ID: 1034282936

View in Genome Browser
Species Human (GRCh38)
Location 7:149866166-149866188
Sequence GAGACATTTCCACAGGTCAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 168}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034282936_1034282946 5 Left 1034282936 7:149866166-149866188 CCTTTGACCTGTGGAAATGTCTC 0: 1
1: 0
2: 1
3: 8
4: 168
Right 1034282946 7:149866194-149866216 CCTGTGGGTCTGGCGGTCAGAGG 0: 1
1: 0
2: 1
3: 21
4: 198
1034282936_1034282947 6 Left 1034282936 7:149866166-149866188 CCTTTGACCTGTGGAAATGTCTC 0: 1
1: 0
2: 1
3: 8
4: 168
Right 1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG 0: 1
1: 0
2: 1
3: 8
4: 213
1034282936_1034282949 23 Left 1034282936 7:149866166-149866188 CCTTTGACCTGTGGAAATGTCTC 0: 1
1: 0
2: 1
3: 8
4: 168
Right 1034282949 7:149866212-149866234 AGAGGGACCCCACAGGCCTGTGG 0: 1
1: 0
2: 3
3: 38
4: 256
1034282936_1034282951 29 Left 1034282936 7:149866166-149866188 CCTTTGACCTGTGGAAATGTCTC 0: 1
1: 0
2: 1
3: 8
4: 168
Right 1034282951 7:149866218-149866240 ACCCCACAGGCCTGTGGTGCGGG 0: 1
1: 0
2: 2
3: 50
4: 333
1034282936_1034282948 16 Left 1034282936 7:149866166-149866188 CCTTTGACCTGTGGAAATGTCTC 0: 1
1: 0
2: 1
3: 8
4: 168
Right 1034282948 7:149866205-149866227 GGCGGTCAGAGGGACCCCACAGG 0: 1
1: 0
2: 0
3: 8
4: 112
1034282936_1034282941 -2 Left 1034282936 7:149866166-149866188 CCTTTGACCTGTGGAAATGTCTC 0: 1
1: 0
2: 1
3: 8
4: 168
Right 1034282941 7:149866187-149866209 TCCCAGCCCTGTGGGTCTGGCGG 0: 1
1: 0
2: 1
3: 64
4: 473
1034282936_1034282939 -10 Left 1034282936 7:149866166-149866188 CCTTTGACCTGTGGAAATGTCTC 0: 1
1: 0
2: 1
3: 8
4: 168
Right 1034282939 7:149866179-149866201 GAAATGTCTCCCAGCCCTGTGGG 0: 1
1: 0
2: 1
3: 21
4: 248
1034282936_1034282940 -5 Left 1034282936 7:149866166-149866188 CCTTTGACCTGTGGAAATGTCTC 0: 1
1: 0
2: 1
3: 8
4: 168
Right 1034282940 7:149866184-149866206 GTCTCCCAGCCCTGTGGGTCTGG 0: 1
1: 0
2: 3
3: 26
4: 275
1034282936_1034282950 28 Left 1034282936 7:149866166-149866188 CCTTTGACCTGTGGAAATGTCTC 0: 1
1: 0
2: 1
3: 8
4: 168
Right 1034282950 7:149866217-149866239 GACCCCACAGGCCTGTGGTGCGG 0: 1
1: 1
2: 3
3: 43
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034282936 Original CRISPR GAGACATTTCCACAGGTCAA AGG (reversed) Exonic
912770611 1:112461333-112461355 AAGACATTTCCTTAGGTCAGAGG - Intronic
913084223 1:115420614-115420636 GATACCTTTCAACAGGTTAATGG - Intergenic
916983490 1:170165770-170165792 GAGACAAATCCACAGGTAAATGG - Intronic
918141595 1:181724588-181724610 GAGAGAGTTCCAAAGGCCAAAGG - Intronic
923971317 1:239206141-239206163 AAGACATTAGCACAGGTAAAAGG + Intergenic
1066374436 10:34844554-34844576 GAGACATATGCACAGCCCAATGG - Intergenic
1067476774 10:46572642-46572664 GATTCATTTGCTCAGGTCAAGGG - Intergenic
1067617964 10:47769138-47769160 GATTCATTTGCTCAGGTCAAGGG + Intergenic
1068009872 10:51434806-51434828 GAGACATTTCCCCATCTGAAAGG - Intronic
1069574662 10:69517824-69517846 GAGTTATTTCCACAGGGCATTGG - Intergenic
1073569403 10:104563900-104563922 GAGGCATTTTCCCAGGTCAAAGG - Intergenic
1074415960 10:113266871-113266893 GAGACAGTGGGACAGGTCAAAGG + Intergenic
1078073930 11:8140076-8140098 GAGGCATTTGCAAAGGCCAAAGG - Exonic
1079691423 11:23422853-23422875 CAGACATTTCTGTAGGTCAAAGG + Intergenic
1079724593 11:23865425-23865447 GAGAAAGTTCCAAAGGTTAACGG - Intergenic
1081738444 11:45421595-45421617 GAGATTCTTCCAGAGGTCAAGGG - Intergenic
1089088278 11:115842723-115842745 GAGGCATTACCTAAGGTCAAAGG - Intergenic
1089342998 11:117772328-117772350 GAGACATTTTCTCATGTCACAGG + Intronic
1089351623 11:117824672-117824694 CAGTCATTTCCCCAGGTGAATGG + Exonic
1089482351 11:118816400-118816422 GTGACAGATACACAGGTCAATGG - Intergenic
1098939167 12:76515333-76515355 CAGACATTTTCACAGGGCCAAGG + Intronic
1100382749 12:94076894-94076916 AATACATTTCTACAGGACAAGGG + Intergenic
1101336842 12:103804253-103804275 AAGACATTTCCACAAGACACTGG + Intronic
1101647828 12:106647532-106647554 CAGGCTTTTGCACAGGTCAAGGG - Intronic
1104218820 12:126762214-126762236 GGGACAGTTTCACAGGTGAACGG - Intergenic
1104826447 12:131712473-131712495 GAGACTATTCCACAGTTTAATGG - Intronic
1106574166 13:30958649-30958671 GAGACAGATCCACAGCTCACAGG - Intronic
1107571171 13:41660076-41660098 GCTACATTTCCACTGGTGAATGG + Intronic
1108279020 13:48842132-48842154 CAGACATTTCCATAAGGCAAGGG - Intergenic
1108471832 13:50774736-50774758 GAGACAATTGCACAGCTCACTGG + Intronic
1112216726 13:97438395-97438417 GGTAGATTTCCACAGGCCAAAGG - Intronic
1113368783 13:109704321-109704343 AAGACATTCCCACAGGTACATGG - Intergenic
1114918590 14:27297174-27297196 GAGATATTTGCATAGGTGAAAGG - Intergenic
1117136112 14:52735470-52735492 GGAACATTTCCACAGGTAGAGGG + Intronic
1117948979 14:61061741-61061763 GAGATCTTTCAACAGGTGAATGG - Intronic
1119323316 14:73744261-73744283 GAGCCATCACCACAGGGCAAGGG + Intronic
1119847502 14:77841284-77841306 GAGAGACTGGCACAGGTCAACGG + Intronic
1119958645 14:78829042-78829064 GAGACATTGACAAAGGTGAAGGG + Intronic
1127299597 15:57639737-57639759 GAGGGGTTTCCTCAGGTCAAAGG + Intronic
1127819631 15:62643718-62643740 TTGACATGTCCAGAGGTCAAAGG + Intronic
1128321479 15:66697704-66697726 GAGACATTTCCCAGGGGCAAGGG + Intergenic
1128644355 15:69364221-69364243 GAGCCATCTCAACAGGTAAATGG + Intronic
1131911426 15:97208872-97208894 AAGTAATTTCCACAAGTCAAGGG + Intergenic
1134830126 16:17316223-17316245 GAGATATTTACACATGTCATCGG + Intronic
1142317072 16:89354461-89354483 GTGACATTTCCACTGGTGCAGGG - Intronic
1142906556 17:3046771-3046793 GAGACATTTTCAGATGTGAAAGG - Intergenic
1143191993 17:5046673-5046695 GAGACATTTCCCCTGCCCAAGGG + Intronic
1145065397 17:19758221-19758243 GAGAGGTCTCCACAGGGCAAAGG + Intergenic
1147360916 17:39929009-39929031 GAGAAACTTCCACAGGACATAGG - Intergenic
1151006630 17:70445165-70445187 GAGACATTTGCAAAGGACATAGG + Intergenic
1151103985 17:71590707-71590729 TATACATCTCCAAAGGTCAAAGG + Intergenic
1152212383 17:79009458-79009480 GGGACTTTCCCACAGGTCAGAGG + Intronic
1152880277 17:82810664-82810686 GAGACATTTACACAAGCAAAAGG - Intronic
1153778079 18:8471282-8471304 GAGACCTTCCCACATGTCCACGG - Intergenic
1155336740 18:24772872-24772894 GAGGCATTTGCAGAGGGCAAAGG - Intergenic
1156059234 18:33053285-33053307 TAGACCTTTCCACAGGTTACAGG - Intronic
1157318802 18:46618682-46618704 GAGACATTTCAATAGTTCAGGGG - Intronic
1157667701 18:49501559-49501581 TAGAGATTTGCACAGGTCCACGG - Intergenic
1160013441 18:75123825-75123847 GAGACAGCTCCAGAGGGCAAAGG - Intergenic
1160192009 18:76722436-76722458 GACATATTTGCACAGGTCAGGGG + Intergenic
1163717721 19:18881611-18881633 GAGACACTTCCCCACGTCCAGGG - Intronic
1166103568 19:40586243-40586265 GAGACAAAGGCACAGGTCAAAGG - Intronic
927401983 2:22722088-22722110 GAGACATTGGAACAGGTTAAAGG - Intergenic
927710321 2:25321531-25321553 GTGACATATTCACAGGTCCAGGG + Intronic
933920178 2:87038034-87038056 AAGACAATTCAACAGGTAAAGGG + Intergenic
933931446 2:87155752-87155774 AAGACAATTCAACAGGTAAAGGG - Intergenic
934002820 2:87731859-87731881 AAGACAATTCAACAGGTAAAGGG - Intergenic
934802749 2:97182673-97182695 GAGGGATTTCCAAATGTCAAAGG + Intronic
934833452 2:97557895-97557917 GAGGGATTTCCAAATGTCAAAGG - Intronic
936361674 2:111809687-111809709 AAGACAATTCAACAGGTAAAGGG + Intronic
939218396 2:139270722-139270744 GAGACAAAACCACAGGCCAATGG - Intergenic
940386883 2:153084518-153084540 TAGTAATTTCCACATGTCAAGGG + Intergenic
940399623 2:153232982-153233004 GAAACTATTCTACAGGTCAAGGG - Intergenic
941411511 2:165162317-165162339 GAGCCATTTCCACAGAGTAAAGG + Exonic
941622320 2:167792236-167792258 GAGAGATGTCTACAGGGCAAAGG - Intergenic
943784195 2:191859104-191859126 GACACATTTCCACCTGGCAAAGG + Intergenic
944687003 2:202126323-202126345 GAGGCAGTGCCACAGATCAAGGG + Intronic
945055668 2:205866786-205866808 GAGACATTTCCTGAGGGCCAAGG + Intergenic
946581352 2:221131258-221131280 GAGACATGTCCAGAGGACACAGG + Intergenic
946788430 2:223273511-223273533 CAGACTTTAGCACAGGTCAAAGG + Intergenic
947395683 2:229684487-229684509 GAGACATCTCCAGAGGGAAATGG - Intronic
948543852 2:238711439-238711461 GAGCCATCTCCACTGGTCAGAGG - Intergenic
1170987615 20:21273026-21273048 CAGACGTTTCCACAGGAGAAAGG - Intergenic
1171241456 20:23570312-23570334 GTGACATTTCGACAGTGCAATGG - Intergenic
1172603076 20:36196886-36196908 GAGTCATCTCCTTAGGTCAAGGG - Intronic
1177627764 21:23686258-23686280 GAGACATTTCTACAGGTAATGGG - Intergenic
1179725558 21:43339670-43339692 GAGACATTTTCACAGCTCCCAGG - Intergenic
1179925392 21:44531392-44531414 GCGACATGGCCACAGGTCACGGG - Intronic
1185064760 22:48626084-48626106 GAAACTTTTCAACAGGTGAATGG - Intronic
949978837 3:9486789-9486811 GAGTAATTACCACGGGTCAAGGG + Intergenic
950297861 3:11847460-11847482 GAGACCATTCCACAAGGCAAGGG - Intergenic
956869674 3:73404388-73404410 AATATTTTTCCACAGGTCAACGG - Exonic
957900480 3:86482447-86482469 CAGACATTTGCACAGCTCATAGG - Intergenic
957972299 3:87398081-87398103 AGGACATTTCCAGAAGTCAAAGG + Intergenic
958121476 3:89295386-89295408 GAGAAATTGCCACAGCTGAAGGG - Intronic
959179263 3:102957593-102957615 AAGCCTTTCCCACAGGTCAAGGG - Intergenic
960034919 3:113092792-113092814 GAGAGATTTCCTCAGCCCAAGGG - Intergenic
960846898 3:122012344-122012366 GAGAAAATTCCACAGGATAAAGG - Intronic
963679913 3:148361395-148361417 GAGAAACTGCCACAGGTCAGAGG - Intergenic
964279976 3:155053347-155053369 GACACAGTTCCACATGTCTAGGG + Intronic
970699662 4:18720710-18720732 GAGAAATTTCCACAGCTAGAGGG + Intergenic
972940379 4:44187896-44187918 GAGATTTTTCCTCAGGTCTAAGG - Intronic
973309912 4:48697959-48697981 GAGGCATTTCCACAGGCACAGGG + Intronic
973958566 4:56087408-56087430 GAAACATTTCCACATGTCAATGG - Intergenic
974255963 4:59455985-59456007 GGCACATTTCTACAGATCAAAGG + Intergenic
975159686 4:71111201-71111223 GAGAGATTTCCCCAGGACACAGG - Intergenic
977395301 4:96463604-96463626 GACACATTTTCACAGTACAAGGG - Intergenic
978092074 4:104729581-104729603 GGGACATTTCCACAGGTGGTGGG + Intergenic
979060747 4:116058219-116058241 GAAACAGTTCCACAGGGCTAGGG + Intergenic
984246271 4:177278607-177278629 GAGTCATTTCCACATGGCTATGG - Intergenic
986598766 5:9450187-9450209 GAGACATTTCCAGAGGAGAAGGG + Intronic
989540432 5:42611602-42611624 CAGACAAATACACAGGTCAATGG + Intronic
989561594 5:42858399-42858421 GAGCCACTGCCACTGGTCAAGGG - Intronic
991646579 5:68807261-68807283 CAGACATTTTCAAAGGTAAAGGG - Intergenic
992913488 5:81422644-81422666 GAGACTTTTAGACAGGTCATAGG + Intronic
993927411 5:93886317-93886339 CAGATAGTTCCATAGGTCAAAGG - Intronic
994339201 5:98605838-98605860 AAAACATTTCCACAAGTCCAAGG + Intergenic
996580107 5:125022617-125022639 GAGAGATTATCACAGATCAATGG - Intergenic
997662779 5:135602331-135602353 GAGACTTTGCCACAGGTGAGTGG + Intergenic
997712661 5:136018910-136018932 GAGACTTTCCCAAAAGTCAAAGG + Intergenic
999353710 5:150904252-150904274 GTTAAATTTCCACAGGTCATAGG - Intronic
999531964 5:152473518-152473540 AAGACATTTCCACAGCTGTAGGG + Intergenic
1002487999 5:179552577-179552599 GAGACTTTTCCACACATCAGTGG + Intronic
1002885434 6:1289710-1289732 GAGACACTTCCAGAGCTAAACGG + Intergenic
1004038943 6:11955551-11955573 GAGAAATTGTCACAGGTGAAAGG + Intergenic
1008038431 6:46772053-46772075 CAGACATTTCCAAAGGCCACTGG - Intergenic
1009296828 6:61961483-61961505 GAGACAGTACTACAGGGCAAGGG + Intronic
1010865553 6:80972994-80973016 AAGACATTTCCAAAAGTCCATGG + Intergenic
1011320898 6:86091847-86091869 GAGGCAATTCCTCAGGGCAACGG - Intergenic
1012056172 6:94413732-94413754 GCAACTTTTCCACAGGTCAAGGG + Intergenic
1014119365 6:117705500-117705522 TAGACATGTACATAGGTCAAAGG - Intronic
1014742094 6:125157500-125157522 GAGAGATGTCCACAGGAGAATGG + Intronic
1015008536 6:128313997-128314019 GAGACAGATACAGAGGTCAAAGG - Intronic
1016415371 6:143827731-143827753 TAGCCATTTCAAGAGGTCAAGGG - Intronic
1017577183 6:155818153-155818175 GAGACACCTGCATAGGTCAAAGG + Intergenic
1020626602 7:10589138-10589160 CAGACATTTCCACATGTCCCGGG + Intergenic
1022040553 7:26577482-26577504 CAGACATGTCCACAGATCAAGGG - Intergenic
1022291838 7:29012611-29012633 GAGACAATGCTTCAGGTCAATGG + Intronic
1023113772 7:36840435-36840457 GAGGCTTTTCCAGAGGTCATGGG + Intergenic
1023130856 7:37001671-37001693 GTGAAATTTCAACAGGTAAATGG + Intronic
1023165556 7:37340028-37340050 GAGAAATTTCTAAAGATCAATGG + Intronic
1029046567 7:97635451-97635473 GAGACAATTCAACAGGAAAAGGG - Intergenic
1032262885 7:130350932-130350954 GATACAGTTCCACAGGTACACGG - Intronic
1032790744 7:135240761-135240783 GAGACGTTTTCACAGGTGGAGGG + Intronic
1034282936 7:149866166-149866188 GAGACATTTCCACAGGTCAAAGG - Exonic
1034351071 7:150415099-150415121 GAGTCAAATTCACAGGTCAAGGG + Intergenic
1036101243 8:5788119-5788141 AACACATTTCCACAGGTTAGTGG + Intergenic
1037582541 8:20254169-20254191 GATTCATTTCCCCAGGGCAAGGG + Intronic
1039629877 8:39099274-39099296 GGAAGATTTCCACAGGACAAAGG + Intronic
1039805885 8:40997804-40997826 CTGACAGTTCTACAGGTCAAGGG + Intergenic
1039806788 8:41006719-41006741 GAGCCATTTCCCCAGGTGAACGG + Intergenic
1040561207 8:48524611-48524633 GGGACATTTCCTCTGCTCAAAGG - Intergenic
1040887712 8:52283537-52283559 AAGACACTTCCAGAAGTCAATGG + Intronic
1041040039 8:53837602-53837624 GAGACAGATACACAGGTCCAAGG + Intronic
1042760761 8:72269277-72269299 GAGCCATTTTCACATGTAAAAGG - Intergenic
1043646308 8:82523659-82523681 GAGAAATTTCAACAGGATAAAGG - Intergenic
1046626426 8:116581404-116581426 CAGACTTTTCCACAGGACAGAGG + Intergenic
1047733953 8:127749642-127749664 AAGACAGTTCCACAGGGGAAGGG + Intergenic
1047905892 8:129472973-129472995 TTAACATATCCACAGGTCAATGG - Intergenic
1060361325 9:122960221-122960243 GTGAAAGTTCCAGAGGTCAAGGG - Intronic
1060764332 9:126282696-126282718 GAGACCTTTCCCCAGGTGACAGG - Intergenic
1060869410 9:127027853-127027875 GAGAGATTGCCACATGTCTAAGG - Intronic
1185491419 X:520059-520081 GAGGCATTTCCAGAGCTCAAAGG + Intergenic
1185685910 X:1928197-1928219 GAAAGACTTACACAGGTCAAGGG + Intergenic
1186402576 X:9273450-9273472 GAGACATTTCAACAGAGAAAGGG + Intergenic
1186821988 X:13298292-13298314 CAGACATTGCCACATGTCACTGG + Intergenic
1187503082 X:19856089-19856111 GAGAGGTTTGCACAGGTAAAAGG + Intronic
1187604101 X:20864300-20864322 GAGAAATTTCCCCATTTCAAGGG - Intergenic
1188300445 X:28501471-28501493 GAGACATTTCCACACCTTGAAGG + Intergenic
1188324768 X:28787625-28787647 GACACCTTGCCACAGGTGAATGG + Intronic
1189751634 X:44228458-44228480 GAGACAATTACACAGGCCATGGG - Intronic
1197023584 X:121719008-121719030 GGGAAATTTACACAGGTAAAAGG + Intergenic
1197959316 X:131986647-131986669 GAAACATTTCTACAAGTAAACGG + Intergenic
1198094530 X:133366287-133366309 GAGATATTTCCAAAAGTCTATGG + Intronic
1199189375 X:144952118-144952140 GAGACATTTCCATAACTAAAAGG - Intergenic
1199197655 X:145050131-145050153 GTGCCATTTTCACATGTCAAGGG + Intergenic
1199747322 X:150781476-150781498 GAGGCAATTTCACAGGTCACTGG + Intronic
1201619020 Y:15934428-15934450 GGGACATTGCCAGAGGTGAAAGG + Intergenic