ID: 1034282937

View in Genome Browser
Species Human (GRCh38)
Location 7:149866173-149866195
Sequence GGGCTGGGAGACATTTCCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 166}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034282937_1034282946 -2 Left 1034282937 7:149866173-149866195 CCTGTGGAAATGTCTCCCAGCCC 0: 1
1: 0
2: 1
3: 15
4: 166
Right 1034282946 7:149866194-149866216 CCTGTGGGTCTGGCGGTCAGAGG 0: 1
1: 0
2: 1
3: 21
4: 198
1034282937_1034282949 16 Left 1034282937 7:149866173-149866195 CCTGTGGAAATGTCTCCCAGCCC 0: 1
1: 0
2: 1
3: 15
4: 166
Right 1034282949 7:149866212-149866234 AGAGGGACCCCACAGGCCTGTGG 0: 1
1: 0
2: 3
3: 38
4: 256
1034282937_1034282950 21 Left 1034282937 7:149866173-149866195 CCTGTGGAAATGTCTCCCAGCCC 0: 1
1: 0
2: 1
3: 15
4: 166
Right 1034282950 7:149866217-149866239 GACCCCACAGGCCTGTGGTGCGG 0: 1
1: 1
2: 3
3: 43
4: 378
1034282937_1034282941 -9 Left 1034282937 7:149866173-149866195 CCTGTGGAAATGTCTCCCAGCCC 0: 1
1: 0
2: 1
3: 15
4: 166
Right 1034282941 7:149866187-149866209 TCCCAGCCCTGTGGGTCTGGCGG 0: 1
1: 0
2: 1
3: 64
4: 473
1034282937_1034282948 9 Left 1034282937 7:149866173-149866195 CCTGTGGAAATGTCTCCCAGCCC 0: 1
1: 0
2: 1
3: 15
4: 166
Right 1034282948 7:149866205-149866227 GGCGGTCAGAGGGACCCCACAGG 0: 1
1: 0
2: 0
3: 8
4: 112
1034282937_1034282947 -1 Left 1034282937 7:149866173-149866195 CCTGTGGAAATGTCTCCCAGCCC 0: 1
1: 0
2: 1
3: 15
4: 166
Right 1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG 0: 1
1: 0
2: 1
3: 8
4: 213
1034282937_1034282951 22 Left 1034282937 7:149866173-149866195 CCTGTGGAAATGTCTCCCAGCCC 0: 1
1: 0
2: 1
3: 15
4: 166
Right 1034282951 7:149866218-149866240 ACCCCACAGGCCTGTGGTGCGGG 0: 1
1: 0
2: 2
3: 50
4: 333
1034282937_1034282955 30 Left 1034282937 7:149866173-149866195 CCTGTGGAAATGTCTCCCAGCCC 0: 1
1: 0
2: 1
3: 15
4: 166
Right 1034282955 7:149866226-149866248 GGCCTGTGGTGCGGGAGCTCTGG 0: 1
1: 0
2: 0
3: 17
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034282937 Original CRISPR GGGCTGGGAGACATTTCCAC AGG (reversed) Exonic
900637263 1:3672077-3672099 CAGCAGGGAGACATGTCCACTGG + Intronic
902566456 1:17314744-17314766 GGCCTGGGAGACGTTTCCCCGGG + Intronic
904694760 1:32322979-32323001 GGGCCGGGATATATTTTCACAGG + Intronic
905243545 1:36596801-36596823 GGGGTGAGAGTCATTTCCAGAGG + Intergenic
905271577 1:36790955-36790977 GAGGTGGGAGCCATCTCCACAGG + Intergenic
908694132 1:66817807-66817829 GGACTGGGAGACAAATGCACTGG + Intronic
908993820 1:70127866-70127888 GGTCTGGGTCAAATTTCCACAGG + Intronic
909470653 1:76024208-76024230 GGGCTGGGTGACATTGTCAGAGG + Intergenic
909589362 1:77328774-77328796 GGGCTGTAAGAGATTACCACAGG + Intronic
912696829 1:111848380-111848402 TGGCTGTGTGACATTTCCATTGG - Intronic
912873517 1:113331602-113331624 GTGCTGGTAGACATTTCCTGGGG + Intergenic
913379676 1:118195650-118195672 GGGCTGAGAGGCACTTTCACAGG + Intergenic
913380271 1:118202862-118202884 GGGCAGGGACACATGTCCAGTGG + Intergenic
914882418 1:151557627-151557649 TTGCCTGGAGACATTTCCACTGG + Intronic
915218000 1:154352689-154352711 GGGCTGGAAGCCACTCCCACAGG - Intergenic
915841064 1:159213345-159213367 GGGGTGGGGGAGATTTACACTGG + Intergenic
919931433 1:202223814-202223836 GGGCTGGGACACTTGCCCACAGG - Intronic
919931456 1:202223882-202223904 GGGCTGGGACACTTGCCCACAGG + Intronic
920057688 1:203204902-203204924 GTGCTGGGAGATCTCTCCACTGG + Intergenic
920577233 1:207070425-207070447 GGGCTGGGAGACACATCCAGTGG + Intronic
920584773 1:207146874-207146896 GGTCTGGGAGCCATTGCTACTGG - Intergenic
920670971 1:208003402-208003424 GCTGTGGGAGACATATCCACTGG + Intergenic
923353523 1:233131197-233131219 GGGCTGGGGGACATCTGCAGTGG + Intronic
1066191418 10:33059339-33059361 TGGCTGGCAGACATTTCAGCTGG + Intergenic
1066279014 10:33896989-33897011 GAGCAGAGAGATATTTCCACTGG - Intergenic
1067498286 10:46778036-46778058 GGGCTGGGTACGATTTCCACTGG + Intergenic
1067596358 10:47562379-47562401 GGGCTGGGTACGATTTCCACTGG - Intergenic
1069581410 10:69569431-69569453 GGGCTCGGAAACATTTCTAGGGG - Intergenic
1070481920 10:76891103-76891125 AGGTTGGGAAATATTTCCACAGG - Intronic
1070961860 10:80505177-80505199 GGGCTGGGTGACATGCCCCCAGG + Intronic
1071616105 10:87077861-87077883 GGGCTGGGTACGATTTCCACTGG + Intronic
1072238394 10:93472828-93472850 GTCCTGGGGGACATTTCCAAGGG - Intronic
1072409282 10:95184934-95184956 GGGCTGGGAGACATGTCAGTAGG - Intergenic
1073057122 10:100710030-100710052 GGGTTGGGAGACAGTGACACCGG + Intergenic
1073823310 10:107290967-107290989 GGCCTGGCTGACATTGCCACTGG - Intergenic
1076250322 10:128979638-128979660 GGGCTGGGAGTCTTTTCTCCAGG - Intergenic
1076313477 10:129524372-129524394 GAGCTGGGAGACACGTCCACAGG - Intronic
1077233254 11:1468123-1468145 GGGCTGGGGGCCAGCTCCACTGG - Intergenic
1084586236 11:70064332-70064354 GGGCAGGGAGGCATCTCCAAAGG + Intergenic
1086147457 11:83568354-83568376 TGGCTGGGAGAAATTTGCAAAGG + Intronic
1088880315 11:113968484-113968506 GAGATGGGACTCATTTCCACAGG + Intergenic
1096845016 12:54401704-54401726 GGGCTGGGCGCCATTCTCACTGG - Intronic
1104115363 12:125744540-125744562 GGGCTGGGAGACGTTACCCCAGG + Intergenic
1104561235 12:129846955-129846977 TGCCTGGGAAACTTTTCCACTGG + Intronic
1106137487 13:26984552-26984574 GGAATGTGAGACATTGCCACAGG + Intergenic
1106699092 13:32209727-32209749 GGGCTGAGAGACACTTACATAGG - Exonic
1107372601 13:39768830-39768852 GGGGTGGGATACATATGCACAGG - Intronic
1110880493 13:80566441-80566463 GGGCTGGGAAAGATTCCCACTGG - Intergenic
1111039812 13:82732698-82732720 GCACTGTCAGACATTTCCACAGG + Intergenic
1113343262 13:109447455-109447477 GGCCAGGGAGACATTTTCAGAGG + Intergenic
1113730640 13:112638801-112638823 GGGCTGAGAGCCACTTCCCCAGG + Intergenic
1115806905 14:37061975-37061997 GGGCTGGCAGAGCTTTCCATGGG + Intronic
1122978141 14:105179394-105179416 GGGCTGGGCGGCATCTCCTCAGG - Intronic
1123428559 15:20193841-20193863 GTGCTGGGACACAGCTCCACTGG + Intergenic
1124824544 15:33080936-33080958 CGGGTGGGGGAGATTTCCACAGG - Intronic
1127210735 15:56772122-56772144 GGGCTGGAAGACATAACCAAAGG + Intronic
1130607934 15:85334535-85334557 TGTTTTGGAGACATTTCCACTGG + Intergenic
1131067882 15:89445566-89445588 AGGCTTGGAAACACTTCCACAGG - Intergenic
1131562232 15:93454789-93454811 GAGCTGGGAGACATAGCCAAGGG - Intergenic
1132090076 15:98941034-98941056 GAGCTGGCTGGCATTTCCACGGG - Intronic
1132678563 16:1130639-1130661 GGGCTGGGGGACACATCCACAGG - Intergenic
1135493256 16:22928843-22928865 GGGCTGGGAGAAAATTTCCCTGG - Intergenic
1136855758 16:33655891-33655913 GTGCTGGGACACAGCTCCACTGG - Intergenic
1137767100 16:50986230-50986252 GGGCTGGGGGAAATTACCAAGGG - Intergenic
1139511924 16:67432482-67432504 GGGCTGGGAGAATTTTCCGGAGG + Intronic
1140336385 16:74108969-74108991 GGGCTGGGGGTAATTTCCAAAGG - Intergenic
1142043214 16:87908706-87908728 GGGCTGGAAGACTTTCCCAAGGG + Intronic
1142343664 16:89539973-89539995 GGGCTGGAGCACTTTTCCACAGG - Intronic
1203117343 16_KI270728v1_random:1504372-1504394 GTGCTGGGACACAGCTCCACTGG - Intergenic
1143496792 17:7317168-7317190 GGGTGGGGAGAGATTTCCAGGGG - Intronic
1143524389 17:7463618-7463640 GGGCTGGCTGGCATTGCCACAGG + Exonic
1147494496 17:40903025-40903047 GAGCAGGAAGATATTTCCACTGG + Intergenic
1148688663 17:49514388-49514410 GAGCTGGGAGAAATCCCCACAGG - Exonic
1150856515 17:68758460-68758482 TGGCTGGAGGACATTTCCAAAGG + Intergenic
1157616202 18:48989129-48989151 GGGCTATGAGACATTCCCTCCGG - Intergenic
1162034453 19:7931681-7931703 GGGCTGGGAGCTGCTTCCACAGG + Intronic
1165578084 19:36838637-36838659 GGGCTGGGAGCCTTTTGCAGAGG - Intronic
1166860346 19:45806798-45806820 GGGCTGGCAGGCATTTCCCTGGG - Intronic
926107061 2:10159130-10159152 GGGGTGGGTGACATTTTCAAAGG + Intronic
926720802 2:15958757-15958779 GGGCAGGGAGTGCTTTCCACAGG + Intergenic
927683483 2:25155239-25155261 AGGCTGGGAGCCTTTTCCATAGG - Exonic
927842251 2:26453189-26453211 GCCCAGGGAGACATTTACACAGG - Intronic
929560448 2:42953242-42953264 GGGCTCGGAGGCACTCCCACAGG - Intergenic
932708987 2:74048128-74048150 GGGCTGGGAGACATGTTTGCTGG - Exonic
935060199 2:99600706-99600728 GGGCTGAGAGAAACTTCCCCAGG - Intronic
935172957 2:100624870-100624892 GGGCTGGGAGGCATCTGCTCTGG + Intergenic
942454494 2:176128988-176129010 GGGGAGGGTGACATTTCCTCGGG - Intergenic
944150797 2:196555998-196556020 GGTCTGGGAGGGATTTCCAGTGG - Intronic
948464838 2:238147504-238147526 GTGCTGGGAGTCATTTCCTGGGG - Intronic
1169203642 20:3728459-3728481 GGGCTGGGTGACTTTGCCCCTGG - Intergenic
1169221595 20:3826323-3826345 GGCCTGTGGGACATTTCCACTGG - Exonic
1170209898 20:13837923-13837945 GGGCTGATACACATTTCCAGAGG - Intergenic
1170745117 20:19092114-19092136 GGGTTGAGAAACATTCCCACGGG + Intergenic
1172004303 20:31807502-31807524 AGGGTGGGAGACATTTCCAGTGG + Intergenic
1172526901 20:35605288-35605310 GGGCTGGGAGAGGGTACCACAGG - Intergenic
1172902287 20:38344047-38344069 TGGCTGGGAGTCATTTGCAGGGG - Intergenic
1173176997 20:40771964-40771986 GAACTGGGAGGCATTTCCTCAGG + Intergenic
1173398261 20:42701192-42701214 GAGTGGGGATACATTTCCACGGG + Intronic
1173669251 20:44786347-44786369 GGGCTGTGAGAGATTCACACGGG - Intronic
1173891721 20:46517508-46517530 GAGGTGGCAGACAGTTCCACTGG + Intergenic
1175777839 20:61664144-61664166 GTGCAGGGAGGCATTTCCACTGG - Intronic
1175817767 20:61892525-61892547 GGGCTGGGAGAGAATTCCATGGG + Intronic
1179034974 21:37751934-37751956 GAGAAGGAAGACATTTCCACTGG + Intronic
1179495911 21:41771206-41771228 TGGCTGAGGGACATTTGCACTGG - Intergenic
1180897387 22:19346788-19346810 GGGCTAGGAGACCTTTACAGAGG + Intronic
1181529879 22:23511433-23511455 GGGCCGGGGGACATGGCCACAGG - Intergenic
1181642191 22:24208155-24208177 GGGCTCGGAGTCACTTCCTCTGG + Intergenic
1182079075 22:27516408-27516430 GGGCTGGCTTACATTTCCAGGGG - Intergenic
1182113570 22:27742025-27742047 GGCCTAGGAGACATTTTCATGGG - Intergenic
1182508669 22:30803259-30803281 GGGCTGGAAGAAATTTACAACGG - Intronic
1183858425 22:40652318-40652340 GGGCTGGCAGCCTTTTCCAAGGG - Intergenic
1184298746 22:43542690-43542712 GGGCTGGGGGCTATTTCCTCCGG - Intronic
1185010814 22:48313007-48313029 GGGCTGGGCTCCATTTGCACTGG - Intergenic
949531318 3:4958354-4958376 GGGCTGAGAGACTTCTCCAGAGG + Intergenic
950125243 3:10506415-10506437 GGGCTGACTGACACTTCCACGGG + Intronic
950136340 3:10583845-10583867 GGGCTGGGAGAGAGTTACATGGG + Intronic
954582141 3:51708663-51708685 GGGCTGAGAGACAGGTCCAGGGG + Intronic
956167834 3:66409824-66409846 GGGTTTGGAGACAGTTCCAGGGG - Intronic
959234817 3:103706880-103706902 GGGCTTGTGGACATTTTCACTGG + Intergenic
959417085 3:106088504-106088526 GCCCTGTGAGACATTGCCACAGG - Intergenic
961660746 3:128467687-128467709 TGGCTGGAAGAAATTTCCCCTGG - Intergenic
969146759 4:5130738-5130760 GGATTGGTAGACATTTCCTCAGG - Intronic
971287978 4:25308525-25308547 GGGGTGGGAAGCATTGCCACTGG + Intergenic
972266286 4:37463193-37463215 TGGCTGGGAGACGCTGCCACAGG - Intronic
973934461 4:55828896-55828918 GGCCTTGGAAACCTTTCCACAGG + Intergenic
977494436 4:97757259-97757281 GGTCTGGGAGGCATTTGCAAAGG - Intronic
978647528 4:110955274-110955296 GTGCTGGGAGACACTGCCAATGG - Intergenic
982647731 4:158044525-158044547 GGACTGGCAGGCAGTTCCACCGG + Intergenic
983221192 4:165045969-165045991 AGGCCTGGAGACATTTCTACTGG + Intergenic
984709075 4:182869865-182869887 GGGCTGGGAAACACTGCCTCTGG + Intergenic
986233434 5:5886604-5886626 AGCCTTGGAGACATTTCCCCAGG + Intergenic
988306872 5:29504214-29504236 GGACTGGGAGACAGTTTCAGGGG - Intergenic
991046092 5:62224257-62224279 GTGCTGGGACACAGCTCCACTGG + Intergenic
991435378 5:66592910-66592932 GTGACGGGAGACATTTCCTCTGG - Intergenic
994821189 5:104652882-104652904 GGGCTGGCAGACTTGCCCACAGG - Intergenic
997251648 5:132393283-132393305 GGGCTGGGACACATCTGCAGAGG + Intronic
998443473 5:142180877-142180899 GGGCTGGAAGAGATTTCCAAGGG + Intergenic
1000177909 5:158776257-158776279 GGGCTGGGAGGCATTTCCAAGGG + Intronic
1000200828 5:159009018-159009040 AGGCTGGGAGAGCTTTCCACTGG - Intronic
1000898930 5:166889831-166889853 GGACTGGGTGAAATCTCCACGGG + Intergenic
1001636132 5:173211583-173211605 GTGCTGGGAGGCCCTTCCACAGG - Intergenic
1001770720 5:174293871-174293893 GGCCTGGGAGACATTACAGCAGG + Intergenic
1002194271 5:177493796-177493818 GTGCTGGAAGACAATTTCACTGG + Intronic
1008078306 6:47168926-47168948 GGGCTGGGAGTAATGGCCACAGG - Intergenic
1008658261 6:53638578-53638600 GGGATGGGAGGAATTTCTACAGG + Intergenic
1013084061 6:106840678-106840700 GAGCTGGTAGACAAGTCCACAGG - Intergenic
1015499501 6:133917926-133917948 GGGGTGGGAGAGATTTCCCAGGG + Intergenic
1017250189 6:152271922-152271944 GGGCTCGGAGAATTTTCCAAGGG - Intronic
1017913547 6:158815413-158815435 GGGCAGGGAGAAATTTCCCATGG + Intronic
1018470949 6:164097379-164097401 GGGCTGGAAGACATTCCCTCAGG - Intergenic
1019630277 7:2045353-2045375 GGGCTGGGAGTCACTCTCACAGG - Intronic
1022277468 7:28869651-28869673 GGGCAGAGAGACATTTCCTGGGG - Intergenic
1023450276 7:40276997-40277019 GGGTTACGAGACATTCCCACTGG - Intronic
1023613035 7:41990820-41990842 GTGCTGGGAGAACTTTCCATTGG + Intronic
1032398257 7:131606229-131606251 GGGCCGGCAGACATTTACCCAGG - Intergenic
1034282937 7:149866173-149866195 GGGCTGGGAGACATTTCCACAGG - Exonic
1034440439 7:151083235-151083257 GGGCTTGGAGAGACTTCCAGAGG - Intronic
1035430706 7:158818625-158818647 GGGCAGGGAGGCATGTCCTCGGG - Intronic
1040300069 8:46183369-46183391 GGGATGGGAGACATCTCCTTGGG + Intergenic
1040554791 8:48469097-48469119 AGTCTGGGAAACATTTCCAGGGG - Intergenic
1040642002 8:49345987-49346009 GGTTTGGGAGACAATTCCCCTGG + Intergenic
1043755304 8:83996046-83996068 GTGCTGGGCAATATTTCCACTGG + Intergenic
1046071774 8:109263729-109263751 GTGCTGGGAGACATCTTCAGGGG + Intronic
1046092018 8:109514051-109514073 GGGGTGGGAGAGATTCCCATAGG - Intronic
1048896890 8:139000411-139000433 GGGCTGGGAAACACGCCCACTGG + Intergenic
1049912798 9:285845-285867 GGTCTGGAAGAAATTTCCACTGG - Intronic
1050430500 9:5557156-5557178 GGGCTGAGAGACTTTGCCACTGG + Intronic
1053664221 9:40306211-40306233 GGGCAAGGAGACATTTCAAATGG - Intronic
1054520395 9:66070074-66070096 GGGCAAGGAGACATTTCAAATGG + Intergenic
1056299356 9:85226018-85226040 TGGCTGGGAGACAGGTCCGCTGG - Intergenic
1056363315 9:85880332-85880354 GGTCTAGTAGACATTTTCACTGG - Intergenic
1056628331 9:88272687-88272709 GGGTGGGGAGCCTTTTCCACTGG - Intergenic
1056628338 9:88272708-88272730 GGGTGGGGAGCCTTTTCCACTGG - Intergenic
1057417186 9:94875001-94875023 GGCCTGGGAAATATTTCCAGAGG - Intronic
1057458727 9:95239149-95239171 GGGTTTGGAGACATTTCCTGGGG - Intronic
1060239056 9:121887681-121887703 GAGCTGGGACACTTTCCCACAGG + Intronic
1060852676 9:126890251-126890273 GGCCTGGGAACCACTTCCACAGG - Intergenic
1062369474 9:136230352-136230374 GGGCTGACAGCCATTCCCACCGG - Intronic
1062669107 9:137695876-137695898 GGACTGGCAGATATTTGCACTGG + Intronic
1190058461 X:47195793-47195815 GGGCTGGGAGAGGTTTCTAATGG - Intronic
1198045086 X:132893638-132893660 AGGCTGGGAGACATTCACCCAGG + Intronic
1200137522 X:153882268-153882290 TGGCTGGGAGACAGGGCCACAGG + Intronic
1201233881 Y:11891807-11891829 GGTCTGGGAGATACTTTCACTGG - Intergenic