242911 12:127008328-127008350 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
1104242912 12:127008336-127008358 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
1104242913 12:127008344-127008366 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
1104242914 12:127008352-127008374 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
1104242915 12:127008360-127008382 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
1104242916 12:127008368-127008390 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
1104378532 12:128286636-128286658 TCAAAGGCAGAAATGAAAAATGG - Intronic
1105284871 13:18995547-18995569 TGAAAGCCAGAAGGCTAGAAGGG + Intergenic
1105456472 13:20545546-20545568 CCAAGGGCAGACATCAAGAAAGG + Intergenic
1105831770 13:24168930-24168952 TCAAAGGTAGAAAGCAGGTCTGG - Intronic
1106109606 13:26765190-26765212 TCAAAGAAAGAAAGAAAGACGGG + Intergenic
1106428859 13:29659891-29659913 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
1106428860 13:29659899-29659921 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
1106662600 13:31816160-31816182 ACAAATGTAGATAGCAAGAATGG + Intergenic
1106684327 13:32042161-32042183 TGAAAAGAAGAAAGGAAGAAGGG + Intronic
1106689239 13:32096090-32096112 TGAAAGGAAGAAAGGGAGAAAGG - Intronic
1106703339 13:32253338-32253360 TCAAAAGTAGAAAGAATGAATGG - Intronic
1106883180 13:34153784-34153806 ACAAAGGCAGAAAGGGAAAAAGG + Intergenic
1107028857 13:35830738-35830760 GCAAGGCCAGAGAGCAAGAAGGG + Intronic
1107338139 13:39377881-39377903 GCAAAGGCACAAGGAAAGAATGG - Intronic
1107391135 13:39965420-39965442 TCAGAGGCAGCAAGCGAGAAGGG - Intergenic
1107405917 13:40113250-40113272 TCAGAGGCAGAGAGCATGCAAGG + Intergenic
1107819893 13:44277112-44277134 ACAAAGGAAGGAAGAAAGAAAGG + Intergenic
1109220662 13:59637963-59637985 TCAAAGTCACAAAGTAAAAATGG + Intergenic
1109336469 13:61001175-61001197 TAAAAGGAAGAGAGGAAGAAAGG - Intergenic
1109373630 13:61458619-61458641 CAAAAGACAGAAAGAAAGAAAGG + Intergenic
1109428941 13:62206747-62206769 TCAAATGTGGAAAGAAAGAAAGG + Intergenic
1109900202 13:68758662-68758684 AGAAAGGAAGAAAGAAAGAAAGG + Intergenic
1109900203 13:68758678-68758700 AGAAAGGAAGAAAGAAAGAAAGG + Intergenic
1110010191 13:70323260-70323282 GCAAAGGCAGTAAGGGAGAAGGG - Intergenic
1110237577 13:73232523-73232545 TCAAAGAAAGAAAGAAAGAAAGG - Intergenic
1110310452 13:74043136-74043158 TCAAAGGCTGAATGAAATAAGGG + Intronic
1110487735 13:76066877-76066899 TAAGAGGAAGAAAGGAAGAAAGG + Intergenic
1110532086 13:76609615-76609637 ACCATGGCAGAAGGCAAGAAGGG + Intergenic
1110622876 13:77618505-77618527 AGAAAGGCAGGAAGGAAGAAAGG - Intronic
1110821600 13:79924052-79924074 TCAAAAGCAGAAAAAAAGCAGGG - Intergenic
1110979364 13:81875610-81875632 TCAAAGGCAGTTTGCAGGAAGGG - Intergenic
1111084493 13:83357029-83357051 TCTGAGGCAGAAAGCAAGAAGGG - Intergenic
1111389040 13:87567135-87567157 ACAAAGGAAAACAGCAAGAAAGG + Intergenic
1111419756 13:87997614-87997636 TGAAAGGCAAATAGAAAGAAGGG - Intergenic
1111931806 13:94520387-94520409 TCAAAGGCAGAAATTGAGAAAGG + Intergenic
1112184639 13:97115833-97115855 ACACAGACAGAAAGAAAGAAAGG - Intergenic
1112704630 13:102053118-102053140 ACAAAGGAAGATAGCAAGAAAGG + Intronic
1113025916 13:105940661-105940683 TAAAAGAAAGAAAGAAAGAAAGG + Intergenic
1114151665 14:20047327-20047349 TCAAATGAAGAAATCAATAAAGG - Intergenic
1114276046 14:21146011-21146033 AGAAAGACAGAAAGAAAGAAGGG - Intergenic
1114278882 14:21171712-21171734 TTAAAGGCAGCTAGAAAGAAAGG + Intergenic
1114316251 14:21512421-21512443 TCAAAAAAAGAAAGAAAGAAAGG - Intergenic
1114326291 14:21592010-21592032 TCAAAGGAGGACAGTAAGAAAGG + Intergenic
1114440376 14:22741805-22741827 TCAAAAAAAGAAAGAAAGAAAGG + Intergenic
1114654248 14:24306528-24306550 CCAATGGCAAGAAGCAAGAAGGG + Exonic
1114681032 14:24483472-24483494 TCAAAGGCGGAAAGAAACAATGG - Intergenic
1114825643 14:26074953-26074975 TCAGAGGAAGGAAGGAAGAAAGG + Intergenic
1114882790 14:26807271-26807293 TGAAAAGCAGACAGCAAGATGGG - Intergenic
1114911876 14:27210384-27210406 ACAAAGACAGAAAGAAAGAAAGG - Intergenic
1114917918 14:27289998-27290020 ACCATGGCAGAAAGCAAAAAAGG + Intergenic
1115071501 14:29328376-29328398 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
1115071502 14:29328384-29328406 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
1115071503 14:29328392-29328414 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
1115071504 14:29328400-29328422 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
1115071505 14:29328408-29328430 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
1115071509 14:29328518-29328540 ACAGAGGGAGAAAGAAAGAAAGG - Intergenic
1115237615 14:31222849-31222871 TGAAAGGCAGATTGGAAGAAAGG + Intergenic
1115356673 14:32454963-32454985 TGAAAGGAAGAAAGGGAGAAAGG - Intronic
1115358318 14:32473520-32473542 TCCAAAGCAGAAAGAGAGAAAGG + Intronic
1115371249 14:32617149-32617171 TCAAAGGAACAAGGCTAGAAAGG - Intronic
1115519117 14:34215069-34215091 AGAAAGGAAGAAAGGAAGAAAGG + Intronic
1115658012 14:35462584-35462606 TCAAAGAAAGAAAGAAAGAAGGG - Intergenic
1115883569 14:37946559-37946581 TTAAAGGCAGCTAGAAAGAAAGG + Intronic
1116196553 14:41734743-41734765 CAAAATGCAGACAGCAAGAAAGG - Intronic
1116201947 14:41808390-41808412 GGAAAGGAAGAAAGGAAGAAAGG + Intronic
1116289971 14:43022330-43022352 TGAAAGGAAGAAAGGAAGGAAGG - Intergenic
1116402048 14:44519623-44519645 ACAAAGGAAGACAGAAAGAAAGG - Intergenic
1116630174 14:47320610-47320632 TCAAAGGAAGAAAGGAAGGGAGG - Intronic
1116650220 14:47581175-47581197 TCAAATGCAGAAAGTAATAAAGG - Intronic
1116765333 14:49063499-49063521 TTAAGGGCAGCAAGAAAGAAAGG + Intergenic
1116802831 14:49461098-49461120 TCAAAGATACAAAGGAAGAAAGG - Intergenic
1117026385 14:51624506-51624528 TAAAAGCCAGGAAGAAAGAAGGG - Intronic
1117206840 14:53452017-53452039 AAAAAGGCAGAAAGAAGGAAAGG - Intergenic
1117837618 14:59823679-59823701 TCAAAGGCAGCTAGAGAGAAGGG - Intronic
1117893569 14:60452292-60452314 TTAAAGGAAGACAGGAAGAAAGG + Intronic
1118107413 14:62675711-62675733 CCAGAGGTAGAAAGAAAGAATGG + Intergenic
1118520691 14:66581461-66581483 ATAAAGGAAGACAGCAAGAAAGG + Intronic
1118656127 14:67950899-67950921 CCAAAGGCAGGCAGCAAGACAGG + Intronic
1119198544 14:72735521-72735543 TGAAATGGAAAAAGCAAGAAGGG + Intronic
1119475426 14:74924133-74924155 TCAGAGGGAGAAAGTATGAAAGG - Intergenic
1120067310 14:80058115-80058137 TTAAAGACAGCAAGAAAGAAGGG + Intergenic
1120080631 14:80212136-80212158 CCACAGACAGATAGCAAGAAGGG - Intronic
1120629489 14:86872690-86872712 AGAAAGGAAGAAAGAAAGAAAGG + Intergenic
1120642669 14:87033779-87033801 TCCAAGGCTAAAAGTAAGAAAGG + Intergenic
1120664688 14:87292074-87292096 ACAAAGGAAGAAAGGAAGGAGGG - Intergenic
1120682476 14:87497106-87497128 TAAAAAGAAGAGAGCAAGAAAGG - Intergenic
1120972476 14:90219313-90219335 CCAAAGGAAGACAGCAAGAGAGG + Intergenic
1121154954 14:91674599-91674621 TTCAAGGCAAAAATCAAGAAAGG - Intronic
1121199057 14:92102254-92102276 GAAAAGGAAGAAAGGAAGAAAGG + Intronic
1121229152 14:92343700-92343722 TCAAAAAAAGAAAGAAAGAAAGG - Intronic
1121300327 14:92865463-92865485 GGAAAGGAAGAAAGAAAGAAAGG - Intergenic
1121578546 14:95008857-95008879 TCAGAGGCACAAAACGAGAAGGG + Intergenic
1121970597 14:98352442-98352464 TGAAAGGCAGGAAGGAAGATGGG + Intergenic
1123189587 14:106556307-106556329 GAAAAGGAAGAAAGGAAGAAAGG - Intergenic
1123914543 15:25009307-25009329 TCAAATGCAGAAAACATGATTGG - Intergenic
1123939548 15:25210220-25210242 TGAAAGACACAAGGCAAGAATGG - Intergenic
1123982107 15:25613649-25613671 TGAAAGGAAGAAAGGAAGGAAGG - Intergenic
1124418843 15:29499223-29499245 ACAAAGGAAGACAGCAAGAGAGG - Intronic
1124498521 15:30204761-30204783 ACAAAGGAAGATAGCAAGAGAGG - Intergenic
1124745062 15:32333915-32333937 ACAAAGGAAGATAGCAAGAGAGG + Intergenic
1124934793 15:34160173-34160195 TCAAAGGTAGAAAAGAAAAAAGG - Intronic
1125036471 15:35130405-35130427 GCAATGCTAGAAAGCAAGAAAGG - Intergenic
1125562372 15:40645319-40645341 TGAAAGGCAAATAGCAAGGAGGG - Intronic
1125605820 15:40939286-40939308 TCAAAGTCAGCAGGCAAGGAAGG - Intergenic
1125634924 15:41179518-41179540 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
1125818974 15:42611523-42611545 TCATAGGCAAAACCCAAGAAGGG - Intronic
1125926740 15:43569141-43569163 GCAAAGACAGAAGGCAAGACAGG + Intronic
1125939884 15:43668706-43668728 GCAAAGACAGAAGGCAAGACAGG + Intergenic
1126082522 15:44978976-44978998 TGAAAGACAGAAAGAGAGAAGGG - Exonic
1126137618 15:45407185-45407207 AGAAAGGCAAAAAGCATGAAGGG + Intronic
1126345593 15:47690414-47690436 ACAAAGTCTGAAATCAAGAAAGG - Intronic
1126401014 15:48270860-48270882 TCAAAGGAAGAAACCAAGCCAGG - Intronic
1126452991 15:48830119-48830141 ACAAAGGAAGACAGCAAGAAAGG - Intronic
1126550091 15:49919415-49919437 TCAAAAGAAAAAAGAAAGAAAGG - Intronic
1126602186 15:50440103-50440125 TGAAGGGCAGAAAGTAAGAGAGG + Intronic
1126609626 15:50516191-50516213 ACAAAGGAAGACAGCAAGAGAGG + Intronic
1127036605 15:54925211-54925233 ACAAAGGAAGATAGCAAGAGAGG - Intergenic
1127104331 15:55597139-55597161 ACAAAGAAAGAAAGAAAGAAAGG - Intergenic
1127438584 15:58983601-58983623 TCAAAGTCAGAAGGAAAGACTGG - Intronic
1127921557 15:63498504-63498526 TCGAAGACAGAACACAAGAAGGG + Intergenic
1128055676 15:64698245-64698267 TCACAGGCTGAAAGCAAAATTGG + Intronic
1128092874 15:64930956-64930978 TCGAAGGCAGAGAGCAAGCAAGG - Intronic
1128183258 15:65623550-65623572 TCAAAGGCAGGAAGGAGGTAGGG - Intronic
1128574286 15:68759986-68760008 CAAAAGAAAGAAAGCAAGAAAGG + Intergenic
1128574302 15:68760173-68760195 CAAAAGAAAGAAAGCAAGAAAGG + Intergenic
1128683472 15:69667606-69667628 CCAAAGTCACACAGCAAGAAGGG - Intergenic
1128796937 15:70472897-70472919 TAAAAGGAAGAAAGCAAGGGAGG + Intergenic
1128826940 15:70727829-70727851 TGAAATGAAGAAAGAAAGAAGGG + Intronic
1129580379 15:76802630-76802652 TCCAAGGGAGAAATCCAGAAGGG - Intronic
1129630271 15:77251429-77251451 CAAAAGGTAGAAAGAAAGAAAGG + Intronic
1129970629 15:79774929-79774951 TCCAAGGGAGAAACAAAGAAGGG + Intergenic
1130030783 15:80311478-80311500 TTCAAGGCTGAAAGCAAGAAAGG + Intergenic
1130068520 15:80627067-80627089 ACAAAGGAAGAAAGGAAGGAAGG - Intergenic
1130236187 15:82135900-82135922 AGAAAGGCAGCAAGCCAGAATGG + Intronic
1131136392 15:89939616-89939638 TGAAAGAAAGAAAGAAAGAAAGG - Intergenic
1131335292 15:91543183-91543205 TCAACACCAGAAAGAAAGAAGGG + Intergenic
1131358884 15:91771673-91771695 TGAAAGGAAGGAAGAAAGAATGG + Intergenic
1131438758 15:92442893-92442915 TCAAAGGCCCAGAGCTAGAAAGG - Intronic
1131449346 15:92526139-92526161 AGAAAGGAAGAAAGAAAGAAAGG - Intergenic
1131589998 15:93738807-93738829 TCAAAGGCAAATAGAGAGAAAGG - Intergenic
1131607368 15:93921216-93921238 TTAAAGGCAGACAGAAATAAGGG - Intergenic
1131638945 15:94268556-94268578 GCCAAGGGAGAAAACAAGAAGGG - Intronic
1131714180 15:95090628-95090650 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
1131938150 15:97530623-97530645 TCAAAGGCATAAAGAAATGAAGG - Intergenic
1133325305 16:4938408-4938430 AGAAAGCAAGAAAGCAAGAAAGG - Intronic
1133599715 16:7327193-7327215 TAAAAGGAAGAAAGGAAGAGAGG + Intronic
1133647191 16:7775315-7775337 TAAAAGGAAGAAAGGAAGGAGGG + Intergenic
1133788887 16:8994057-8994079 TCAAAAACAGAAAGAAAGAAAGG - Intergenic
1133797870 16:9061143-9061165 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
1134066386 16:11231239-11231261 TCAAAGACCGAAACCAAGAGAGG - Intergenic
1134727217 16:16429003-16429025 TCAAAAGCATAAAGCATAAATGG - Intergenic
1134887207 16:17804239-17804261 AGAAAGGAATAAAGCAAGAAGGG - Intergenic
1134940220 16:18282852-18282874 TCAAAAGCATAAAGCATAAATGG + Intergenic
1135036027 16:19077553-19077575 GAGAAGGCATAAAGCAAGAAAGG - Intronic
1135107902 16:19666935-19666957 AGAAAGGAAGAAAGGAAGAAAGG - Intronic
1135107903 16:19666943-19666965 AGAAAGGAAGAAAGGAAGAAAGG - Intronic
1135107904 16:19666951-19666973 AGAAAGGAAGAAAGGAAGAAAGG - Intronic
1135107905 16:19666959-19666981 AGAAAGGAAGAAAGGAAGAAAGG - Intronic
1135180006 16:20264642-20264664 TCAAAGTCAGAAATCACCAAGGG + Intergenic
1135747742 16:25031783-25031805 TCACAGGCAGAAAGCAGGAGAGG - Intergenic
1135795091 16:25433926-25433948 TGAAAGGAAGAAAGAAAGGAAGG - Intergenic
1135910590 16:26557308-26557330 AGAAAGGAAGAAAGAAAGAAAGG - Intergenic
1135910592 16:26557332-26557354 AGAAAGGAAGAAAGAAAGAAAGG - Intergenic
1136012333 16:27371925-27371947 TCAAGGGCAGAAGGCAGCAATGG - Intergenic
1136250142 16:28999019-28999041 AAAAAGGCAGAAAGGGAGAAAGG - Intergenic
1137773991 16:51040810-51040832 GCAAAGGCAGAAAAGAAGGAAGG + Intergenic
1137973482 16:53009523-53009545 ACAAAGGAAGATAGCAAGAGAGG - Intergenic
1138579383 16:57930492-57930514 TGAAAGGAAGAAAGCAGGAGAGG + Intronic
1138624958 16:58244117-58244139 TTCAAGGCTGGAAGCAAGAAGGG + Intronic
1138783449 16:59816361-59816383 ACAAAGGAAGACAGCAAGAGAGG + Intergenic
1138813767 16:60180691-60180713 AGAAAGGAAGAAAGAAAGAAAGG - Intergenic
1139221366 16:65185858-65185880 AGAAAGGTAGAAAGGAAGAAAGG - Intergenic
1139639744 16:68282599-68282621 TGGAAGGAAGAAAGGAAGAAAGG - Intronic
1139792147 16:69447056-69447078 TTAAAGGGAGAAAGGAAGAAGGG + Intronic
1139818480 16:69698122-69698144 TCAGAGAGAGAAAGAAAGAAAGG - Intronic
1140036932 16:71378223-71378245 TCAAAAAAAGAAAGAAAGAAAGG + Intronic
1140039016 16:71393106-71393128 TCAAGGGCAGAAAACAAGCGGGG + Intergenic
1140464732 16:75172153-75172175 TCAAATGAGGAAAGCAAGAGGGG + Exonic
1140660401 16:77186115-77186137 ACTAAGGTAGAAAACAAGAAAGG - Intergenic
1140789187 16:78374190-78374212 AGAAAGACAGAAAGGAAGAAAGG - Intronic
1140791459 16:78395534-78395556 AGAAGGGCAGAAAGAAAGAAGGG + Intronic
1140924695 16:79571031-79571053 CCAAAGTCACAAAGCTAGAAAGG + Intergenic
1141393627 16:83685262-83685284 ACTAAGGAAGAAAGGAAGAATGG + Intronic
1141806930 16:86348017-86348039 TTAGAGGCAGAAGGCAGGAAAGG - Intergenic
1142274612 16:89111208-89111230 TCAAAGTCACAAAGCATGTAAGG - Intronic
1142464202 17:119589-119611 TTAATGGCAGAATGCATGAATGG + Intergenic
1142517469 17:442017-442039 TCTAATTCAGAAAGCAAGGAAGG - Exonic
1142689704 17:1598118-1598140 GCAAAGAAAGAAAGAAAGAAAGG + Intronic
1143235629 17:5397463-5397485 TCAAAGGCAGCCAGCAACAGTGG - Intronic
1143308072 17:5964273-5964295 TCCAAGGCAGAAACCATGAAAGG - Intronic
1143537116 17:7548211-7548233 AGAAAGGAAGAAAGAAAGAAAGG - Intergenic
1144037895 17:11383739-11383761 TCAAAGAAAGGAACCAAGAAAGG - Intronic
1144163101 17:12581101-12581123 TCTAAGGTAGGAAGGAAGAAAGG - Intergenic
1144715753 17:17434686-17434708 TCAAAGCCAGGAAGCAGGGACGG + Intergenic
1146399989 17:32494598-32494620 CCAAAGGCAGAAAACCAGGAAGG + Exonic
1146892987 17:36519532-36519554 TCAAAGGCAATAAGAAAAAAGGG - Intronic
1147480679 17:40759650-40759672 ACAAAGGCAGACAGCAAGAAAGG - Intergenic
1147511866 17:41076840-41076862 AGAAAGGAAGAAAGGAAGAAGGG + Intergenic
1147544008 17:41385371-41385393 ACAAAGGAAGACAGCAAGATAGG - Intronic
1147797992 17:43059546-43059568 GGAAAGGCAGGAAGCAGGAATGG - Intronic
1148121066 17:45211700-45211722 ACAAAGGCACAAATCCAGAAAGG - Intergenic
1148188523 17:45662050-45662072 TCAAAGGGAGGAAGGAAGATGGG + Intergenic
1148380547 17:47193731-47193753 AAAAAGGAAGAAAGAAAGAAAGG - Intergenic
1148404679 17:47400564-47400586 GCAAAGGAAGAAAGGAAGCAGGG - Intronic
1149159890 17:53679708-53679730 ACAAAGTCAGGAAACAAGAAAGG - Intergenic
1149639998 17:58196541-58196563 TCCAAAGCAGCAAGCAAGAAAGG + Intronic
1150150040 17:62801623-62801645 GTAATTGCAGAAAGCAAGAATGG - Intronic
1150171308 17:62998490-62998512 TTAAAGGCAGCTAGAAAGAAGGG + Intergenic
1150342215 17:64377607-64377629 TCAAAGAAAGAAAGGAAGGAAGG + Intronic
1150749304 17:67845413-67845435 CCAAAGGGAGAGAGGAAGAAAGG - Intronic
1150880588 17:69021696-69021718 AGAAAGGGAGAAAGAAAGAAAGG - Intronic
1151148118 17:72060330-72060352 GGAAAGGGAGAAAGAAAGAAAGG - Intergenic
1151381033 17:73725943-73725965 TCAAAGAGAGAGAGCAAGGACGG - Intergenic
1151708020 17:75781953-75781975 TCAAAGGCAGAAATCAAAGTTGG - Intronic
1152179923 17:78813005-78813027 TCAAAGGAAGAAAACAAGTAGGG + Intronic
1152191489 17:78890976-78890998 GCAAAGGCAGAAAGCAGAGATGG - Exonic
1153018809 18:608147-608169 CCAAAGGCACAGAGCAAGACAGG - Intronic
1153619866 18:6967644-6967666 TCATAGGCAGAAATGAAGACCGG - Intronic
1154040450 18:10849695-10849717 TGCAAGACAGGAAGCAAGAATGG - Intronic
1154398733 18:14014518-14014540 TCAGAGGCAGGAAAGAAGAAAGG - Intergenic
1154482485 18:14846864-14846886 TCAAAGGCAGATTGTCAGAACGG - Intronic
1155146704 18:23089727-23089749 TGAAAGAAAGAAAGAAAGAAAGG + Intergenic
1155271084 18:24141815-24141837 TAAAAGGCAGAAAGGCAGAAGGG + Intronic
1155353161 18:24926105-24926127 GCAAAGGCACAGAGCAGGAAGGG + Intergenic
1155404298 18:25470870-25470892 AAAAAGACAGAAAGGAAGAAAGG + Intergenic
1155614823 18:27709742-27709764 TTAAAGGCAGATAGAGAGAAGGG - Intergenic
1155680128 18:28477509-28477531 TATAAGGCAGAACGCAGGAAGGG - Intergenic
1156001107 18:32385283-32385305 TGAAAGGTAGACAGCAAGGAAGG - Intronic
1156140793 18:34108264-34108286 ACAAAGGAAGAGACCAAGAAAGG + Intronic
1156391655 18:36656197-36656219 ACAAAGGCAGAAATAGAGAAGGG - Intronic
1156525455 18:37763552-37763574 CCAAATGCTGAAAGGAAGAATGG - Intergenic
1156623425 18:38880501-38880523 GGAAAGGCAGAAAGGAAGGAAGG + Intergenic
1156653958 18:39261241-39261263 TTAAAGGCAGCTAGAAAGAAAGG + Intergenic
1156798983 18:41085407-41085429 TCAGGGGCAGCAAGCAAGCATGG + Intergenic
1156800785 18:41110672-41110694 TTAAAGGCAGCTAGAAAGAAAGG + Intergenic
1156889862 18:42178328-42178350 ACAAAGGAAGGAAGGAAGAAAGG + Intergenic
1156987502 18:43365850-43365872 AGAAAGGGAGAAAGAAAGAAAGG + Intergenic
1157003739 18:43557983-43558005 TCAAAGGCAGCTAGAGAGAAGGG - Intergenic
1157022517 18:43803460-43803482 TAAAAGGAAGACAGGAAGAAAGG - Intergenic
1157139226 18:45088890-45088912 AGAAAGGAAGAAAGGAAGAAGGG - Intergenic
1157765865 18:50297273-50297295 ACAAAGAAAGAAAGAAAGAAGGG + Intergenic
1158026901 18:52910020-52910042 TCATAGGCAGGAAGCGATAAAGG + Intronic
1158123415 18:54075839-54075861 TCATATGCTGAAAGCAAGGAGGG - Intergenic
1158502568 18:58016764-58016786 TCAAAGGAAAAAAGAAAAAAAGG - Intergenic
1158540128 18:58346073-58346095 TCAAAGAAAGAAAGAAAGATTGG + Intronic
1158600398 18:58851415-58851437 ACAGAGGCAGGAAGCCAGAAAGG - Intergenic
1159205024 18:65238317-65238339 TTTAAGGAAGAAAGGAAGAATGG + Intergenic
1159237809 18:65699628-65699650 TCAAAGGATGGAAGAAAGAATGG - Intergenic
1159445935 18:68541940-68541962 TCCATGGCAGAAGGCAAGAGAGG + Intergenic
1159517342 18:69474267-69474289 TGAAAGAGAGAAAGGAAGAATGG - Intronic
1159833003 18:73301083-73301105 TAAAAAGCAGAAAAGAAGAATGG - Intergenic
1160304778 18:77722303-77722325 TCAAAGAAAGAAAGGAAGGAAGG - Intergenic
1160334431 18:78026036-78026058 TTAAAGTCAGAAAGAAGGAAGGG + Intergenic
1160356198 18:78229861-78229883 AAAAAGGAAGAAAGCAGGAAGGG - Intergenic
1160436099 18:78853978-78854000 TCAAAGGGAACAAGGAAGAAAGG + Intergenic
1161357753 19:3828481-3828503 TCAACGTCAGAAACCAAGCAAGG + Intronic
1161498754 19:4601616-4601638 TCAAGGGCACAAAGCAGGCAGGG + Intergenic
1161643820 19:5440403-5440425 AAAAAGGAAGAAAGAAAGAAAGG + Intergenic
1162394329 19:10407863-10407885 TTAAAGAAAGAAAGAAAGAAAGG - Intronic
1162797595 19:13094927-13094949 TAGAGGACAGAAAGCAAGAAAGG + Exonic
1162983043 19:14251093-14251115 AAAAAGGAAGGAAGCAAGAAAGG - Intergenic
1164413082 19:28021771-28021793 TCAAAAAAAGAAAGGAAGAAAGG - Intergenic
1164992640 19:32695560-32695582 TCAAAGACAGAAGGAAAGAGAGG - Intronic
1164998741 19:32743411-32743433 TCAAAAAAAGAAAGCAAGAAGGG - Intronic
1165289222 19:34869756-34869778 AGAAAGGAAGAAAGAAAGAAAGG + Intergenic
1165349328 19:35267800-35267822 TGCAAGGGAGAAAGAAAGAAGGG - Intronic
1165785946 19:38462053-38462075 TCAAAAGAAGAAAGAAAGAAAGG + Intronic
1166350269 19:42194818-42194840 AGAAAGGCAGAAAGGGAGAAAGG + Intronic
1166974531 19:46597261-46597283 ACAAAGGAAGACAGTAAGAAAGG - Intronic
1167248484 19:48388722-48388744 GAAAAGGAAGAAAGGAAGAAAGG + Intronic
1167248488 19:48388767-48388789 AGAAAGGAAGAAAGAAAGAAAGG + Intronic
1167611957 19:50512009-50512031 TAAAGGTCAGAAAGAAAGAAAGG + Intronic
1167808514 19:51807674-51807696 TCACAGGAAGAATGAAAGAATGG + Intronic
1168328793 19:55554012-55554034 AGAAAGACAGAAAGGAAGAAAGG - Intergenic
1168368166 19:55807398-55807420 CCTAAGGAAGAAAGCAAAAATGG - Intronic
925290168 2:2742605-2742627 TCAAAGGAAGAAAGGGAGGATGG + Intergenic
925439882 2:3876349-3876371 TCAAGGACAAAAGGCAAGAAAGG + Intergenic
926332334 2:11835833-11835855 ATAAAGGGAGAAAGAAAGAAAGG - Intergenic
926368216 2:12153158-12153180 GGAAAGGAAGAAAGGAAGAAAGG - Intergenic
926494211 2:13563818-13563840 AAAAAGGAAGACAGCAAGAAAGG + Intergenic
926600652 2:14841249-14841271 ACAAAGGAAGACAGTAAGAAAGG + Intergenic
926814045 2:16782786-16782808 TCAAAGGCAGATAGTCAGAGAGG - Intergenic
926837802 2:17043861-17043883 TCAAAGTCAGACATCATGAAAGG + Intergenic
926908398 2:17827150-17827172 TGGAAGGCAGAAAGTAAAAAAGG + Intergenic
926920240 2:17933056-17933078 TCAAAAGCATAAAGAAAGGAAGG - Intronic
927565257 2:24106196-24106218 TCAAAGGCAGCTAGAGAGAAAGG + Intronic
927731708 2:25479015-25479037 GCAAAGGCAAAAAGCAGAAAGGG - Intronic
927768699 2:25838327-25838349 TCAAAGGTAAAAAGAAAGCAGGG - Intronic
927902119 2:26828122-26828144 TCAAAGGCTGAATGGAAGGAAGG - Intergenic
927947696 2:27147225-27147247 GCAAAGAAAGAAAGAAAGAAAGG - Intergenic
928077027 2:28274204-28274226 TCAAGGAGAAAAAGCAAGAAGGG - Intronic
928295411 2:30078734-30078756 CTAAAGGCAGAAAGCAAGGATGG + Intergenic
928417528 2:31108555-31108577 TCAAGAGCAAAATGCAAGAAAGG + Intronic
928475209 2:31618675-31618697 TAAGAGGGAGAAAGCAAGAAAGG + Intergenic
928811492 2:35233312-35233334 TTAAAGGCAGCTAGAAAGAAAGG + Intergenic
929008323 2:37416645-37416667 ACAAAGGAAGAAAGAAGGAAGGG - Intergenic
929609163 2:43257122-43257144 ACAAAGGCAGACAGAGAGAATGG + Intronic
929727288 2:44443985-44444007 TCTAAGGCAGAACACAAGAAGGG + Intronic
929865833 2:45716566-45716588 AGAAAGGAAGAAAGGAAGAAAGG + Intronic
930271846 2:49266285-49266307 TCAAAGGCAAAAAGAAATGAAGG - Intergenic
930452559 2:51560547-51560569 TGAAAGGTAAAAAGGAAGAAAGG + Intergenic
930656723 2:54014322-54014344 TCAAAAAAAGAAAGAAAGAAAGG - Intronic
930832722 2:55762603-55762625 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
930843312 2:55872331-55872353 TGCAAAGCAGAAAGCAATAAAGG - Intronic
930982716 2:57547044-57547066 ACAAAAACAAAAAGCAAGAAAGG + Intergenic
931011905 2:57926938-57926960 TAAAAGGAAGACAGGAAGAAAGG - Intronic
931123383 2:59245952-59245974 TCAACGGCTGAAAACATGAAAGG - Intergenic
931135951 2:59401072-59401094 AGAAAGGAAGGAAGCAAGAAAGG + Intergenic
931137829 2:59424059-59424081 TGAAAGGCACAAAGCTGGAAAGG - Intergenic
931214953 2:60233535-60233557 TCAAAATCAGAAATCAAAAAAGG + Intergenic
931574635 2:63707035-63707057 TTAAAGGCAGCCAGAAAGAAAGG - Intronic
931798689 2:65737042-65737064 TCCAAGTCAGAAACCAAGAGGGG - Intergenic
931918163 2:66982188-66982210 TCTAAGACAGAAAGAAAGTATGG + Intergenic
932325683 2:70859881-70859903 ACGAAGGAAGAGAGCAAGAAAGG - Intergenic
932364668 2:71142030-71142052 TCAAAAAAAGAAAGAAAGAAAGG + Intronic
932643112 2:73471174-73471196 ACAAAGGAAGACAGCAAGAGAGG - Intronic
932804529 2:74771406-74771428 TAAAAGGAAGAAAGGAAGGAAGG + Intergenic
933165657 2:79072001-79072023 TGAAAGGCAGGAAGCAAGTCAGG + Intergenic
933785141 2:85833327-85833349 ACAAAGGAAGACAGTAAGAAAGG + Intergenic
933891538 2:86776029-86776051 TCAAAGGCAGAATTTCAGAATGG + Exonic
933892590 2:86785521-86785543 TCAAAGGCACACAGCAAGTCAGG - Exonic
934033386 2:88067411-88067433 TCAAAAGCAGACAGCTGGAATGG - Intergenic
934076743 2:88435063-88435085 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
934076744 2:88435071-88435093 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
934546551 2:95221989-95222011 TGGAAGGAAGAAAGGAAGAAGGG - Intronic
935182979 2:100706560-100706582 TGAAAGGCAGGAAGGAAAAATGG + Intergenic
935281984 2:101526256-101526278 ACAAAGGCAAAAAGGAAGAAAGG + Intergenic
935436260 2:103037300-103037322 ACAAAGGAAGACAGCAAGAGAGG - Intergenic
935485363 2:103646695-103646717 AGAAAGGAAGAAAGAAAGAAAGG + Intergenic
935565389 2:104600806-104600828 ACAAAAACAGAAAGAAAGAAAGG + Intergenic
935616430 2:105087815-105087837 TCAAAGGAAGGAAGGAAGGAAGG - Intronic
935740573 2:106143909-106143931 TCAAAGGCAGCAACAGAGAATGG - Intronic
936157120 2:110055165-110055187 ACAAAGGCAAAAAGGAAAAAAGG - Intergenic
936187574 2:110316279-110316301 ACAAAGGCAAAAAGGAAAAAAGG + Intergenic
936342862 2:111652845-111652867 GCAAAGTCAAAAAGCAAGACTGG + Intergenic
936356592 2:111757098-111757120 AGAAAGGAAGAAAGAAAGAAAGG + Intergenic
936838533 2:116740118-116740140 TCAAAGGCAGAAAGAAGGAATGG + Intergenic
936926571 2:117743012-117743034 GAAAAGGCAGAAAAGAAGAAAGG + Intergenic
936972615 2:118189417-118189439 TCAGAGGAAAAAAGTAAGAATGG + Intergenic
937461016 2:122086013-122086035 AGAAAGGAAGAAAGAAAGAAAGG - Intergenic
938800042 2:134753916-134753938 ACAAAGGAAGACAGTAAGAACGG + Intergenic
938800513 2:134759373-134759395 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
938800514 2:134759381-134759403 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
938800515 2:134759389-134759411 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
939022790 2:136979199-136979221 TTAAGGGCAGCAAGAAAGAAAGG - Intronic
939087132 2:137734631-137734653 TCAAAGGAAAACAGCAAGAGGGG - Intergenic
939577418 2:143912894-143912916 TCAAAGCCAGCAAGAGAGAAAGG + Intergenic
939652996 2:144787006-144787028 TTAAGGGCAGAAAGAGAGAAAGG + Intergenic
939692812 2:145286578-145286600 TCAAAGGCAGAGAAAATGAAGGG + Intergenic
939757582 2:146133180-146133202 TGAAAGAGAGAAAGAAAGAAAGG - Intergenic
939793627 2:146613715-146613737 ACAAAGGAAGAAAACAAGACAGG - Intergenic
939801452 2:146715942-146715964 TCAAAGGCTAAAAGCTAAAATGG + Intergenic
940099270 2:150015482-150015504 CCAAAGCCAGAAAGCAGGAAGGG - Intergenic
940124992 2:150312427-150312449 TTAAGGGCAGCAAGCGAGAAAGG + Intergenic
940393713 2:153163347-153163369 TTAAAGACCGAAACCAAGAATGG - Intergenic
940442954 2:153742089-153742111 TCAAAGGTACAAAGCATCAAAGG - Intergenic
940477605 2:154184469-154184491 ACAAAGGAAGACAGCAAGATAGG - Intronic
940575907 2:155503782-155503804 TTAAAGGCAGCAAGAGAGAAGGG + Intergenic
941034303 2:160550946-160550968 ACAAAGGAAGAAATAAAGAAAGG - Intergenic
941161959 2:162045789-162045811 TCAATGTTAGAAAGCCAGAAAGG + Intronic
941201288 2:162513513-162513535 TGAAAGGAAGAAAGGAAGGAAGG - Intronic
941477143 2:165963910-165963932 ACAAAGGAAGAAGGGAAGAAGGG - Intergenic
941497869 2:166229736-166229758 TGAAAAGCAGAAATAAAGAAAGG - Intronic
941550688 2:166912016-166912038 TTAAGGGCAGACAGAAAGAAAGG - Intronic
941861848 2:170290756-170290778 ACAAAGGAAGACAGGAAGAAAGG - Intronic
941946362 2:171102720-171102742 TCAAAGGCAAAAACCTTGAATGG - Intronic
942126101 2:172827301-172827323 TAACAAGCAGAAAACAAGAAAGG - Intronic
942144415 2:173012402-173012424 CCAAATGGAGAAAGTAAGAATGG - Intronic
942303519 2:174585066-174585088 GAAAAGGCAGAAAAAAAGAAAGG + Intronic
942526315 2:176856655-176856677 ATAAAGGAAGAAAGAAAGAAAGG - Intergenic
943003420 2:182359001-182359023 TAAAAGGAAGAAATGAAGAAAGG - Intronic
943073699 2:183171284-183171306 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
943416955 2:187619518-187619540 TCAAAGGAAGAAAACACGGATGG + Intergenic
943480190 2:188407697-188407719 TCAAAGGAAGACAGCAACAAAGG + Intronic
943480192 2:188407713-188407735 ACAAAGGAAGAAAGGAACAAAGG + Intronic
943643754 2:190386542-190386564 TAAAAGGAAGAAAGGAAGGAAGG + Intergenic
943798790 2:192031828-192031850 CCAAAGCCAGAAAGCAAGAAAGG - Intronic
943821841 2:192333321-192333343 GCAAAGGAAGAAAGGAAGGAAGG - Intergenic
943878102 2:193101164-193101186 ACAATGGCAGACAGCAAGAGAGG - Intergenic
944031736 2:195242495-195242517 TCAGAGGCTAAAAGCAAGTATGG + Intergenic
944199931 2:197095679-197095701 TCAAAGTCACAAAGCCAGTAAGG - Intronic
944224883 2:197339727-197339749 TCAAAGGCAGGAAGAAAGTGAGG + Intergenic
944648616 2:201805918-201805940 TGGAAGGAAGCAAGCAAGAAAGG + Intronic
944763312 2:202839773-202839795 ACAAAGGAAGAAGGCATGAAAGG - Intronic
944888716 2:204093793-204093815 TCCAAATCAGAAAGGAAGAAGGG - Intergenic
944963128 2:204899297-204899319 TGAAAGGAAGACAGCAAGGAAGG - Intronic
945149933 2:206779823-206779845 ACAAAGGAAGATAACAAGAAAGG - Intronic
945348674 2:208750896-208750918 TTAAGGGCAGAAAGAGAGAATGG - Intronic
945430412 2:209756773-209756795 TTAAAGGCAGCAAGAGAGAAGGG + Intergenic
945463807 2:210143543-210143565 ACAAAGGAAGACAGCAAGAGAGG - Intronic
945569730 2:211451211-211451233 TCAAATGCAAAATGCTAGAATGG + Intronic
945653048 2:212588853-212588875 AGAAAGGGAGAAAGGAAGAAAGG + Intergenic
945681081 2:212915394-212915416 GCAAAAGCAGAAAGAAAAAAAGG - Intergenic
945712707 2:213318957-213318979 TTAATTGCAGAAAGAAAGAAAGG - Intronic
945950130 2:216031395-216031417 AGAAAGGAAGAAAGGAAGAAAGG + Intronic
946188095 2:217992591-217992613 TCAGAGGCAGAAAGCCAGAGAGG + Intronic
946747847 2:222862881-222862903 TTGAAGGAAGAAAGGAAGAATGG + Intronic
947069214 2:226267825-226267847 TCAGAGGCAGAAAACAAGACAGG - Intergenic
947077044 2:226355932-226355954 AGAAAGGGAGAAAGGAAGAAAGG + Intergenic
947216344 2:227753631-227753653 AGAAAGGAAGAAAGAAAGAAAGG - Intergenic
947308648 2:228776051-228776073 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
947471422 2:230404543-230404565 TGGAAGGCAGACAGCAAGGAAGG + Intergenic
948267779 2:236648658-236648680 TAGAAGGCGGAAAGGAAGAAAGG + Intergenic
949054204 2:241916554-241916576 TTAAAGGCAGAGAGAGAGAAAGG + Intergenic
1168905474 20:1399974-1399996 TCACAGGAAGAATGAAAGAATGG - Intergenic
1169010845 20:2249023-2249045 AGAAAGGAAGAAAGAAAGAAAGG - Intergenic
1169082116 20:2803945-2803967 TTCATGACAGAAAGCAAGAAAGG + Intergenic
1169168686 20:3446155-3446177 GAATAGGCAGAAAGAAAGAATGG - Intergenic
1169268991 20:4184999-4185021 GGAAAGGCAGATGGCAAGAAGGG + Intronic
1170050616 20:12140455-12140477 ACAAAGGAAGATAGTAAGAAAGG - Intergenic
1170332686 20:15232079-15232101 AAAAAGGAAGAAAGGAAGAAAGG - Intronic
1170335789 20:15268685-15268707 TCAAAGCCAGTAAGGAAAAAGGG - Intronic
1170398407 20:15953138-15953160 TCATAGGCAGAAGCCAAGAAAGG + Intronic
1170777369 20:19388929-19388951 ACAAAGGAAGACAGCAAGATTGG - Intronic
1170810997 20:19674524-19674546 TTCAAGACAGAGAGCAAGAAGGG + Intronic
1170935971 20:20809921-20809943 TCTAAGGCAGAAATGAAGAAAGG - Intergenic
1171240029 20:23559823-23559845 ACAAAGGAAGAAAACAAGAGAGG - Intergenic
1171387382 20:24779462-24779484 ACAATGACAGAAAGCCAGAAGGG + Intergenic
1171474568 20:25398193-25398215 TCACAGGAAGAATGAAAGAATGG + Intergenic
1171777734 20:29385863-29385885 TAAAAGGAAGACAGGAAGAAAGG - Intergenic
1171819030 20:29816534-29816556 TAAAAGGAAGACAGGAAGAAAGG - Intergenic
1171898789 20:30836649-30836671 TAAAAGGAAGACAGGAAGAAAGG + Intergenic
1172245437 20:33442808-33442830 TCACAGGCAGAAGGCCAGCAAGG - Intronic
1173755087 20:45508683-45508705 AGAAAGGAAGAAAGGAAGAAGGG - Intergenic
1174166333 20:48586167-48586189 TTCAAGGCTGAAAACAAGAAAGG - Intergenic
1174169852 20:48609470-48609492 TCAATGTCACAAAGCAACAAAGG - Intergenic
1174311824 20:49662079-49662101 TCAGAAGCAGAGAGGAAGAAAGG - Intronic
1174487119 20:50868420-50868442 TCAAAAAAAGAAAGAAAGAAAGG - Intronic
1174705560 20:52652435-52652457 TCAAAGGCAGAAATGATGCAAGG + Intergenic
1174960663 20:55153670-55153692 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
1174960664 20:55153678-55153700 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
1175514004 20:59557123-59557145 TCAAAAAGAGAAAGAAAGAAAGG - Intergenic
1175666402 20:60863854-60863876 TCGAAGGAAGAAAGGAAGGAGGG + Intergenic
1176798117 21:13389752-13389774 TCAAAGGCAGATTGTCAGAACGG + Intergenic
1176925419 21:14743956-14743978 ACAAAGGAAGACAGCAAGATTGG + Intergenic
1177272626 21:18869506-18869528 TTAAAGGCAGCTAGAAAGAAAGG - Intergenic
1177603443 21:23346173-23346195 ACAAAGGAAGACAGCAAGCATGG + Intergenic
1177635767 21:23784937-23784959 AGAAAGGAAGAAAGAAAGAAAGG + Intergenic
1178224393 21:30699135-30699157 TCATAGGCAGAAGGGAAGGAAGG - Intergenic
1178384420 21:32137872-32137894 CTACAGGCAGAAAGCAAGGAAGG + Intergenic
1178436687 21:32566116-32566138 TTAAAGGCAGCAAGAAAGATGGG - Intergenic
1178909267 21:36661128-36661150 GAAAAGGAAGAAAGGAAGAAAGG + Intergenic
1179339748 21:40494102-40494124 ACAAAGGAAGACAGCAAGAGAGG + Intronic
1179357068 21:40670294-40670316 ACAGAGGCAGAAAGTTAGAACGG - Intronic
1179497304 21:41780838-41780860 GGAAAGGAAGAAAGAAAGAAAGG + Intergenic
1180323007 22:11341231-11341253 TAAAAGGAAGACAGGAAGAAAGG - Intergenic
1180517293 22:16157335-16157357 TCAAAGGCAGATTGTCAGAATGG - Intergenic
1180649421 22:17366574-17366596 TCAAAGGGAGAAGGGAAGAAGGG + Intronic
1181375578 22:22455204-22455226 ACAAAGGCAGAAAGAGAGAGAGG + Intergenic
1181377676 22:22473029-22473051 GCAAATGCAGAAATCCAGAAGGG - Intergenic
1182126091 22:27816846-27816868 GAAAAGGAAGAAAGGAAGAAGGG - Intergenic
1182193337 22:28487944-28487966 TTCAAGGCTAAAAGCAAGAAAGG - Intronic
1182552253 22:31106786-31106808 TCAAAGTCACATAGCAAGACAGG + Intronic
1183184413 22:36283943-36283965 TCAAAGGCAAGGAGCCAGAAGGG + Intronic
1183608794 22:38883581-38883603 ACAAAGGAAGAAAGGAAGGAAGG - Intergenic
1183610539 22:38900989-38901011 TTCAAGGCTGAAAGCAAGAAAGG - Intergenic
1183616020 22:38946108-38946130 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
1183616021 22:38946116-38946138 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
1184023908 22:41839528-41839550 TCCAAGGCAGAAAGGAAGCAGGG + Intronic
1184372427 22:44090900-44090922 TAAAAGGCAGAAAGGAAACAGGG - Intronic
1185237388 22:49722271-49722293 AGAAAGGAAGAAAGAAAGAAAGG + Intergenic
949677385 3:6471350-6471372 TCAAATGCATAAAGCAGGGATGG - Intergenic
949743375 3:7262076-7262098 TCAAAGGCAATAAGAGAGAAAGG - Intronic
949768237 3:7550437-7550459 AGAAAGGAAGAAAGGAAGAAAGG - Intronic
949860059 3:8497025-8497047 TCAGAGTCACAAAGCTAGAAAGG - Intergenic
950256158 3:11508006-11508028 TAAAAGGAAGAAGGGAAGAATGG + Intronic
950582123 3:13869452-13869474 AGAAAGACAGAAAGAAAGAAAGG + Intronic
950611516 3:14130040-14130062 ACAAAGGAAGGAAGGAAGAAAGG - Intronic
951171877 3:19552111-19552133 TAAAAGGAAGATAGGAAGAAAGG - Intergenic
951223965 3:20098962-20098984 GAAAAGGCAGTAAGCGAGAAAGG + Intronic
951836082 3:26984842-26984864 TAAAAGGCAGGAAGCAAGAGAGG - Intergenic
952008653 3:28873582-28873604 TGAAAGGAAGAAAGGAAGGAAGG - Intergenic
952296366 3:32066143-32066165 AGAAAGGAAGAAAGGAAGAAAGG + Intronic
952518059 3:34125576-34125598 CTAAAGTCAGAAAGCAAGATAGG - Intergenic
952541929 3:34375917-34375939 TATAAGCCAGAAAGCAAGAGTGG - Intergenic
952669737 3:35952319-35952341 TTAAAGGCAGCTAGAAAGAAGGG - Intergenic
952764163 3:36940816-36940838 TGAAAAACAAAAAGCAAGAAGGG + Intronic
952839635 3:37634154-37634176 ACAAAGGAAGATAGCAAGAAAGG + Intronic
953711827 3:45278460-45278482 ACAAAGGAAGACAGTAAGAAAGG + Intergenic
953803714 3:46049782-46049804 TCACAGGAAGAATGAAAGAATGG + Intergenic
953893055 3:46769511-46769533 ACAAAGGAAGACAGCAAGACAGG + Intronic
954067149 3:48115964-48115986 ACAAAGGCAAAAAGGAAAAAAGG - Intergenic
954189278 3:48944958-48944980 TAAAAAGCAGAAATGAAGAAAGG - Intronic
954527907 3:51289470-51289492 ACAAAGGAAGAAAGCAATACAGG + Intronic
954555462 3:51514015-51514037 TTAAAGGAAGGAAGGAAGAAAGG + Intergenic
955113002 3:55967860-55967882 AGAAAGGCAGAAAGGCAGAAAGG - Intronic
955113003 3:55967868-55967890 TGAAAGGCAGAAAGGCAGAAAGG - Intronic
955677666 3:61465925-61465947 AGAAAGGAAGAAAGAAAGAAAGG - Intergenic
956095969 3:65716544-65716566 TCAGAGTCAGGTAGCAAGAAAGG - Intronic
956643680 3:71436001-71436023 TAGAAGGAAGAAAGGAAGAAAGG + Intronic
957087465 3:75694901-75694923 TAAAAGGAAGACAGGAAGAAAGG + Intergenic
957268707 3:78001930-78001952 TCAAGGGCAGCCAGAAAGAAAGG - Intergenic
957281866 3:78161431-78161453 TCAAAAACAGGAAACAAGAAAGG - Intergenic
957389859 3:79550146-79550168 AGAAAGGAAGAAAGAAAGAAAGG + Intronic
957442767 3:80272068-80272090 AGAAAGGAAGAAAGAAAGAAGGG + Intergenic
957442771 3:80272096-80272118 TGAAAGGAAGAAAGGAAAAAAGG + Intergenic
957505185 3:81110883-81110905 TCAAAGGAAGACAGCAAGAGAGG + Intergenic
957521418 3:81323451-81323473 TAAAAGGAAGAAAGGAAGGAAGG + Intergenic
957570295 3:81938760-81938782 TGACAGGGAGAATGCAAGAAGGG + Intergenic
957925682 3:86807498-86807520 TAAAAGGAAGACAGGAAGAAAGG + Intergenic
958073252 3:88641702-88641724 TTAAAGGCAGAAAACTAGATAGG - Intergenic
958081263 3:88748633-88748655 TCAAGGGCAGCCAGAAAGAATGG + Intergenic
958504505 3:94957313-94957335 ACAAAGGAGGAAAGAAAGAAAGG - Intergenic
958613377 3:96457210-96457232 GCAAAGGAAGACAGGAAGAAGGG + Intergenic
958678711 3:97297415-97297437 TCAAAGGTAAAAATCAAGGAAGG - Intronic
958759440 3:98290366-98290388 TTAAAGGCAGACAGAAAGAAAGG - Intergenic
958828245 3:99058430-99058452 TCAAAGGATGAAAGAAAGAAAGG - Intergenic
958864915 3:99488700-99488722 ACAAAAGAAGACAGCAAGAAAGG + Intergenic
958933200 3:100229444-100229466 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
959243979 3:103839319-103839341 TACAAGGAAGAAAGAAAGAAAGG + Intergenic
959322929 3:104902134-104902156 TTAAAGGAAGAGGGCAAGAAAGG - Intergenic
959371510 3:105532758-105532780 GCCAAGACAGAAAACAAGAAAGG + Intronic
959572107 3:107895716-107895738 TCTAAGGCAGAAAGCAAACGAGG + Intergenic
959814064 3:110654446-110654468 AAAAAGGAAGACAGCAAGAAAGG + Intergenic
959823316 3:110763430-110763452 ACAAAGGAAGGCAGCAAGAAAGG - Intergenic
959898733 3:111635831-111635853 TCAAGGTCAGAAAGTAAGAAAGG + Intronic
960018193 3:112917104-112917126 CCACAGGAAGAAAGCAGGAAAGG + Intergenic
960356701 3:116662657-116662679 ACAAAGGCAGAAAGGAAAGAGGG + Intronic
960469388 3:118042398-118042420 ACAAAGGAAGAAAGCAAGAGAGG + Intergenic
960749033 3:120925725-120925747 ACAAAGGAAGACAGTAAGAAAGG - Intronic
960950755 3:122997066-122997088 TCACAAGAAAAAAGCAAGAAAGG - Intronic
961490375 3:127253187-127253209 TTCAAGGCCAAAAGCAAGAAAGG + Intergenic
961514400 3:127423694-127423716 TCAAAAGTAGAAAGGAAGGAGGG - Intergenic
961766953 3:129218909-129218931 GGAAAGGAAGAAAGAAAGAAAGG - Intergenic
962166132 3:133050301-133050323 TTAAAGAGAGAAAGAAAGAAAGG - Intronic
962587459 3:136856797-136856819 TGGAAGGCAGAAGGGAAGAAGGG + Intergenic
963056512 3:141190665-141190687 TGAAAGTCAGAAAACAAGAGAGG + Intergenic
963276377 3:143334521-143334543 TCAAAATCACAAAGCAAGTAAGG - Intronic
963330755 3:143912413-143912435 TAAAAGGAAGACAGGAAGAAAGG + Intergenic
963526376 3:146419775-146419797 ACAAAGGCAGAAAGTAAAAGAGG - Intronic
963530360 3:146467501-146467523 CCAAAGGCATAGAGCATGAAAGG + Intronic
963794286 3:149616283-149616305 TCATAGGCAGAAAGAAAGGGTGG - Intronic
963819052 3:149867854-149867876 ACAAAGGAAGACAGTAAGAAAGG - Intronic
963861662 3:150316719-150316741 CCAAAGGTAGGAAGGAAGAAAGG - Intergenic
963865279 3:150354078-150354100 TTAAAGGCTGAAATCGAGAATGG - Intergenic
963945755 3:151144341-151144363 TGAAAGGGAGAATCCAAGAAAGG + Intronic
963983322 3:151564449-151564471 TCAAAGAAAAAAAGAAAGAAAGG - Intergenic
964202519 3:154134179-154134201 AGAAAGGAAGAAAGAAAGAAAGG - Intronic
964252633 3:154736416-154736438 TCCAAGGTAGAAAAGAAGAAAGG + Intergenic
964255204 3:154767339-154767361 TCAGAGGAAGAAAGCAATTAAGG - Intergenic
964268078 3:154922397-154922419 CCAAAGGAAGAGAGCAAGGAGGG + Intergenic
964369639 3:155986330-155986352 TGAAAGCAAGAAAGCAAGGAAGG - Intergenic
964376809 3:156055954-156055976 TAAAAGGTAGAAAGCAAGCCTGG - Intronic
964439608 3:156693542-156693564 TCAAAGACAGAATAAAAGAAGGG - Intronic
965151995 3:164989367-164989389 AGAAAGGAAGAAAGAAAGAAAGG + Intronic
965268169 3:166575651-166575673 TCAAAGTCAACAATCAAGAAAGG - Intergenic
965800527 3:172488852-172488874 TCAAAGGAAGGAAGGAAGAAAGG - Intergenic
965911917 3:173788888-173788910 TCATAGCCAGTAAGAAAGAAAGG + Intronic
965974386 3:174604661-174604683 TGAAAGGAAGAAAGGAAGAAAGG - Intronic
966256628 3:177924594-177924616 TCAAAGGCAGTAAGCCACAATGG - Intergenic
966576977 3:181512865-181512887 AAAAAGGAAGAAAGGAAGAAAGG + Intergenic
966585112 3:181615126-181615148 AGAAAAGAAGAAAGCAAGAAAGG + Intergenic
966738159 3:183206896-183206918 AGAAAGACAGAAAGAAAGAAAGG + Intronic
966753789 3:183348856-183348878 CCAAAGACACAAAGCAAAAATGG + Intronic
966791450 3:183674357-183674379 TCAAAAAAAGAAAGAAAGAAAGG - Intronic
967479490 3:189957307-189957329 TGAAAGGCACAGAGCAAGAAAGG + Exonic
967491580 3:190097557-190097579 CCTGAGGCAGAAAGAAAGAAGGG - Intronic
967577636 3:191113826-191113848 ACAAAGGAAGACATCAAGAAAGG + Intergenic
967763207 3:193248495-193248517 GCAAAGGAAGCAAGCAAGAGAGG - Intronic
968089656 3:195892324-195892346 TGAGAGGCAGAAAGCAAGACTGG - Intronic
968930917 4:3578294-3578316 TGAAAGAAAGAAAGCATGAAAGG - Intronic
969592512 4:8130109-8130131 TCAAAGGCAGCCCCCAAGAAAGG + Intronic
969961428 4:10948385-10948407 TCAAAGTATGGAAGCAAGAATGG + Intergenic
970338296 4:15076639-15076661 ACAAAGGAAAACAGCAAGAAAGG + Intergenic
970468512 4:16352001-16352023 GCTAAAGCAGAAGGCAAGAATGG - Intergenic
970561104 4:17283141-17283163 TCGAATGCACAAAGGAAGAAGGG - Intergenic
970932467 4:21528774-21528796 AGAAAGGAAGAAAGGAAGAAAGG + Intronic
970932468 4:21528782-21528804 AGAAAGGAAGAAAGGAAGAAAGG + Intronic
971103254 4:23493595-23493617 TCAAGGGTAGAAAGAAAGAGAGG + Intergenic
971211332 4:24620137-24620159 ACAAAGGAAGATAGCAAGAGAGG - Intergenic
971510041 4:27413482-27413504 TCAAACAAAGAAAGGAAGAAGGG + Intergenic
972491936 4:39596092-39596114 TCAAAGAAAGAAAGAAAAAAAGG - Intronic
972685773 4:41351180-41351202 TTAAGGGCAGCCAGCAAGAAAGG + Intergenic
972801165 4:42477202-42477224 TCAAAAGCAGAAACTGAGAAAGG + Intronic
972928652 4:44043128-44043150 TAAAAGGAAGACAGGAAGAAAGG + Intergenic
973056193 4:45661685-45661707 ACAAGGGCAGAAATAAAGAATGG - Intergenic
973115820 4:46457439-46457461 ACAAAGGAAGACAGTAAGAAAGG + Intronic
973188120 4:47354959-47354981 ACAAAGGAAGAAAGAAAGAAAGG - Intronic
973198446 4:47472759-47472781 TCAAGGGCATAAAGCCACAAAGG + Intergenic
973255741 4:48111057-48111079 TCAAAGACAGATAGCAAAGACGG + Intronic
973877753 4:55237984-55238006 ACAAAGGAAGAATGCAAGAGAGG - Intergenic
974160994 4:58139028-58139050 TCCAGGGCAGACAGCAAGAGAGG + Intergenic
974279238 4:59769950-59769972 TCAGAGGTAAAAATCAAGAAAGG + Intergenic
974499938 4:62686153-62686175 TCAAAAGCAGAAAAAAAGCAGGG + Intergenic
974649504 4:64735630-64735652 ACAAACGCACAAAGCAAGGAAGG - Intergenic
974769898 4:66399218-66399240 TGAAAGGAAGACAGCAAGAAAGG - Intergenic
974826196 4:67133891-67133913 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
974846346 4:67354972-67354994 ACACAGGCAGGAAGCAAAAAGGG + Intergenic
974986244 4:69029317-69029339 TCAAATGCAAAAACCAATAAGGG + Intronic
975360504 4:73464130-73464152 ACAAAGGAAGACAGCAAGAGTGG + Intergenic
975404242 4:73970664-73970686 TCAAAGGCAGATAGAGAGAAAGG + Intergenic
975504144 4:75119520-75119542 TAAAAGGAAGAAAGGAAGGAAGG + Intergenic
975737520 4:77395864-77395886 TCACAGGAAGAATGAAAGAATGG + Intronic
975763317 4:77639820-77639842 ACAAAGGGAGAAAATAAGAAAGG - Intergenic
975847836 4:78543576-78543598 TGAAAGGCAGAAAGAAAGGGAGG - Intronic
975899286 4:79131425-79131447 ACAAAGGAAGACAGCAAGAGAGG + Intergenic
975926990 4:79468457-79468479 TCACAGGAAGGAAGCATGAATGG + Intergenic
976161435 4:82203786-82203808 ACAAAGGAAGACAGGAAGAAAGG + Intergenic
976174124 4:82335289-82335311 TCAAAGGGAGAAGGAAAGAGAGG - Intergenic
976239262 4:82936278-82936300 TGAAAGGCAAAAAGCAATAAAGG - Exonic
976358730 4:84151986-84152008 TCAAAGGCATAAATCTTGAAAGG + Intergenic
976466104 4:85370367-85370389 GAAAAGGCTGAAAGGAAGAATGG + Intergenic
976610439 4:87025157-87025179 GCATAGGCAGAATGCAGGAAGGG + Intronic
976649924 4:87423198-87423220 TCAAAATCAGAAGTCAAGAAGGG - Intronic
976783773 4:88792503-88792525 TTAAAGACAGAAAGCAGAAAGGG - Intronic
976896440 4:90117645-90117667 GCAAAGTCAGAAAGGAAGGAAGG + Intergenic
977289454 4:95148022-95148044 TCAAAGGAAGAAAACAATAATGG - Intronic
977341716 4:95766484-95766506 TCAAAGGAAGACAGGAATAAAGG + Intergenic
977773414 4:100887409-100887431 TAAAAGGAAGACAGGAAGAAAGG - Intergenic
977801302 4:101236177-101236199 GCAAAGACAGAAAGTAAAAAGGG + Intronic
978326799 4:107566831-107566853 ACAAAGGAAGAAAGCAAGAGAGG + Intergenic
978487949 4:109277402-109277424 TGAAAGACAGAAAGCAAGAGTGG + Intronic
978588985 4:110303652-110303674 CAAAACGCACAAAGCAAGAAAGG - Intergenic
978675292 4:111307284-111307306 ACAAAGGAAGACAGGAAGAAAGG - Intergenic
978797464 4:112722643-112722665 TCCAAAGCAGAAAGCAAGGTTGG + Intergenic
979749662 4:124263144-124263166 ACAGAGGAAGAAAGGAAGAAAGG - Intergenic
979828556 4:125270994-125271016 AAAAAGCCAGAGAGCAAGAAGGG - Intergenic
979916081 4:126435627-126435649 ACAGAGGAAGAAAGCAACAATGG + Intergenic
980268691 4:130554725-130554747 TAAAAGGAAGACAGGAAGAAAGG + Intergenic
980504095 4:133692261-133692283 TAAAAGGCAGCTAGAAAGAAGGG + Intergenic
980621150 4:135306168-135306190 TAAAATGCAGAAAACAAGGAAGG + Intergenic
981142502 4:141285241-141285263 TCAAAAGAAGAAATCCAGAAGGG + Intergenic
981156935 4:141448981-141449003 TAAAAGGAAGAAAACAAGAAAGG - Intergenic
981669546 4:147272256-147272278 ACAAAGGAAGACAGCAAGAAAGG - Intergenic
981798127 4:148622418-148622440 CCAAAGGAATAAAGCAAGAGAGG + Intergenic
981942547 4:150298784-150298806 TCAAAACCAGAATGCGAGAATGG + Intronic
981971795 4:150671794-150671816 ACAAGGGCAGCCAGCAAGAAAGG + Intronic
982133416 4:152250010-152250032 TCAAAGGTGTAAAGCAACAAAGG - Intergenic
982280047 4:153674616-153674638 ACAAAGGAAGACAGTAAGAAAGG - Intergenic
982286179 4:153738047-153738069 TCAAAAAAAGAAAGAAAGAAAGG - Intronic
982411773 4:155085829-155085851 TCAAAGGTAGGAAGAGAGAAGGG + Intergenic
982549892 4:156784492-156784514 TCGAAGTAAGAAAGGAAGAAAGG + Intronic
982872579 4:160601903-160601925 TGAAGGGCAGAAAACAAAAAAGG - Intergenic
983017447 4:162630806-162630828 TAAAAGGAAGACAGGAAGAAGGG + Intergenic
983102869 4:163646817-163646839 ACAAAGGAAGATAGCAAGAGAGG + Intronic
983607892 4:169610967-169610989 GAAAAAGCAGAAAGCAAAAATGG + Intronic
983636127 4:169899547-169899569 ACAAAAGCAGAAAGCAAGAGGGG + Intergenic
983655774 4:170082487-170082509 ACAAAGGAAGACAGTAAGAAAGG + Intronic
984025201 4:174535042-174535064 TAAAAAGAACAAAGCAAGAATGG + Intergenic
984106013 4:175546729-175546751 GCACAGGCAGGAAGCTAGAAGGG + Intergenic
984222472 4:176994737-176994759 AGAAAGACAGAAAGAAAGAAAGG - Intergenic
984511074 4:180679394-180679416 CCTAAAGCAGAAAGCAAGAGAGG + Intergenic
985062033 4:186089461-186089483 GGAAAGGAAGAAAGAAAGAAAGG + Intergenic
985158941 4:187024166-187024188 TCAAAGTCTGAAAGCAAGGGAGG - Intergenic
985219236 4:187685242-187685264 CCAAAGGAAGAAAGGAAGGAAGG - Intergenic
987540894 5:19253730-19253752 AGAAAGGAAGAAAGAAAGAAAGG + Intergenic
987602952 5:20095567-20095589 AGAAAGGAAGAAAGGAAGAAAGG + Intronic
987669871 5:20992350-20992372 TTAAAGGCAGATAGCAAAAAAGG + Intergenic
988007913 5:25442417-25442439 ACAAAGGAAGACAGCAAGACAGG + Intergenic
988142096 5:27256301-27256323 AAAAAGAGAGAAAGCAAGAAGGG + Intergenic
988229237 5:28452582-28452604 TCAAAGGCTTAAAGTAATAAAGG + Intergenic
988460369 5:31430831-31430853 TCAAAGGAAGAGGGCAAAAATGG + Intronic
988675247 5:33426748-33426770 TTAAAGGCAGCAAGAAATAAGGG - Intergenic
988834533 5:35018306-35018328 TTAAAGGCAGCAAGAGAGAAAGG + Intronic
989412251 5:41133593-41133615 TCAGTGGCATAAAACAAGAAAGG + Intergenic
989779376 5:45246003-45246025 TGAAAGGCAGCTAGAAAGAAGGG - Intergenic
990023893 5:51161639-51161661 TTAAAGGCAGCTAGTAAGAAAGG + Intergenic
990167965 5:53016493-53016515 TTAAAGGCAGCCAGAAAGAAGGG - Intronic
990544370 5:56807689-56807711 TAAAAGGCAGAAAAATAGAATGG - Intergenic
990566462 5:57034529-57034551 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
990932856 5:61112825-61112847 TAAAAGGGAGACAGGAAGAAAGG - Intronic
991238572 5:64428574-64428596 ACAAAGGAAGACAGTAAGAAAGG + Intergenic
991256199 5:64617854-64617876 TCAAAGGCTGAAAGTAAGAGTGG - Intergenic
991509949 5:67365456-67365478 TCAAAGCCAAAAAGCAGAAATGG + Intergenic
991622278 5:68557140-68557162 CAAAAGGAAGAAAGGAAGAAGGG + Intergenic
991898289 5:71428979-71429001 TGAAAGACAGAAAGAAAGAGAGG - Intergenic
991949407 5:71933149-71933171 TCAGAGGGAGCAAGCTAGAAGGG + Intergenic
992205094 5:74423391-74423413 ACAAAGAAAGAAAGAAAGAAGGG + Intergenic
992243881 5:74797528-74797550 GCAAAGGCACAAAGCTAGGAGGG - Intronic
992279066 5:75154659-75154681 AGAAAGGCAGGAGGCAAGAAAGG + Intronic
992456978 5:76924952-76924974 TCAGAGTCAGAAAGCAGGAGTGG + Intergenic
993018833 5:82566056-82566078 TTAAAGGCAGCTAGAAAGAAAGG + Intergenic
993267371 5:85743605-85743627 TAAAAGGAAGACAGGAAGAAAGG - Intergenic
993314425 5:86382686-86382708 TGGAAGGAAGAAAGGAAGAAAGG - Intergenic
993875721 5:93304467-93304489 TCAAAGAAAGAAAGAAAAAAGGG - Intergenic
994242603 5:97442691-97442713 TTAAAGGCAGCTAGAAAGAAAGG - Intergenic
994359042 5:98829132-98829154 TTAAAGGCAGCTAGGAAGAAAGG + Intergenic
994466705 5:100143637-100143659 TCAATGGCAGAAAGTAAGAGGGG - Intergenic
994642916 5:102432681-102432703 TCAAAGGCAGCTAGAGAGAAAGG - Intronic
994897222 5:105721658-105721680 TCAAAGCCCAAAAGCTAGAATGG - Intergenic
995249851 5:109980562-109980584 TGAAAGGAAGAAAGGAAGGAAGG - Intergenic
995549744 5:113269003-113269025 TCAAAGGAACAAAAGAAGAATGG + Intronic
995676392 5:114667451-114667473 CCCCAGCCAGAAAGCAAGAACGG + Intergenic
995896010 5:117011246-117011268 TTAAAGGCAGCTAGAAAGAAAGG - Intergenic
996018075 5:118563122-118563144 TATAGGGCAGAAAGCAAGTATGG + Intergenic
996028584 5:118679845-118679867 TCAAAAGCAGAAAGCACTGAAGG + Intergenic
996080112 5:119249541-119249563 GCAAGGGCAAAGAGCAAGAAAGG - Intergenic
996666824 5:126069291-126069313 TAAAAGGCAGACAGGAAGGAAGG + Intergenic
996781842 5:127195549-127195571 ACAAAGGAAGGCAGCAAGAAAGG + Intergenic
997215916 5:132110597-132110619 TCAAAGACAGAAAATAAGGAAGG + Intergenic
997664939 5:135623146-135623168 TCAAAGCAACAAACCAAGAAGGG - Intergenic
997729423 5:136156202-136156224 TCAAAGCCAGTAAGGAAGAGAGG + Intronic
997743787 5:136280586-136280608 TAAAAGGCAGACAGGAAGAGGGG + Intronic
998458347 5:142290994-142291016 TAAAAGGAAGGAAGGAAGAAAGG - Intergenic
998483424 5:142481602-142481624 TCAAAGGCAGATGCCAAAAAGGG - Intergenic
998641065 5:144011879-144011901 TCAAAGGCGGAAAGAAAGCTAGG - Intergenic
998755799 5:145378194-145378216 TTAAAGGCAGCTAGAAAGAAAGG - Intergenic
999559630 5:152786702-152786724 TAAAAGGGAGACAGGAAGAAAGG + Intergenic
999857835 5:155614463-155614485 TCAAGGGGGGAAAGAAAGAAGGG - Intergenic
1000008939 5:157213753-157213775 TCAAAGCCACAAACCTAGAAGGG + Intronic
1000113345 5:158130103-158130125 TCAAAGGCAGAAAGGCAGCAAGG - Intergenic
1000128580 5:158272301-158272323 TCAAAGGAAGAAAGGAAGGAAGG + Intergenic
1000249551 5:159481068-159481090 TCAGTGGCAGAAAGGAAGAAAGG + Intergenic
1000288597 5:159848848-159848870 TCAGAGCCAGAAAGCAAGACAGG - Intergenic
1000786785 5:165554805-165554827 AGAAAGGTAGAAAGCAAAAAAGG - Intergenic
1000793670 5:165638058-165638080 CCAAGGGCAAAGAGCAAGAAAGG + Intergenic
1000810273 5:165853172-165853194 TGGAAAGCAGAAAGCAAGTAGGG - Intergenic
1001172478 5:169433467-169433489 GCAAGGGCAGAAAGGAAGACAGG + Intergenic
1001240424 5:170065309-170065331 ACAAAGGAAGAAAGTAATAAAGG + Intronic
1001392438 5:171390161-171390183 TAAAAGGCTGAAATCAAGTAGGG - Intronic
1001678922 5:173541881-173541903 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
1001693307 5:173648913-173648935 ACAAAGGCAGAAAGGAAGCTGGG - Intergenic
1001896302 5:175384914-175384936 GGAAAGGAAGAAAGGAAGAAAGG + Intergenic
1002036449 5:176474209-176474231 CCAAAGGAAGAAGGCTAGAATGG - Intronic
1002304706 5:178276336-178276358 TTACAGCCAGAAAGCAAGACAGG - Intronic
1002467629 5:179415620-179415642 TGAAAAGCAGACAGCCAGAAGGG + Intergenic
1002621145 5:180489308-180489330 TCAAAAGCAGAAACCAAGGGTGG - Intergenic
1003265725 6:4563687-4563709 TCAAAGACAGCTAGCAAGGAAGG - Intergenic
1003420409 6:5952671-5952693 GCAATGACAGAAAGAAAGAAGGG - Intergenic
1003676107 6:8205931-8205953 TCAAAAAAAGAAAGGAAGAAAGG - Intergenic
1003984522 6:11421911-11421933 ACAAAGGAAGACAGCAAGACAGG + Intergenic
1004184519 6:13410621-13410643 AGAAAGGAAGAAAGAAAGAAAGG + Intronic
1004207400 6:13605054-13605076 TCAAAGGCAGAAACCAACCCTGG + Intronic
1004380268 6:15126780-15126802 AAAAAGGAAGAAAGAAAGAAAGG - Intergenic
1004382479 6:15144470-15144492 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
1004567264 6:16809458-16809480 TCAAAAGCAGAAAACAAAGATGG - Intergenic
1004740339 6:18454149-18454171 TCAAAGGCAGAAAAACAGAAAGG + Intronic
1004798224 6:19113599-19113621 ACAAAGGAAGAAAGCAAGAGAGG - Intergenic
1004845232 6:19634504-19634526 TCAAAGGAACAAAGGAAGAATGG - Intergenic
1004859969 6:19793868-19793890 TCAAAGGAAGGAAAGAAGAAAGG + Intergenic
1004921987 6:20384360-20384382 TCAAAAGAAGAAAGAAAGGAAGG + Intergenic
1005171618 6:22992188-22992210 TGAAAAGCAGAAAGGAAGTATGG - Intergenic
1005257089 6:24014739-24014761 CCAAACACAGAAAGCATGAAAGG + Intergenic
1005762097 6:28976854-28976876 AGAAAGGAAGAAAGAAAGAAAGG - Intergenic
1005914875 6:30343227-30343249 TCCAAGCCAGAAAGGAAAAAAGG + Exonic
1005932958 6:30497521-30497543 AGAAAGGAAGAAAGAAAGAAAGG + Intergenic
1006619524 6:35353549-35353571 TCAAAAATAAAAAGCAAGAAAGG + Intronic
1006965335 6:37977924-37977946 AGAAAGGAAGAAAGGAAGAACGG - Intronic
1006965336 6:37977932-37977954 AGAAAGGAAGAAAGGAAGAAAGG - Intronic
1006975207 6:38093989-38094011 GCAGAGGCAGAAACCCAGAAGGG + Intronic
1007207472 6:40164350-40164372 AGAAAGACAGAAAGAAAGAAAGG + Intergenic
1007376799 6:41462507-41462529 TCAATGGAAAACAGCAAGAAAGG + Intergenic
1007833118 6:44653984-44654006 TCAAAGAGAGAAAGAAAGAAAGG - Intergenic
1007925910 6:45649568-45649590 TCAAAGGAAGAAAGGAAGGAAGG - Intronic
1007984246 6:46191436-46191458 CGTAAGGCAGAAAGCAGGAAAGG - Intergenic
1007988218 6:46229178-46229200 TTAAGGGCAGCAAGAAAGAAAGG - Intronic
1008001624 6:46366203-46366225 AAAGAGGAAGAAAGCAAGAAAGG - Intronic
1008208304 6:48689162-48689184 TTAAAGGCAGCTAGAAAGAAAGG + Intergenic
1008314839 6:50026910-50026932 TAAAAGGAAGAGAGGAAGAAAGG + Intergenic
1008326851 6:50192741-50192763 AGAAAGGCAGAAAGGCAGAAAGG + Intergenic
1008751135 6:54735664-54735686 TTAAAGGCAGCAAGAGAGAAGGG - Intergenic
1008830043 6:55747785-55747807 GTAAAGGCAGAAAGAAAGGAGGG - Intergenic
1008886787 6:56439962-56439984 TTAAAGGAAGAAAAAAAGAATGG + Intergenic
1008917599 6:56806398-56806420 GCAAAAGCAGAAAGCAATATTGG + Intronic
1009467690 6:63992688-63992710 ACAAAGGAAGAAAGCAAGAAAGG + Intronic
1009491302 6:64295333-64295355 AGAAAGGAAGAAAGGAAGAAAGG + Intronic
1009611256 6:65944218-65944240 TAAAAGGAAGAAAGAATGAAAGG - Intergenic
1009659137 6:66587081-66587103 ACAAAGGGAGAGAGAAAGAAAGG - Intergenic
1009689694 6:67013028-67013050 AAAAAGGAAGAAAGAAAGAAAGG - Intergenic
1010279225 6:74004692-74004714 TCAGAGAGAGAATGCAAGAAAGG + Intergenic
1010296567 6:74205055-74205077 ACAAAGGAAGAAAACAAGAGAGG - Intergenic
1010358052 6:74957955-74957977 TAAAAGGAAGAATGCAACAATGG + Intergenic
1010394931 6:75380200-75380222 TAAAAGGCAAAAAAAAAGAAAGG + Intronic
1010488474 6:76445731-76445753 ACAAAGGAAGACAGCAAGAAAGG - Intergenic
1010530361 6:76960571-76960593 TTAAAGGCAGCCAGAAAGAAAGG + Intergenic
1010716669 6:79238298-79238320 ACAGAGGGAGAAAGGAAGAAAGG + Intergenic
1010782999 6:79966868-79966890 TTAAAGGCAGCCAGCAAGAAAGG + Intergenic
1011028884 6:82899384-82899406 TAAAAGGTAGAAAGAAAAAAAGG + Intronic
1011137229 6:84113985-84114007 TTAAAGGCAGCAAGAGAGAAAGG - Intergenic
1011225730 6:85103818-85103840 AGAAAGGAAGAAAGAAAGAAAGG + Intergenic
1011520714 6:88201799-88201821 TAAAAGGAAGACAGGAAGAAAGG + Intergenic
1011602143 6:89069815-89069837 AAAAAGGAAGAAAGGAAGAAAGG + Intergenic
1011706818 6:90008874-90008896 ACAAAGAAAGAAAGAAAGAAAGG + Intronic
1011788225 6:90869469-90869491 CCAAAAGAAGAAAGAAAGAAAGG - Intergenic
1011844524 6:91546889-91546911 TAAAAGGCAAAAATGAAGAATGG + Intergenic
1011855757 6:91688513-91688535 TGGAAGGAAGAAAGCAAGAAAGG - Intergenic
1011855764 6:91688572-91688594 TCATAAGTAGAAAGCAAGGAGGG - Intergenic
1012474917 6:99607569-99607591 TGAAGGGCAGAAGGGAAGAAAGG - Intronic
1012795562 6:103756084-103756106 GCAAAGGCAGACAGCAAGAGAGG + Intergenic
1013200014 6:107885175-107885197 AGAAAGGAAGAAAGAAAGAAAGG + Intronic
1013615131 6:111835786-111835808 ACAAAGGCAAAAAGGAAAAAAGG + Intronic
1013648118 6:112165399-112165421 CCAAAGGCACACAGCAAGGATGG - Intronic
1013931224 6:115535806-115535828 TCAAAGGCAAAAATCCACAATGG + Intergenic
1014034512 6:116749912-116749934 ACAAAGGCAGAATCCCAGAAAGG - Intergenic
1014052279 6:116968761-116968783 TCAAAGGCAGCAAGTAGAAAAGG + Intergenic
1014132291 6:117847926-117847948 TTAAAGGCAGCTAGAAAGAAGGG + Intergenic
1014297107 6:119632318-119632340 AAAAATGCATAAAGCAAGAATGG + Intergenic
1014357456 6:120431283-120431305 ACATAGGAAGAAAGAAAGAAAGG + Intergenic
1014551684 6:122796182-122796204 TCAAAGACAAAAGGCAATAATGG + Intronic
1014654018 6:124076541-124076563 TCTAAAGCAGAGAGCAAGACAGG - Intronic
1014823595 6:126021985-126022007 TTAAAGGTCCAAAGCAAGAATGG - Intronic
1014859920 6:126453294-126453316 TTAAAGGCAGATAGAGAGAAGGG + Intergenic
1014975967 6:127884520-127884542 TGAAAGGCAGTGAGCAAGAGGGG - Intronic
1015029118 6:128572873-128572895 ACAAAGAAAGAAAGAAAGAAAGG - Intergenic
1015129192 6:129790955-129790977 CCAGAGGCTGAAGGCAAGAAGGG + Intergenic
1015229082 6:130893372-130893394 TTAAAGGCAAAAGGGAAGAAGGG + Intronic
1015278809 6:131410228-131410250 AGGAAGACAGAAAGCAAGAAAGG - Intergenic
1015368404 6:132423934-132423956 TTAAGGGCAGACAGAAAGAAAGG - Intergenic
1015790765 6:136962291-136962313 TAAAAGAAAGAAAGAAAGAAAGG + Intergenic
1015990832 6:138940772-138940794 GAAAAGGAAGAAAGAAAGAAAGG + Intronic
1016063640 6:139656066-139656088 AGAGAGGCAGAAAGGAAGAAAGG - Intergenic
1016086797 6:139924647-139924669 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
1016086798 6:139924655-139924677 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
1016086799 6:139924663-139924685 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
1016107918 6:140185811-140185833 TTAAAGGCAGGTAGAAAGAAGGG + Intergenic
1016230025 6:141791588-141791610 TAAAAGGAAGACAGGAAGAAAGG + Intergenic
1016429998 6:143973458-143973480 TCAGAGGGAGAAAACAAGCACGG + Intronic
1016432084 6:143996422-143996444 ACAAAGAAAGAAAGGAAGAATGG - Intronic
1016628360 6:146198941-146198963 ACAAATGCAGAAAGTAAGAATGG - Intronic
1016761096 6:147738479-147738501 TTCAAGGTTGAAAGCAAGAAAGG + Intergenic
1017055021 6:150429071-150429093 ACTAAGGGAGAAAGCAACAAAGG - Intergenic
1017214197 6:151890961-151890983 ACAAAGGAAGACAGCAAGATAGG - Intronic
1017944247 6:159080695-159080717 GCACAGACAGAAAGAAAGAAAGG - Intergenic
1017947437 6:159107103-159107125 TAAAATGCACAAAGCAACAAAGG - Intergenic
1018132762 6:160748395-160748417 AGAAAGGAAGAAAGAAAGAAAGG + Intronic
1018230625 6:161671651-161671673 GCAAAGTCATAAAGCAAGCATGG + Intronic
1018386673 6:163310616-163310638 GCAAAGACAGAAAGGAAGGACGG - Intronic
1019234377 6:170597443-170597465 TCAAATAAAGAAAGGAAGAAAGG + Intergenic
1019234378 6:170597451-170597473 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
1019987938 7:4671744-4671766 GAACAGGCAGAAAGCAAGACTGG + Intergenic
1020538436 7:9430039-9430061 TCAAAGGGAAAAATCAAGGAAGG - Intergenic
1020574620 7:9910853-9910875 TAAAAGGAAGAAAGAAAAAAAGG - Intergenic
1020796207 7:12681369-12681391 TTCAAGGCTAAAAGCAAGAAAGG - Intergenic
1020955320 7:14733772-14733794 AGAAAGGAAGAAAGAAAGAAGGG + Intronic
1020966464 7:14876011-14876033 TCAAAGGCAGAAATGTAGACAGG - Intronic
1021251798 7:18337243-18337265 TGACAGGAAGAAAGGAAGAAAGG - Intronic
1021277994 7:18679515-18679537 AGAAAGGAAGAAAGAAAGAAAGG - Intronic
1022173859 7:27854777-27854799 TTAAAGGCAGACAGAGAGAAAGG - Intronic
1022279632 7:28893902-28893924 GCAAATGCAGAAAGCAAAATGGG + Intergenic
1022509134 7:30924004-30924026 CCAAAGGCACAAAGCAATTACGG - Exonic
1022604360 7:31794444-31794466 TGAAAGAGAGAAAGCAACAAGGG - Intronic
1022877952 7:34554283-34554305 TTAAAGTCAGATAGAAAGAAAGG + Intergenic
1022885579 7:34639952-34639974 TCCAAATCAGAAAGCAAGGATGG - Intergenic
1023091727 7:36624184-36624206 TGAAATGCACAAAGCAAGGAAGG - Intronic
1023319853 7:38983355-38983377 ACAAAAGCAGAAAGGAAGAAAGG - Intronic
1023354171 7:39350596-39350618 TGAAAGGCAGAAAGCAAAAATGG + Intronic
1023973899 7:45013048-45013070 ACAAAGGAAGAAAGCACAAAGGG - Intronic
1024149863 7:46559997-46560019 TAAAGGGGAGAAAGGAAGAATGG + Intergenic
1024361303 7:48471806-48471828 CCAAAGGCAGAAGGCAATGAAGG - Intronic
1024895069 7:54249458-54249480 TAAAATGAAGAAAGTAAGAAGGG + Intergenic
1025002076 7:55324900-55324922 TGAAAGGAAGAGAGGAAGAAAGG + Intergenic
1025888472 7:65621923-65621945 TCAAGGGCAGGAACCAGGAAAGG + Intergenic
1026114024 7:67481198-67481220 AAAAAGGAAGAAAGAAAGAAAGG - Intergenic
1026144417 7:67734108-67734130 AGAAAGGAAGAAAGAAAGAAAGG - Intergenic
1026284216 7:68948750-68948772 ACAAAGAAAGAAAGAAAGAAAGG - Intergenic
1026613770 7:71883916-71883938 TCAAAGAAAGAAAGGAAGGAAGG - Intronic
1027084713 7:75255079-75255101 TGAAAGAAAGAAAGAAAGAAAGG - Intergenic
1027279389 7:76594984-76595006 TTAAAGGCAGCTAGAAAGAAAGG + Intergenic
1027506061 7:79018135-79018157 TCAAAGGCAGCTAGAAAGAAGGG + Intronic
1027798516 7:82723108-82723130 TCAAAGGCAGCAAGGCAGAGTGG - Intergenic
1027845985 7:83375681-83375703 TCAGATGCACAAAGCTAGAATGG + Intronic
1028104488 7:86861077-86861099 TCAAAGGCAGCATGCCTGAATGG + Intronic
1028543350 7:91969988-91970010 TCAAAGAAAGACAGTAAGAAAGG - Intronic
1028645460 7:93091398-93091420 ACAAAGGAAGACAGGAAGAAAGG - Intergenic
1028693727 7:93683734-93683756 TCAAAGCCAGAAATCAATAATGG + Intronic
1028800264 7:94955889-94955911 CCAAACACAGAAAGCAAGACAGG - Intronic
1028858040 7:95614267-95614289 TTAAAGGCAGCAAGAGAGAAAGG + Intergenic
1028899601 7:96082320-96082342 GAAAAGGAAGAAAGGAAGAAAGG - Intronic
1029923843 7:104295123-104295145 TCAAAGGCAGAGAGAATGTAAGG - Intergenic
1030109019 7:106010587-106010609 GCAAAGTCTGACAGCAAGAATGG - Intronic
1030427291 7:109394996-109395018 TGAAAGGCAAAATGCAATAATGG + Intergenic
1030809124 7:113954201-113954223 TTAAAGGCAGACAGAAAGAAAGG - Intronic
1030881999 7:114891512-114891534 TCAAATGCAGAATGCAGGTATGG + Intergenic
1030919596 7:115365611-115365633 ACAAAGGAAGATAGCAAGAGAGG + Intergenic
1031308403 7:120163177-120163199 TGAAAGGGAGCAAGAAAGAAAGG - Intergenic
1031853970 7:126900039-126900061 TCAAGGGCAGGAACCAGGAAAGG - Intronic
1032183996 7:129707515-129707537 TCAAATACATAGAGCAAGAAAGG - Intronic
1032582755 7:133118358-133118380 TCAGAGGGAGAAGGAAAGAATGG - Intergenic
1032867941 7:135947354-135947376 TGAAAGACAGAAAACAAGCAGGG - Intronic
1033068343 7:138177599-138177621 AGAAAGGAAGAAAGAAAGAAAGG + Intergenic
1033302221 7:140196671-140196693 TCAAAGTAAGAAAGCAAAAGAGG - Intergenic
1033489005 7:141823046-141823068 TAAAAGGAAGAAAGGAAGGAAGG - Intergenic
1033683155 7:143616265-143616287 TCAAAGGCAGAAAGAGAAAAAGG + Intergenic
1033701457 7:143841373-143841395 TCAAAGGCAGAAAGAGAAAAAGG - Intergenic
1033720342 7:144052134-144052156 GCAAAGGAAGAAAGCATCAAGGG + Intergenic
1033977469 7:147119702-147119724 ACAAAGGGAGAAAGGAAGGAAGG + Intronic
1034013673 7:147558740-147558762 TCAAAGAAAGGAAGGAAGAAAGG - Intronic
1034282934 7:149866150-149866172 TCAAAGGCAGAAAGCAAGAAAGG - Exonic
1034611243 7:152371440-152371462 ACAAAGGAAGACAGCAAGAGAGG + Intronic
1034951960 7:155304370-155304392 TCAAAGCAAGAAAGCAATGATGG - Intronic
1035150709 7:156869568-156869590 CCAAAGGTAGACAGCAAGAAAGG + Intronic
1035810948 8:2490595-2490617 ATAAAGGCAGGAAGAAAGAAAGG - Intergenic
1035896348 8:3407028-3407050 TAGAAGGAAGAAAGGAAGAATGG + Intronic
1036435665 8:8730766-8730788 AAAAAGGAAGAAAGAAAGAAAGG + Intergenic
1037057010 8:14455567-14455589 TCCAGGTCAGAAAGCAAGAATGG - Intronic
1037255700 8:16950168-16950190 TAAAAGGAAGACAGGAAGAAAGG + Intergenic
1037282638 8:17260136-17260158 ACAAAGGAAGATAGTAAGAAAGG - Intronic
1037389341 8:18376977-18376999 ACAAAGGAAGAAGGCAAGAAAGG + Intergenic
1037541667 8:19878238-19878260 TCAAAGGAAGAAAGAATGAAAGG + Intergenic
1038081971 8:24148622-24148644 ACAAAGGAAGATAGCAAGAGAGG - Intergenic
1038134782 8:24773508-24773530 TCAATGGCATAAAACAACAAAGG - Intergenic
1038137862 8:24808962-24808984 ACAAAGGAAGACAGCAAGAGAGG + Intergenic
1038151666 8:24946811-24946833 TCAAGGGCAAATAGCAAGAAGGG - Intergenic
1038460791 8:27714917-27714939 TCAAAGAAAGAAGGAAAGAAAGG - Intergenic
1038861789 8:31396023-31396045 TCAAAGTTATAAACCAAGAAGGG + Intergenic
1038864573 8:31425669-31425691 TGAAAGGCCTAGAGCAAGAAAGG - Intergenic
1039195105 8:35022327-35022349 TGAAAGAAAGAAAGCTAGAAGGG - Intergenic
1039217503 8:35288910-35288932 ACAAAGGAAGACAGCAGGAAAGG + Intronic
1039222814 8:35354271-35354293 TCAAAAGAACAAAGCAAGAGAGG - Intronic
1039267773 8:35844504-35844526 ACAAAGAAAGACAGCAAGAATGG + Intergenic
1039347324 8:36721806-36721828 TGAGAGGAAGAAAGCAGGAAGGG - Intergenic
1039625629 8:39049149-39049171 ACAAAGGAAAACAGCAAGAAAGG - Intronic
1039765793 8:40626436-40626458 TTAAAGGAAGAAACCAATAAAGG + Intronic
1039872274 8:41556541-41556563 TAAAAGTCAGGAAGAAAGAATGG - Intergenic
1039993264 8:42508162-42508184 TCAAAAAAAGAAAGAAAGAAAGG + Intronic
1041029676 8:53724177-53724199 TCAAACTCTGAAAGGAAGAAGGG + Intronic
1041321350 8:56617169-56617191 TCAAGTGCAGAAAGGAAAAAGGG - Intergenic
1041937550 8:63350771-63350793 GCAAAGGCAGGAAGCAGGGAGGG + Intergenic
1042013327 8:64275915-64275937 TCAGAGGAAGGAAGGAAGAAGGG + Intergenic
1042108480 8:65354494-65354516 TTAAAGGCAGCTAGCAAAAAAGG - Intergenic
1042387479 8:68194361-68194383 TCAAAGGAATAAAGGAAGATAGG + Intronic
1042489705 8:69382894-69382916 TCAAAGGCAGCCAGAGAGAAAGG + Intergenic
1042750944 8:72156847-72156869 TCAATGGCATAAAGTAAGAGGGG - Intergenic
1042752064 8:72169086-72169108 TCAAAGGCAGCTAGAGAGAAAGG - Intergenic
1042839858 8:73112571-73112593 TGAAAGAAAGAAAGAAAGAAAGG - Intronic
1042898660 8:73698217-73698239 TAAAAGGAAGACAGGAAGAAAGG + Intronic
1042945375 8:74148886-74148908 TCAAAGACAGAAGGAATGAAAGG - Intergenic
1042976537 8:74476690-74476712 TTAAAGGCAGCAAGAGAGAAAGG - Intronic
1043530269 8:81142325-81142347 AGAAAGCAAGAAAGCAAGAAAGG - Intergenic
1043739948 8:83798932-83798954 TAAAAGGAAGATAGGAAGAAAGG - Intergenic
1043779174 8:84310544-84310566 TTAAAGGCAGGAAGGAAGGAAGG + Intronic
1043834111 8:85026948-85026970 TCAAAGGAAGGAAGGAGGAAGGG + Intergenic
1044126083 8:88459099-88459121 TTAAAGGCAGCTAGAAAGAAAGG + Intergenic
1044450812 8:92334283-92334305 TTAAAGGCAGCCAGAAAGAAAGG - Intergenic
1044850454 8:96422170-96422192 TAAAAGGCAAAGAGCAGGAATGG + Intergenic
1045026482 8:98091920-98091942 AGAAAGGAAGAAAGAAAGAAAGG - Intronic
1045805919 8:106161578-106161600 TTAAAGGCAGCAAGAAAGATAGG + Intergenic
1046444813 8:114304310-114304332 TCAAAGGCACATAGAAACAAAGG - Intergenic
1046543066 8:115611646-115611668 TCAAAGGCAGTGATCATGAAAGG + Intronic
1046588456 8:116176416-116176438 AGAAAGGAAGAAAGAAAGAAAGG + Intergenic
1046756049 8:117973916-117973938 AGAAAGGCAGAAAGCAAGGAAGG + Intronic
1046772120 8:118126688-118126710 TTAAAAGCAGGAAGCAGGAAAGG - Intergenic
1046851135 8:118974136-118974158 AAAGAGGCAGAAAGCAAGGAAGG - Intergenic
1047066707 8:121292045-121292067 GAAAAGGAAGAAAGGAAGAAAGG - Intergenic
1047523964 8:125616623-125616645 GCAGAGGCAGAAAACCAGAAAGG + Intergenic
1047762815 8:127966884-127966906 TCAAGGGAAGAAAAAAAGAAAGG - Intergenic
1047806104 8:128361648-128361670 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
1047808729 8:128384871-128384893 TCCAAAAAAGAAAGCAAGAAGGG - Intergenic
1048191144 8:132290496-132290518 TCAAATGAATGAAGCAAGAATGG + Intronic
1048242111 8:132752798-132752820 AGAAAGGAAGAAAGGAAGAAGGG + Intronic
1048271134 8:133029023-133029045 GCAAAGTCAGAAAGGAAGAATGG + Intronic
1048520300 8:135147763-135147785 TCAGAGACAGAGAGAAAGAAAGG - Intergenic
1048555728 8:135473930-135473952 TCAGCAGCAGCAAGCAAGAATGG - Intronic
1048770077 8:137885828-137885850 TGGAAGGAGGAAAGCAAGAATGG + Intergenic
1048794608 8:138138237-138138259 ACAGAGGCAGAAAGTAGGAAAGG + Intronic
1048876578 8:138841128-138841150 TCAAAGGATGAAAACATGAATGG - Intronic
1049871589 8:144982969-144982991 GAAAAGGCAGAAAGAAAAAAAGG + Intergenic
1050158311 9:2691270-2691292 TCAACGGCAGCAAGGGAGAAGGG + Intergenic
1050563195 9:6855671-6855693 CCAAAGGGAGAAAGAAGGAATGG - Intronic
1050841661 9:10157539-10157561 TTAAAGGCAGTAAGAGAGAAAGG - Intronic
1051122982 9:13772659-13772681 GCAAAGCCCCAAAGCAAGAATGG - Intergenic
1051134426 9:13902278-13902300 AAAAAGACAGAAAGGAAGAAAGG + Intergenic
1051520170 9:17978374-17978396 ACAAAGGAAGACAGCAAAAAAGG - Intergenic
1051773148 9:20601711-20601733 TCAAAGGAACAAAAAAAGAAAGG - Intronic
1051852564 9:21526785-21526807 TTAAAGGCAGCTAGAAAGAAAGG - Intergenic
1051906456 9:22100581-22100603 TAAAAGTCAAAAAGCAAAAACGG - Intergenic
1052129303 9:24822214-24822236 TCAAAGGCAGTATGGCAGAAGGG + Intergenic
1052780213 9:32774791-32774813 ACAAGGGAAGACAGCAAGAAAGG - Intergenic
1053107897 9:35428431-35428453 ACAAAGGAAGACAGCAAGAGAGG + Intergenic
1053107928 9:35428862-35428884 CCAAAGGAAGACAGCAAGAGAGG + Intergenic
1053705027 9:40743963-40743985 TCAAAGGCAGATTGTCAGAATGG + Intergenic
1054415105 9:64867570-64867592 TCAAAGGCAGATTGTCAGAATGG + Intergenic
1054459200 9:65453620-65453642 TGAAAGAAAGAAAGCATGAATGG + Intergenic
1054755443 9:68952854-68952876 TAATAGGAAGAAAGAAAGAAAGG - Intronic
1055104991 9:72502991-72503013 AAAAAGACAGAAAGAAAGAAAGG - Intergenic
1055151576 9:73006818-73006840 CCAAAGGAAAAAAGCAAGTACGG - Intronic
1055366381 9:75548857-75548879 ACAAAGGAAGAAAGGAAGGAAGG - Intergenic
1055452557 9:76443896-76443918 AGAAAGGAAGAAAGGAAGAAAGG + Intronic
1055452558 9:76443904-76443926 AGAAAGGAAGAAAGGAAGAAAGG + Intronic
1055452559 9:76443912-76443934 AGAAAGGAAGAAAGGAAGAAAGG + Intronic
1055511627 9:77000887-77000909 TCAAAAAAAGAAAGAAAGAAAGG - Intergenic
1055515716 9:77031164-77031186 TCAAAAGAAGAAAGGAAGGAAGG - Intergenic
1055770328 9:79710059-79710081 TCAAAGGCTGAAAGGAAATAAGG + Intronic
1056185522 9:84130533-84130555 CCAATGGCAGAAAGCCATAAAGG + Intergenic
1056423198 9:86450001-86450023 ACAAAGGAAGACAGCAAGAAAGG + Intergenic
1056424450 9:86463109-86463131 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
1056690128 9:88801123-88801145 TCAAAAGCATAAACCAAGAAAGG + Intergenic
1058016533 9:100038552-100038574 TAAAAGGAAGACAGCAAGGAAGG + Intronic
1058221420 9:102308533-102308555 TTAAAGGCAGCTAGAAAGAAAGG - Intergenic
1058540717 9:106009749-106009771 GCAAAGGGAGAGAGAAAGAAAGG - Intergenic
1058689930 9:107511226-107511248 CCAAAGGCAGAAAGATACAATGG - Intergenic
1058814913 9:108674214-108674236 GCAAATGCACAGAGCAAGAAGGG + Intergenic
1058839230 9:108890165-108890187 TCTAAAGCAGAAAGGAACAATGG + Intronic
1059053964 9:110959318-110959340 GGAAAGGAAGAAAGGAAGAAGGG + Intronic
1059524439 9:114977276-114977298 TTCAAGGCTGAAAGCAAGATAGG + Intergenic
1059735262 9:117094090-117094112 TCAAAGGAAGAAAGAAAGGAGGG + Intronic
1059970782 9:119666103-119666125 ACAAAGGAAGAAAGGAAGGAAGG - Intergenic
1060876859 9:127090028-127090050 TCTGAGGCAGAAAGCAAGAGGGG + Intronic
1060902822 9:127276013-127276035 TCAAAAGGAGAAAGTAAGAAGGG - Intronic
1061028334 9:128064972-128064994 TAAAAGAAAGAAAGAAAGAAAGG + Intronic
1061511698 9:131065352-131065374 TCAAACCCAGAAAGCAGGACAGG + Intronic
1061819120 9:133214754-133214776 TTCAAGGCTGAAAGCAAGAAAGG + Intergenic
1062241565 9:135543433-135543455 TTCAAGGCTGAAAGCAAGAAAGG - Intergenic
1203370691 Un_KI270442v1:301801-301823 TAAAAGGAAGACAGGAAGAAAGG - Intergenic
1185486844 X:488114-488136 ACAAAGACAGAAAGGAAGAAAGG + Intergenic
1185519894 X:730599-730621 AGAAAGGAAGAAAGGAAGAAAGG - Intergenic
1185637478 X:1563536-1563558 AGAAAGGAAGAAAGAAAGAAAGG + Intergenic
1185676540 X:1853865-1853887 AGGAAGGAAGAAAGCAAGAAAGG + Intergenic
1185820258 X:3196135-3196157 AGGAAGGAAGAAAGCAAGAAAGG + Intergenic
1185872083 X:3673000-3673022 AGAAATGCAGAAAGGAAGAAAGG + Intronic
1186095064 X:6091887-6091909 ACAAAGGAAGAAAGGAAGGAAGG - Intronic
1186148361 X:6647993-6648015 AGAAAGGAAGAAAGAAAGAAAGG + Intergenic
1186164480 X:6811911-6811933 TCAGATGTAGAAAGAAAGAAGGG + Intergenic
1186384770 X:9098951-9098973 AGAAAGGGAGAAAGAAAGAAAGG - Intronic
1186553614 X:10533306-10533328 TCCAAGAAAGAAAGAAAGAAAGG + Intronic
1186619284 X:11220365-11220387 TTAAAGGCAGCCAGAAAGAAAGG + Intronic
1186825692 X:13337879-13337901 TCACATGCTGAAAGAAAGAATGG - Intergenic
1186921317 X:14284049-14284071 TCAGAGGCATAAAGCAACGAAGG + Intergenic
1187249943 X:17588175-17588197 TCAAAAGCAGTAAGCAAGTCAGG + Intronic
1187402782 X:18976482-18976504 TAAATGACAGAAAGCAAAAACGG - Intronic
1187435421 X:19263950-19263972 ACAAAGGAAGACAGCAAGAAAGG - Intergenic
1187621292 X:21058929-21058951 ACAAAGGTAGACAACAAGAAAGG - Intergenic
1187832539 X:23397568-23397590 TAAAAGGCAGAAGGTAGGAAAGG - Exonic
1187941282 X:24384716-24384738 ACAAAGGAAGACAGTAAGAAAGG - Intergenic
1188150087 X:26662889-26662911 TAAAAGGAAGGAAGAAAGAAAGG - Intergenic
1188313379 X:28644952-28644974 TTAAAGGCTGAAAACAAGAAGGG + Intronic
1188316355 X:28678473-28678495 TTCAAGGCTGAAAGCAAGAAAGG + Intronic
1188467194 X:30495276-30495298 TCTAAGGCAGAAATCAAGTTAGG + Intergenic
1188581497 X:31719265-31719287 TCTAATCCAGAAATCAAGAATGG + Intronic
1188598241 X:31927619-31927641 TTAAAGGTAGAAACCAAGAAGGG + Intronic
1188827440 X:34853295-34853317 GCAAAGGGGGAAAGCCAGAATGG - Intergenic
1189140134 X:38595813-38595835 TAGAAGGCAGAAAGTAAGAAAGG - Intronic
1189194761 X:39143652-39143674 AAAAAGGGAGAAAGGAAGAAAGG - Intergenic
1189297319 X:39928238-39928260 TCACTGGATGAAAGCAAGAATGG - Intergenic
1189769794 X:44414027-44414049 TAAAAGGAAGACAGGAAGAAAGG - Intergenic
1189875792 X:45434457-45434479 GTAACAGCAGAAAGCAAGAAGGG - Intergenic
1189966650 X:46380251-46380273 AGAAAGGAAGAAAGAAAGAAAGG + Intergenic
1190151037 X:47948597-47948619 ACAAAGGAAGACAGCAAGAGAGG + Intronic
1190604653 X:52128217-52128239 TTAAAGGCAGCTAGAAAGAAGGG + Intergenic
1190751050 X:53361715-53361737 TTCAAAGCAGAAAGAAAGAAGGG + Intergenic
1190946933 X:55104145-55104167 ACAAAGGTAGAAAGTAATAAGGG + Intronic
1191137809 X:57084448-57084470 TTAAAGGCAGATAGAGAGAAAGG + Intergenic
1191170561 X:57443018-57443040 TCAAGGGCAGACAGAGAGAAAGG - Intronic
1191773946 X:64792558-64792580 TCCAAGGCTGAAAGAAATAAAGG - Intergenic
1191956997 X:66652890-66652912 ACAAAGACAGACAGCAAGAGAGG + Intergenic
1192064899 X:67872707-67872729 ACAAAAGAAGAAAGCAAGAGAGG - Intergenic
1192069770 X:67924906-67924928 TAAAAGGGAGACAGCAAGGAAGG + Intergenic
1192395605 X:70777809-70777831 ACAAAGGAAGACAGCAAGAAGGG + Intronic
1192658597 X:73019467-73019489 GGCAAGACAGAAAGCAAGAAAGG + Intergenic
1192779794 X:74282604-74282626 TCAAAAAAAGAAAGAAAGAAAGG - Intergenic
1192890768 X:75388643-75388665 ACAAAGGAAGAAAGAAAGAAGGG + Intronic
1192892071 X:75400715-75400737 TTAAAGGCAGCTAGCCAGAAAGG + Intronic
1192923740 X:75734652-75734674 CCAAAGCCCGAAGGCAAGAATGG + Intergenic
1193051554 X:77105450-77105472 ACAAAGGAAGACAGCAAGAGAGG + Intergenic
1193061337 X:77211305-77211327 TTAAAGGCAGCTAGAAAGAAAGG - Intergenic
1193178358 X:78422578-78422600 AAAAAGGAAGAAAGCAAGAGTGG + Intergenic
1193206126 X:78749760-78749782 TCAAAGTCTGCAAGCAAGGAGGG - Intronic
1193396781 X:80993153-80993175 TAAAAGGAAGACAGAAAGAATGG + Intergenic
1193471646 X:81911138-81911160 GCAAAGAAAGAAAGGAAGAAAGG + Intergenic
1193860764 X:86664091-86664113 TAAAAGCCAGAAAGTAAGAAGGG - Intronic
1193883655 X:86958939-86958961 TCAAAGGCAGCTAGAGAGAAAGG - Intergenic
1194256061 X:91635740-91635762 TCAAGGTCAGAAGCCAAGAAAGG - Intergenic
1194317739 X:92401979-92402001 TCAAAAGCAGAAAGGAGTAAAGG - Intronic
1194692643 X:97006852-97006874 TAAAAGGAAGACAGGAAGAAAGG - Intronic
1194727795 X:97418484-97418506 GCACAGGCACAAAGCAAGTATGG - Intronic
1194774556 X:97945976-97945998 TCAAAGGCAGCTAGAGAGAAGGG + Intergenic
1194838495 X:98711692-98711714 TTAAAGGCAGACAGAAAAAAAGG - Intergenic
1194867607 X:99087613-99087635 TTAAAGGCAGCAAGAGAGAAAGG + Intergenic
1195149008 X:102046194-102046216 TTAAAGGCAGCAAGAGAGAAAGG + Intergenic
1195424084 X:104708112-104708134 CCAAAGTCAGAGAGCAAGCAGGG - Intronic
1195653038 X:107306189-107306211 ACAAAGGGAGACAGCAAGAAAGG + Intergenic
1196011693 X:110895218-110895240 TCAAAATCAGAAAGAAATAAAGG + Intergenic
1196092577 X:111761703-111761725 TGAAAGGGAGAAGGCAAAAAAGG - Intergenic
1196184202 X:112727632-112727654 AGAAAGGAAGAAAGAAAGAAAGG + Intergenic
1196334860 X:114520362-114520384 GCAAAGGAAGACAGCAAGAGAGG + Intergenic
1196344747 X:114641015-114641037 AGAAAGGAAGAAAGAAAGAAAGG - Intronic
1196634637 X:117988211-117988233 GCAAAGGCAGAAAGGGAGGAGGG + Intronic
1196641331 X:118065700-118065722 CCAAGGGCAGGAAGCTAGAAGGG - Intronic
1196729098 X:118923029-118923051 AAAAAGGGAGAAAGAAAGAAAGG + Intergenic
1197026826 X:121761106-121761128 ACAAAGGAAGATGGCAAGAAAGG + Intergenic
1197181010 X:123537312-123537334 ACAAAGGAAGACAGCAAGAGGGG + Intergenic
1197260787 X:124315201-124315223 ACAAAGGAAGACAGGAAGAAAGG + Intronic
1197448649 X:126582706-126582728 ACAAAGGAAGATAGCAAGAGAGG + Intergenic
1197482651 X:127006089-127006111 TCAAAGGCAGCTAGAGAGAAAGG + Intergenic
1197740790 X:129891967-129891989 TAAAATGCTGAAAGAAAGAAAGG + Intergenic
1197880582 X:131162817-131162839 TTAAAGGCAGCCAGAAAGAAAGG - Intergenic
1198277581 X:135111085-135111107 TTAAAGGCAGCTAGAAAGAAGGG - Intergenic
1198531759 X:137555055-137555077 AAAAAGGAAGAAAGAAAGAAAGG + Intergenic
1199113696 X:143964342-143964364 TTAAAGGCAGCTAGAAAGAAAGG - Intergenic
1199120657 X:144049431-144049453 TTAAAGGCAGCTAGAAAGAAAGG + Intergenic
1199344663 X:146724266-146724288 AGAAAGGAAGAAAGGAAGAAAGG + Intergenic
1199667418 X:150109952-150109974 TAAAAGGCAGAATGTCAGAATGG - Intergenic
1199706230 X:150427868-150427890 TCAAAGGCACCTGGCAAGAAAGG - Intronic
1199819038 X:151426547-151426569 TTGAAGGCAGAAGACAAGAATGG + Intergenic
1199864127 X:151827697-151827719 TCAAATGGAGAAAGCAGGATTGG + Intergenic
1200051597 X:153434796-153434818 ATTAAGGCTGAAAGCAAGAAAGG - Intergenic
1200060933 X:153483482-153483504 TCGGAGGCAGAGAGCAAGGATGG + Intronic
1200574790 Y:4875033-4875055 TCAAGGTCAGAAGCCAAGAAAGG - Intergenic
1200625913 Y:5515266-5515288 TCAAAAGCAGAAAGGAGTAAAGG - Intronic
1200711527 Y:6488938-6488960 TCAAAGACAGAAGGAAAGAGAGG + Intergenic
1200905794 Y:8480834-8480856 TCAAAGCCAGAAGGCTGGAATGG + Intergenic
1200941027 Y:8781936-8781958 ACACAGGGAGAAAGAAAGAAAGG + Intergenic
1201022404 Y:9673045-9673067 TCAAAGACAGAAGGAAAGAGAGG - Intergenic
1201067627 Y:10113267-10113289 TAAAAGGAAGACAGGAAGAAAGG + Intergenic
1201256541 Y:12113088-12113110 AGGAAGGCAGAAAGCAAGCAAGG - Intergenic
1201558584 Y:15290876-15290898 TCAGATGTAGAAAGAAAGAAGGG + Intergenic
1201797445 Y:17913615-17913637 TGAAAGAAAGAAAGAAAGAAAGG - Intergenic
1201804108 Y:17992344-17992366 TGAAAGAAAGAAAGAAAGAAAGG + Intergenic
1201854326 Y:18524354-18524376 TGAAAGAAAGAAAGAAAGAAAGG + Intergenic
1201878995 Y:18796031-18796053 TGAAAGAAAGAAAGAAAGAAAGG - Intronic
1201887699 Y:18903943-18903965 TGAAGGGAAGAAAGGAAGAAAGG + Intergenic
1201973191 Y:19817876-19817898 ACAAAGGCAAAAAGGAAAAAAGG + Intergenic
1202064497 Y:20924252-20924274 TTAAAGGCAGACAGAGAGAAAGG - Intergenic
1202073989 Y:21020317-21020339 TCACAGGAAGAATGAAAGAATGG + Intergenic
1202078689 Y:21062172-21062194 TCACAGGAAGAATGAAAGAATGG + Intergenic
1202366008 Y:24165525-24165547 TGAAAGAAAGAAAGAAAGAAAGG - Intergenic
1202504774 Y:25504598-25504620 TGAAAGAAAGAAAGAAAGAAAGG + Intergenic