ID: 1034289035

View in Genome Browser
Species Human (GRCh38)
Location 7:149913383-149913405
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 589
Summary {0: 2, 1: 0, 2: 3, 3: 58, 4: 526}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034289035 Original CRISPR CAGACTGAGGATAGGGGAGG CGG Intergenic
900185404 1:1331003-1331025 CAGGCTGTGGAGAGGAGAGGGGG - Intergenic
900625204 1:3604810-3604832 CAGAGTGAGAATAGGGGAGGGGG + Intronic
901070274 1:6513474-6513496 CAGCCTGAGGTGAGGGGAAGAGG + Intronic
901102055 1:6726518-6726540 CAGGCTGAGAATGGGGGAGTGGG - Intergenic
901167300 1:7229644-7229666 GAGAAGGAGGAGAGGGGAGGAGG + Intronic
901234626 1:7661302-7661324 GAGACTCAGGATAGAGGTGGTGG - Intronic
901263110 1:7888325-7888347 CAGTCTGAGGGATGGGGAGGAGG - Intergenic
901439602 1:9269739-9269761 AAGACTGAGGAAATGGGAGGGGG - Exonic
901674116 1:10872960-10872982 CAGCCTGAGGGGAGGGGACGGGG - Intergenic
901688310 1:10956900-10956922 GGGACTGAGGAGAGGAGAGGTGG + Intronic
901872835 1:12148205-12148227 CAAACTGAGGCTCGGGGAGTGGG + Intergenic
901930708 1:12595084-12595106 CAGAGGGAGGGGAGGGGAGGCGG + Intronic
901933449 1:12612194-12612216 CAGAGTGAGGATGGGAGAGATGG + Intronic
902511127 1:16967579-16967601 CAGGCTCAGGATAGGGGCTGGGG + Intronic
902617573 1:17632206-17632228 GAGACTGAGGCTGGGAGAGGTGG - Intronic
902718338 1:18288105-18288127 GAAACTGAGACTAGGGGAGGTGG + Intronic
903272163 1:22196357-22196379 CAGAGTGGGGATAGTGGAAGAGG + Intergenic
903479888 1:23645350-23645372 CAGACTGTGGGTAGAGGAGCAGG + Intergenic
903501889 1:23805030-23805052 GAGAATGAGGATGGGGAAGGGGG - Intronic
903643025 1:24872615-24872637 TGGACAGAGGACAGGGGAGGAGG - Intergenic
903677045 1:25071058-25071080 TAGAGTGAGGAATGGGGAGGGGG - Intergenic
903752917 1:25640301-25640323 AAGAATGAGGATGGGGGAGAGGG - Intronic
904478415 1:30779001-30779023 AAAACTGAGGCTCGGGGAGGTGG + Intergenic
904896693 1:33823161-33823183 CTGGCTGAGGAAAGGGGAGGCGG - Intronic
905291465 1:36924478-36924500 CTGGCTGTGGAGAGGGGAGGGGG + Intronic
905380338 1:37557267-37557289 CAGATTTAGGATGGGGAAGGAGG + Intronic
905699157 1:39999068-39999090 GAGACCGTGGAAAGGGGAGGGGG - Intergenic
905976200 1:42175715-42175737 CATACTGAGGATTGGGGCCGTGG - Intergenic
906434876 1:45786898-45786920 CACACTGAGAATAGTGGAGCAGG - Intergenic
906804405 1:48766477-48766499 CTTACTGAGGATAGAGGACGTGG - Intronic
907467963 1:54652022-54652044 CAGATTGAGGGTAGGGGTGCTGG + Intronic
907876940 1:58499221-58499243 CAGGCTGGGGATCGGGGAGTAGG + Intronic
908693660 1:66811626-66811648 GAGAGTGAGGAGTGGGGAGGAGG + Intergenic
909206090 1:72759527-72759549 AAGACTCAGGATAGGGAGGGTGG - Intergenic
909520971 1:76567031-76567053 AAGAATGAGGACAGGGAAGGAGG + Intronic
910302001 1:85716456-85716478 TAGGTTGAGCATAGGGGAGGAGG - Intergenic
910449136 1:87329099-87329121 CAGAAGCAGGAAAGGGGAGGAGG - Exonic
911015393 1:93326453-93326475 GAGAATGAGGATGAGGGAGGAGG + Intergenic
911178782 1:94843088-94843110 CAGGCTGGGCATAGGGGAAGAGG + Intronic
912164866 1:107031060-107031082 AAGAATGAGGATGAGGGAGGAGG - Intergenic
912333475 1:108841292-108841314 CAGACTAAGGAAGGGAGAGGAGG + Intronic
914243229 1:145866796-145866818 GAGACTGAGGATATGGAAGTGGG - Intronic
914835698 1:151205109-151205131 CAAACTGGGGAGAGGGAAGGTGG + Intronic
914875988 1:151512952-151512974 CGGACTGAGGACCAGGGAGGTGG + Intronic
915034341 1:152909826-152909848 CTGACTGAGGGCAGGGGAGAGGG - Exonic
915112629 1:153574488-153574510 GAGACTGTGGAAAGGGGAGAGGG - Intergenic
915137590 1:153744282-153744304 CAGACTCAGGACAGGGAAGCAGG - Intronic
915142773 1:153777385-153777407 CAGACTGAGGAACGGTGAGGGGG + Intronic
915245559 1:154553793-154553815 CTCACTGAGCATAGGGAAGGAGG + Intronic
915302133 1:154957758-154957780 CAGCCTGTGGGTAGGGGATGCGG - Exonic
915493912 1:156267582-156267604 CAGGCTGAGGTTGGGTGAGGAGG + Exonic
915706671 1:157850602-157850624 CAGACTGGGAGTAGGGGAGGAGG + Intronic
915936338 1:160092249-160092271 CAGAGTGAGGAGGGTGGAGGGGG + Intronic
915977724 1:160401396-160401418 CAGACCGAGGATGGGGCTGGAGG + Intronic
916132504 1:161623722-161623744 GGGACTGAGGATTGGGGTGGGGG - Intronic
916412359 1:164559073-164559095 GAGAAGGAGGAGAGGGGAGGGGG - Intronic
917416436 1:174815135-174815157 CAGAGTGGGGAACGGGGAGGTGG - Intronic
917565326 1:176207040-176207062 GAGGCTGAGGGGAGGGGAGGCGG - Exonic
918107716 1:181427794-181427816 CAGAAAGAGGGAAGGGGAGGAGG - Intronic
918113166 1:181475956-181475978 CAGACAGAGGAAAGGGGTTGGGG + Intronic
919204340 1:194401676-194401698 CAGAGTGAGGAGAGGAAAGGAGG + Intergenic
920263659 1:204706575-204706597 CAGACAGCGGAGAGGGGAAGAGG + Intergenic
920274259 1:204792308-204792330 AAGACAGAGGCTGGGGGAGGGGG + Intergenic
920570905 1:207016555-207016577 CAGAGTGTGGATTGGGAAGGAGG + Intronic
920720149 1:208379739-208379761 CAGGGTGCGTATAGGGGAGGGGG - Intergenic
922041219 1:221900675-221900697 TGGAGTGAGGAAAGGGGAGGTGG + Intergenic
922378110 1:224990463-224990485 CAGGCTGAGGGTAGGGGAAATGG - Intronic
922471592 1:225880423-225880445 CAGGCTGAGGAGAAGGCAGGGGG + Intronic
922669107 1:227495239-227495261 CAATCTGAGGCTGGGGGAGGTGG - Intergenic
922670490 1:227506063-227506085 CAATCTGAGGCTGGGGGAGGTGG + Intergenic
923205571 1:231755662-231755684 CAGACTGGGGATATAGGAGAAGG - Intronic
923365672 1:233258537-233258559 CTGCCTGAGGGTGGGGGAGGAGG - Exonic
1062838621 10:652418-652440 CAGCCTGAGGGAAGGGGTGGAGG - Exonic
1063964852 10:11338923-11338945 CAGGGTGAGGATGGGGGTGGGGG - Intergenic
1064279683 10:13940313-13940335 GAGAGTGAGGAAAGGTGAGGAGG - Intronic
1064909034 10:20379881-20379903 CAGACTGAGGATGTTGGTGGTGG - Intergenic
1065088576 10:22206029-22206051 CAGACAGGGGATAGGGGAGGGGG - Intergenic
1067081209 10:43213436-43213458 CAGGGTGAGAAGAGGGGAGGGGG + Intronic
1067448904 10:46369232-46369254 CAGACTGAGTCTGTGGGAGGCGG + Intronic
1068846725 10:61684706-61684728 AAGACAGAGGATACTGGAGGTGG - Intronic
1069570933 10:69493944-69493966 CAGAGCGAGGCTCGGGGAGGAGG + Intronic
1069841295 10:71341039-71341061 CAGTCTGGGGAGAGGAGAGGCGG + Intronic
1071325746 10:84515390-84515412 GAGACTGGAGATGGGGGAGGGGG - Exonic
1071432848 10:85619701-85619723 GGGTCTGAGGGTAGGGGAGGAGG + Intronic
1071464953 10:85931191-85931213 GAGAAGGAGGAAAGGGGAGGAGG - Intronic
1072000940 10:91195070-91195092 GAGAGTGAGGATGGGGAAGGTGG + Intronic
1072428095 10:95347412-95347434 CAGATAGAGGAGAGGGTAGGAGG - Intronic
1072797568 10:98367647-98367669 CAGACTGAGGCTCAGAGAGGAGG - Intergenic
1073295259 10:102434907-102434929 CAAACAGGGGATAGGGGAGAGGG - Intergenic
1073653416 10:105386027-105386049 AAGATTGAACATAGGGGAGGGGG - Intergenic
1074090499 10:110248948-110248970 TAGACTTAGGATAGGGGAGGTGG + Intronic
1074243116 10:111658969-111658991 CAAACTGGGGAGAAGGGAGGAGG - Intergenic
1074522861 10:114240374-114240396 CAGACAGAAGAGAAGGGAGGAGG + Intronic
1074778848 10:116785878-116785900 CAGTCTAAGGTGAGGGGAGGGGG - Intergenic
1074856401 10:117477189-117477211 CAGAGTGAGGAGAGGCTAGGAGG + Intergenic
1075181616 10:120216023-120216045 GAGACCGTGGAAAGGGGAGGGGG + Intergenic
1076243581 10:128928663-128928685 GAGACTGGGGGAAGGGGAGGCGG - Intergenic
1076379573 10:130015794-130015816 CAGGCTGGGGATTGGGGAGCAGG + Intergenic
1077748051 11:4930536-4930558 CAGAATGAGGATTGGGTAGATGG - Intronic
1078151337 11:8761998-8762020 AAGAGTGAGGATGAGGGAGGAGG - Intronic
1078392055 11:10943883-10943905 CAGACTGCGGCTGGGGTAGGTGG + Intergenic
1079102869 11:17552468-17552490 CAGACCTAGGACAGGTGAGGGGG - Intronic
1080831084 11:35893974-35893996 CAGAGAGAGGGTAGGGGAGCAGG - Intergenic
1083470611 11:62881507-62881529 CCGTCTGGGGACAGGGGAGGGGG - Intronic
1083692090 11:64415515-64415537 GGGTCTGAGGAGAGGGGAGGAGG + Intergenic
1083766834 11:64845265-64845287 CACACTGAGGCTTGGGAAGGAGG + Intergenic
1084047070 11:66575241-66575263 CAGCCTGGGGAGCGGGGAGGAGG - Intergenic
1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG + Intergenic
1084220569 11:67675024-67675046 AAGAGTGAGGACAGGAGAGGAGG - Intronic
1084872147 11:72105557-72105579 CAGGCAGAGGGTAGGGGTGGGGG + Intronic
1085042837 11:73336723-73336745 GAAACTGAGGATCAGGGAGGTGG - Intronic
1085113235 11:73907384-73907406 CACACTGCAGACAGGGGAGGTGG + Intronic
1085271461 11:75272633-75272655 CAGACCTAGGATAGAGGAGGAGG + Intronic
1085376520 11:76067467-76067489 CAGACTGAGGCCAGGTGTGGTGG + Intronic
1086855485 11:91860520-91860542 CAACCTGAGGAGAGGGGAGGGGG - Intergenic
1088446680 11:109937957-109937979 CAGACTGGGGATACGGAAAGAGG - Intergenic
1089378697 11:118012680-118012702 CAGATTGGGGATGGGGCAGGGGG + Intergenic
1089777545 11:120848781-120848803 CAGAGCTAGGGTAGGGGAGGAGG + Intronic
1090268153 11:125367820-125367842 CAGAGAGAAGAAAGGGGAGGTGG - Intronic
1090817906 11:130314791-130314813 GGGACTGAGGGGAGGGGAGGGGG + Intergenic
1091157094 11:133384049-133384071 GAGACTGAGGATTGGCCAGGTGG - Intronic
1091600057 12:1912570-1912592 GAGAAGGAGGAGAGGGGAGGGGG + Intronic
1091600157 12:1913097-1913119 CAGTCTGAAGATCGAGGAGGTGG - Exonic
1091636328 12:2199709-2199731 CTGACAGAGGAAAAGGGAGGGGG - Intronic
1091797904 12:3307711-3307733 CAGACAGAGAATGGAGGAGGAGG + Intergenic
1091832195 12:3557714-3557736 GAAACTGAGGCTAGGAGAGGTGG + Intronic
1094249370 12:28341389-28341411 CAAAGTGATGATATGGGAGGGGG - Intronic
1094353301 12:29550463-29550485 CAGACAGAGGAGCGAGGAGGTGG + Intronic
1096066955 12:48748691-48748713 GAGAATGAGGATGGGGGAGGAGG - Intergenic
1096098684 12:48956098-48956120 CTGATTGAGGACAGGGAAGGAGG + Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096788076 12:54029220-54029242 CAGTCTGAGGAGAAGGGAGGGGG + Intronic
1097388476 12:58979749-58979771 CAGACTGAGGAAATGGGCGCTGG + Intergenic
1097670798 12:62535061-62535083 CAGAATGAGGAAGGGGGATGAGG - Intronic
1098038990 12:66335295-66335317 GAGACTGCAGATAGAGGAGGGGG + Intronic
1099779049 12:87171241-87171263 GAGAAGGAGGAGAGGGGAGGAGG + Intergenic
1100886744 12:99079323-99079345 CAAACTGAGGATAGAGAAGGGGG + Intronic
1101324059 12:103698831-103698853 CAGACTGAAGATATGAGAGCTGG - Intronic
1101640732 12:106584318-106584340 AAGAATGAGCCTAGGGGAGGGGG - Intronic
1102006144 12:109590460-109590482 CAGAGAGGGGATAGGGGAGAAGG - Intronic
1102167837 12:110820680-110820702 GGGACTGGGGAGAGGGGAGGAGG - Intergenic
1103183395 12:118934876-118934898 TAGCCTGAGGATAGGAAAGGGGG + Intergenic
1103209795 12:119157785-119157807 CAGCCTGGGCAGAGGGGAGGGGG - Exonic
1103988661 12:124784019-124784041 CAGAATGGGGACAGGGAAGGAGG - Intronic
1104391897 12:128397851-128397873 GAGGCTGAGCAGAGGGGAGGTGG - Intronic
1104636142 12:130438797-130438819 GAGACTGAGGACAGGTAAGGAGG - Intronic
1104724424 12:131067036-131067058 CAGGCTCAGGATAGGAGTGGAGG + Intronic
1105024993 12:132842250-132842272 CAGTCTGTGGAGAGGGAAGGTGG - Intronic
1106566369 13:30888084-30888106 CTGACTGCTGATAGGAGAGGTGG + Intergenic
1106700996 13:32228522-32228544 CAGACTGATGCTAGAGGAGGTGG - Exonic
1107636118 13:42394353-42394375 AAGACTGGGGAAAGGAGAGGAGG + Intergenic
1108427944 13:50324360-50324382 CAGAATGAGAATAGGGGGTGAGG - Intronic
1108496977 13:51034907-51034929 TAGACTGGGGAGCGGGGAGGTGG - Intergenic
1111270318 13:85873725-85873747 CAGATTGAGGATAGGGCATTAGG - Intergenic
1111566034 13:90017337-90017359 CAGACTGAGGCTGGGTGTGGTGG - Intergenic
1112463221 13:99621270-99621292 AAGATGGAGGATAGGTGAGGAGG - Intronic
1112796076 13:103058006-103058028 CAGACTGAGGGCTGGGGAGGGGG + Intronic
1113059325 13:106304666-106304688 CAGACTGTGGAGGAGGGAGGTGG + Intergenic
1113382976 13:109820677-109820699 GAGAGTGAGGGTGGGGGAGGAGG - Intergenic
1115414445 14:33114922-33114944 CAGCCTGAGGATATGGGCTGTGG + Intronic
1115562010 14:34591054-34591076 CTGCCTGGGGATAGGGCAGGAGG + Intronic
1116005525 14:39286426-39286448 GAGACTGTGGAGAGGGGAGAGGG + Intronic
1118139023 14:63059468-63059490 GAAAGTGAGGATATGGGAGGAGG + Intronic
1118900403 14:69981072-69981094 CAGAAGGAGGCTGGGGGAGGAGG + Intronic
1118974554 14:70665449-70665471 GAGAGGGAGGAGAGGGGAGGGGG + Intronic
1121167431 14:91818933-91818955 AAGACTGGGGATAGGGGGGAGGG + Intronic
1121328179 14:93033940-93033962 GGGACTGAGGATGGGGCAGGGGG + Intronic
1121559966 14:94867149-94867171 CAGACTGGGGATTTGGGAGAGGG - Intergenic
1121563816 14:94893939-94893961 CCTACTGAGGATGGGGGTGGTGG + Intergenic
1121609781 14:95269874-95269896 CAGCCTGTGGATTGGGGTGGGGG - Intronic
1121680850 14:95791662-95791684 CACACTGAGGAGAGGGGAGTGGG - Intergenic
1121740588 14:96249371-96249393 CAGACTGAGGCTCTGGAAGGTGG + Intronic
1121757934 14:96418804-96418826 CCTACTGAGGCTAGGCGAGGTGG - Intronic
1122416072 14:101550098-101550120 CTGACTGAGGGTCCGGGAGGAGG - Intergenic
1122896672 14:104761007-104761029 AAGCCTTGGGATAGGGGAGGAGG - Intronic
1124843067 15:33262977-33262999 GAGAGTGAGGATGGGGCAGGAGG - Intergenic
1125828189 15:42693268-42693290 AAGAGTGAGGATTGGGGAGGAGG - Exonic
1127612239 15:60648072-60648094 CAGACTGAGGGAGGAGGAGGAGG + Intronic
1127620020 15:60724894-60724916 CAGTGTGAGGAGCGGGGAGGAGG - Intronic
1127725804 15:61748470-61748492 CACTCTGAGGATAGGTGAGTAGG + Intergenic
1127761707 15:62146184-62146206 CAGGGTGAGGGTAGGGAAGGAGG - Intergenic
1127971394 15:63965333-63965355 CTGCCTGGGGCTAGGGGAGGGGG + Intronic
1128579909 15:68802238-68802260 CAGACAGAGGATAAGATAGGAGG - Intronic
1128791363 15:70436769-70436791 CAGACTGAGGGTAGCAGAGCAGG - Intergenic
1129389800 15:75214830-75214852 CAGGCTGAGGCTAGGGGCTGTGG - Intergenic
1129656834 15:77530027-77530049 CAGGGTGAGGGTAGGAGAGGTGG + Intergenic
1129695828 15:77740231-77740253 CAGACAGAGGATGTGGGTGGAGG + Intronic
1129717404 15:77860302-77860324 CAGTCTGAGGTGGGGGGAGGGGG - Intergenic
1130241206 15:82193897-82193919 CAGAATGAGGAGAGTGAAGGCGG - Intronic
1130459222 15:84147262-84147284 CAGAATGAGGAGAGTGAAGGCGG + Intergenic
1131164112 15:90129835-90129857 GGGACTGAGGATAGTGGAGGAGG + Intergenic
1131167395 15:90152375-90152397 CAGACAGCGGATGGGGCAGGGGG + Intergenic
1132385550 15:101397736-101397758 AAGGCTGAGGAAGGGGGAGGAGG - Intronic
1132546152 16:534346-534368 CTGGCTGAGGATAGCGGTGGGGG - Intronic
1132702580 16:1228435-1228457 CAGGCTTAGGACAGGGAAGGGGG + Exonic
1132705746 16:1242433-1242455 CAGGCTTAGGACAGGGAAGGGGG - Exonic
1132751584 16:1460142-1460164 CAGAGTGAGGAGATGGAAGGAGG + Intronic
1132852828 16:2032622-2032644 CTGGCTGGGGATAGGGGAGGTGG + Intronic
1132989858 16:2787028-2787050 CGGGGTGAGGATAGAGGAGGAGG - Intronic
1133873782 16:9714027-9714049 CAGACTGAGCAAGGGGGTGGAGG - Intergenic
1135496733 16:22958412-22958434 CAGACAGAGGAGTGGGGAGGAGG - Intergenic
1136000879 16:27291734-27291756 GAAACAGAGGATAGGGGATGGGG - Intergenic
1136539448 16:30921199-30921221 AAGACAGAGGGAAGGGGAGGGGG + Intergenic
1136610566 16:31362779-31362801 GAGGATGAGGGTAGGGGAGGTGG + Intronic
1137434193 16:48442214-48442236 GAGACTGCGGACGGGGGAGGAGG - Intronic
1137805182 16:51297867-51297889 CAGAATGAGGAGTGGGGTGGAGG + Intergenic
1138293942 16:55870871-55870893 GCCACTGAGGAAAGGGGAGGTGG + Intronic
1138455414 16:57117894-57117916 CAGAGTGAGGTGCGGGGAGGAGG - Intronic
1139443967 16:66985320-66985342 CAGGCAGAGGACAGGGGAAGGGG - Intergenic
1140305527 16:73799180-73799202 GAGATTGAGGGTCGGGGAGGTGG - Intergenic
1141658618 16:85429670-85429692 AGGTCTGAGGACAGGGGAGGAGG - Intergenic
1141783478 16:86181587-86181609 CAGGCTGAGGGTTGGGGAGCTGG - Intergenic
1142383718 16:89748936-89748958 CAAACACAGTATAGGGGAGGTGG - Intronic
1142433698 16:90044077-90044099 CAGACTGAGGGTCTGGGATGGGG + Exonic
1142507983 17:377568-377590 GAGAGTGGGGAGAGGGGAGGGGG + Intronic
1143002362 17:3802649-3802671 CAGAATGAAGTGAGGGGAGGAGG - Intergenic
1143480454 17:7224938-7224960 CAGCCTGGGGAGAGGGAAGGAGG - Exonic
1143590114 17:7880200-7880222 CAGACAGAAGAGAGGGGAGAGGG + Intronic
1143714652 17:8758216-8758238 TTGACTGAGGAGAGGGAAGGGGG - Intronic
1143886670 17:10070173-10070195 AAGACTGGGGATAGAGGAGTGGG - Intronic
1144005695 17:11097113-11097135 AAGACTGAAGTTAGAGGAGGAGG - Intergenic
1144034708 17:11354746-11354768 CTGACTGAGGATAGGGGGTGGGG - Intronic
1146175478 17:30663654-30663676 CAGACTGTGGATAAGGATGGAGG - Intergenic
1146348929 17:32079700-32079722 CAGACTGTGGATAAGGATGGAGG - Intergenic
1147760827 17:42796430-42796452 CTAAGTGAGGAAAGGGGAGGTGG - Intronic
1147909551 17:43847345-43847367 GAGGCTGAGGATAGGTGGGGTGG - Intronic
1147960733 17:44166114-44166136 CAGGCTGAGGCTAAGGCAGGAGG - Intergenic
1148020198 17:44548274-44548296 CAGAGTGAGAAGATGGGAGGGGG + Intergenic
1148074933 17:44930040-44930062 CTGACTGAGGGCAGTGGAGGGGG - Intronic
1148088770 17:45010084-45010106 GAGACCGAGGCTGGGGGAGGAGG + Intergenic
1148250049 17:46069455-46069477 CAGACTGAGGCTGGGTGTGGTGG + Intronic
1148578269 17:48726309-48726331 AAGACTGAGGAGAGGGGAACGGG - Exonic
1148680423 17:49470424-49470446 CAGACTGGGGATCGGGGTGGGGG + Intronic
1148963330 17:51411852-51411874 CAGACTGGGGAGAGAGGATGTGG + Intergenic
1149868682 17:60164336-60164358 CAGACTGGAGGGAGGGGAGGAGG - Intronic
1150944916 17:69734525-69734547 CAGATTGAGGATAGGGGAAAGGG - Intergenic
1151197302 17:72440768-72440790 CACACTGAGGCTGGGGGAGAAGG + Intergenic
1152260927 17:79266697-79266719 CAACCTCAGGAGAGGGGAGGGGG + Intronic
1152687487 17:81701763-81701785 TAGGCTGAGGACAAGGGAGGTGG - Exonic
1153243575 18:3052632-3052654 CTGACTGAGGAAGAGGGAGGAGG - Intergenic
1153770502 18:8412044-8412066 AAGGCTGAGGAAAAGGGAGGTGG + Intergenic
1153951808 18:10064152-10064174 CAGACAGTGGGTAGGTGAGGAGG - Intergenic
1153953102 18:10073555-10073577 CAGTCTGAGGCTAGGCGTGGTGG + Intergenic
1155426284 18:25710976-25710998 AAGACTCAGGAAAGGGAAGGGGG + Intergenic
1156599470 18:38587735-38587757 CAGACTGTGGATGTAGGAGGTGG + Intergenic
1156786258 18:40918991-40919013 CAGAATTAAGATAGGGGAGATGG + Intergenic
1157184060 18:45523205-45523227 CAGACTCAGCATAGGGGCTGGGG - Intronic
1157400660 18:47383774-47383796 TAAACTGAGGATTGGGAAGGTGG + Intergenic
1157642805 18:49234501-49234523 AAGCCACAGGATAGGGGAGGAGG - Intronic
1157780951 18:50438706-50438728 GTGACTGGGGATAGGGGAAGGGG - Intergenic
1157824072 18:50796645-50796667 CAGACTGAGCAAAGGTGAGGGGG + Intronic
1158431206 18:57389264-57389286 CAGTTTGGGGTTAGGGGAGGTGG - Intergenic
1158781398 18:60656677-60656699 CACACTGAGGAACTGGGAGGTGG - Intergenic
1158782048 18:60663453-60663475 CAGACTGAGGATGTGGCAGATGG - Intergenic
1160979831 19:1811823-1811845 CAGACTGGGGATTGGAGAGTTGG + Exonic
1160991618 19:1862628-1862650 GAAACTGAGGCTGGGGGAGGGGG + Intronic
1161012616 19:1967854-1967876 CAGCCTGGGGAGAAGGGAGGAGG - Intronic
1161012637 19:1967915-1967937 CAGCCTGGGGAGAAGGGAGGAGG - Intronic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1161509650 19:4663375-4663397 TAGAATGAGGATGGGGTAGGTGG - Intronic
1161509762 19:4663819-4663841 CAGAATGAGGATGGGGTGGGTGG - Intronic
1161550153 19:4908465-4908487 CCCACTGAGCAAAGGGGAGGGGG - Intronic
1161828544 19:6586176-6586198 CAGGCTGATGCTACGGGAGGCGG + Exonic
1162983488 19:14254257-14254279 CAGACTGTGGATAAGGATGGAGG + Intergenic
1163218119 19:15895546-15895568 CAAACTGAGGAGGGGGGAGATGG + Exonic
1163384297 19:16989896-16989918 CTCCCTGAGGATTGGGGAGGGGG - Intronic
1163843851 19:19627966-19627988 CAGACTGGGGAAGGGGTAGGGGG + Exonic
1164412474 19:28017447-28017469 GAAACTGAGGAGAGGGGATGTGG - Intergenic
1164467314 19:28498695-28498717 CAGGGTCAGGATAGGGGAGCAGG + Intergenic
1164813458 19:31176144-31176166 CAGACTGAGGCAAGGCCAGGTGG + Intergenic
1164828056 19:31298736-31298758 GAGACAGAGAATAGGGGATGAGG + Intronic
1165086385 19:33350989-33351011 CAGACTGGGGAGGGGGGTGGGGG + Intergenic
1165352308 19:35282446-35282468 GAGACAGAGCAAAGGGGAGGGGG + Intronic
1165704089 19:37962777-37962799 CAAACTGAGGCTGGGTGAGGTGG - Intronic
1166306945 19:41940515-41940537 CAGATTCAGGAAAGGGGAGGGGG + Intergenic
1166696766 19:44856325-44856347 GAGACTGAGTGTTGGGGAGGAGG - Intronic
1166759969 19:45218168-45218190 CTGCCTGAGGGGAGGGGAGGTGG - Intronic
1167125051 19:47543934-47543956 CAGAATGAGGCCAGGTGAGGTGG - Intronic
1167578258 19:50328069-50328091 GAGACTCAGGATTGGGGAAGAGG + Intronic
1167711748 19:51115865-51115887 CAGACTGAGGAGGGGACAGGAGG + Intergenic
1168129630 19:54310073-54310095 CCCACTCAGGACAGGGGAGGAGG - Intronic
1168250120 19:55137209-55137231 CTGCCTGAGGGTGGGGGAGGCGG + Exonic
1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG + Intronic
925591660 2:5515971-5515993 GAGATTGAGGATAAAGGAGGTGG + Intergenic
926055887 2:9773728-9773750 AAGTCTGAAGAGAGGGGAGGCGG - Intergenic
926288792 2:11511931-11511953 CAGTCAGAGGAAAGGGGCGGTGG - Intergenic
926495088 2:13576229-13576251 TAGCCTGAGGACAGGGGTGGTGG - Intergenic
927207727 2:20620653-20620675 GAGACTGAGGACCAGGGAGGAGG - Intronic
928114093 2:28533973-28533995 GAGACAGAGGATTAGGGAGGTGG - Intronic
928402006 2:30985814-30985836 AAGGCTGAGGGGAGGGGAGGGGG - Intronic
929608455 2:43251774-43251796 AGGCATGAGGATAGGGGAGGAGG - Intronic
929889794 2:45909648-45909670 CAGAATGGGGGTAGGGGATGAGG - Intronic
929964220 2:46521525-46521547 CAGACTGAGGAAGGAGGAGAAGG + Intronic
930000044 2:46855132-46855154 AAGAATGAGTATAGGGGATGAGG + Intronic
931224345 2:60316685-60316707 CAGACTGAGGTGAGGGGGTGTGG - Intergenic
932621059 2:73265193-73265215 AAGTCTGGGGAAAGGGGAGGGGG + Intronic
932786491 2:74609210-74609232 GAGGCTGAGGATAGGGGGGAAGG - Intronic
933813510 2:86048166-86048188 CAGCCTGAGGAGTGGGGAGGAGG - Intronic
934810051 2:97270014-97270036 CAGCCTGAGGACACTGGAGGAGG - Intergenic
934827641 2:97437925-97437947 CAGCCTGAGGACACTGGAGGAGG + Intergenic
934960131 2:98665727-98665749 CAGAGTGATGAATGGGGAGGGGG + Intronic
935147443 2:100405474-100405496 CAGAGAGAGGATGGGGCAGGAGG + Intronic
935176729 2:100655422-100655444 CACACCGAGGAAAGGGGATGGGG + Intergenic
935889378 2:107659246-107659268 AAGACTGGGGTTAGGGGAGGTGG + Intergenic
936284717 2:111173245-111173267 CAGAGTGAGGATGGGGCAGTGGG - Intergenic
936934564 2:117826765-117826787 GAGACAGAGGGCAGGGGAGGAGG - Intronic
937061477 2:118983244-118983266 CAGGCAGAGGACAGGGGTGGAGG - Intronic
937250224 2:120519144-120519166 CTGGCTGAGGATAGGAGAGCTGG - Intergenic
937924947 2:127160867-127160889 CAGTCTGAGGACAGGAGAGGAGG - Intergenic
938141105 2:128795193-128795215 CAGACAGAGGGAAGGGCAGGTGG + Intergenic
938676066 2:133635207-133635229 CAGACAGAGGAAAAGGAAGGGGG + Intergenic
938726501 2:134113408-134113430 AAGACTGAGGAGGGGGGAGGGGG - Intergenic
938842795 2:135179268-135179290 CAGAATGAGGCTGGGTGAGGTGG + Intronic
940274747 2:151927507-151927529 GAGACTGAGGATGGGGGAAGAGG + Intronic
940599445 2:155839370-155839392 CAGACTGAGGTTAGAGTTGGAGG - Intergenic
941169642 2:162120862-162120884 GGGAATGAGGATGGGGGAGGAGG + Intergenic
941212376 2:162657085-162657107 CAGGTTGTGGATAGTGGAGGAGG - Intronic
941371853 2:164675210-164675232 CAGACTGATGGTTGGGAAGGAGG + Intronic
942014437 2:171796901-171796923 TAAACTGGGGATAGGGAAGGGGG + Intronic
942426166 2:175863137-175863159 CAGACCCAGGATGGGAGAGGGGG - Intergenic
942567732 2:177283153-177283175 CAGGGTGAGGAAAGGGGAGTAGG + Intronic
942617488 2:177809097-177809119 CAGGCTGAAGAGAGGGGAGTGGG + Intronic
942996267 2:182264022-182264044 GAGACTGAGGATGGGGGAAGAGG + Intronic
943208276 2:184928459-184928481 CAGCCTGGGGTTAGGGGAGGGGG + Intronic
943570381 2:189566775-189566797 GAAAGTGAGGATGGGGGAGGAGG + Intronic
944675522 2:202032498-202032520 GAGACAGAGGAAAGAGGAGGAGG + Intergenic
946010513 2:216560188-216560210 CAGAGGGAGGAGAGGGGAGGGGG - Intronic
946042258 2:216792419-216792441 CAGACTGGGGACAGGGGTGGTGG + Intergenic
946328689 2:218997833-218997855 CAGACTGGGGGTGGGGGCGGGGG - Intergenic
946918965 2:224558389-224558411 TAGAGTGAGGATGGAGGAGGTGG - Intronic
947593424 2:231397105-231397127 CAGACTGGAGAAGGGGGAGGAGG + Intronic
947921129 2:233875311-233875333 GAGACTGAGGCTGGGGGAAGTGG + Intergenic
948098404 2:235354687-235354709 CAGAATTTGGATAGGAGAGGTGG - Intergenic
948826207 2:240574478-240574500 GAGACAGAGGAGAGGTGAGGGGG - Intronic
948995816 2:241577676-241577698 GAGACAGAGGAAAGGGGAGGAGG + Intergenic
1168932598 20:1636119-1636141 CAGCCTGGGGAGAGGGGAGTGGG + Intronic
1168979039 20:1989391-1989413 AAGACTGAGGCTTGTGGAGGAGG - Intronic
1169536360 20:6546222-6546244 CTGACAGAGGATGGGAGAGGTGG + Intergenic
1170480109 20:16756847-16756869 AAGAGAGAGGAGAGGGGAGGAGG + Intronic
1170810482 20:19670191-19670213 CACACTGAGGAGAGGGGGTGGGG + Intronic
1171253921 20:23671837-23671859 CATAGAGAGGCTAGGGGAGGAGG - Intergenic
1172014471 20:31864744-31864766 GAGACTGAGGCTCGGGGAGGTGG + Intronic
1172307279 20:33889545-33889567 CAGCCTGAGGAGAAGGCAGGTGG - Intergenic
1172644084 20:36459087-36459109 CAGGCTGGGGATTAGGGAGGGGG + Intronic
1172735646 20:37125210-37125232 GAGACCGTGGAAAGGGGAGGGGG - Intronic
1172881722 20:38204437-38204459 AGGACTGGGGATAGGGGAGGTGG - Intergenic
1172963223 20:38813450-38813472 CAGACTGATGGAAGGGAAGGTGG + Intronic
1173349876 20:42234860-42234882 CACACTGAGCAGAGGGGATGGGG + Intronic
1173410992 20:42809250-42809272 CAGACTGAGGACAGGAGAAAGGG + Intronic
1173551735 20:43937452-43937474 CAGTTTGAGGAAGGGGGAGGAGG + Intronic
1173857712 20:46261488-46261510 CAGACTCAGGCTAGGGGAAAGGG + Intronic
1174089836 20:48038047-48038069 CAGACTGGGGAAAGGTCAGGGGG + Intergenic
1174406800 20:50308110-50308132 CAGACTGAGGCCAGGCGCGGTGG - Intergenic
1175723631 20:61302538-61302560 CTGACTGAGGTTGGGGGTGGGGG + Intronic
1175751494 20:61501171-61501193 TAGACTCAGGCTGGGGGAGGTGG + Intronic
1175825927 20:61936485-61936507 CAGTCTGTGGGCAGGGGAGGCGG - Intronic
1176016213 20:62934532-62934554 GAGACTGAGGAGCAGGGAGGGGG - Intronic
1178517256 21:33258369-33258391 CAGAGTGAGGATGAAGGAGGGGG + Intronic
1180605906 22:17058469-17058491 CTGATGGAGGATTGGGGAGGTGG + Intergenic
1180635968 22:17263258-17263280 CAGACAGAGCAGTGGGGAGGTGG + Intergenic
1181284024 22:21739344-21739366 CAGAGTTAGCAGAGGGGAGGAGG - Intergenic
1181540694 22:23571619-23571641 AAGACTGAGGGATGGGGAGGGGG - Intergenic
1181728789 22:24830006-24830028 CAGACTGTGGACAGGGGAAGAGG - Intronic
1182008882 22:26983910-26983932 CAGAGTGAGGACAGGAGAAGAGG - Intergenic
1182740245 22:32562316-32562338 CAGGCTGAGGACAGGGCAGCGGG + Intronic
1183078957 22:35444198-35444220 AAGAGAGAGGAAAGGGGAGGAGG + Intergenic
1183086704 22:35491400-35491422 CCGACTGGGGATAGGGGTGGAGG - Intergenic
1183498076 22:38161797-38161819 CAGGCTGAGGGGAGGGAAGGAGG + Intronic
1183529958 22:38347990-38348012 AAGACTGAGGCTTGGAGAGGTGG - Intronic
1184019803 22:41813423-41813445 CAGGCTGAGGATGGGCGAGTGGG - Exonic
1184448708 22:44570146-44570168 CAGAAAGAGAAAAGGGGAGGAGG - Intergenic
1184452165 22:44589720-44589742 CAGAAGGAGGAGAGAGGAGGAGG + Intergenic
1185208105 22:49551770-49551792 CAGACGCAGGATAAGGGAAGCGG - Intronic
1185229760 22:49673452-49673474 GAGACAGAGGGCAGGGGAGGGGG + Intergenic
949510813 3:4765177-4765199 AAGGCTAAGCATAGGGGAGGTGG + Intronic
950009167 3:9710456-9710478 GAGAATGAGGATGGGGGAGGAGG + Intronic
950119380 3:10471485-10471507 CAGAGGGAGGGTACGGGAGGAGG + Intronic
950719048 3:14869600-14869622 CTGCCAGGGGATAGGGGAGGAGG - Intronic
950844834 3:16005040-16005062 CAGAGATAGGATGGGGGAGGCGG - Intergenic
951644357 3:24871930-24871952 CAGGGTGATGATAGGGGAAGTGG - Intergenic
951666136 3:25125941-25125963 CAGACTGAGGGTGGGAGAGAGGG + Intergenic
952653481 3:35755314-35755336 CAGACTTAGGTTTGGGAAGGTGG - Intronic
952879038 3:37971548-37971570 CAGATTGGGGGTAGGGGTGGAGG - Intronic
953004900 3:38969163-38969185 CAGACTGAGGCTAGGATAGGTGG + Intergenic
954091499 3:48287915-48287937 GAGAGTGAGGAAGGGGGAGGAGG + Intronic
954183211 3:48898003-48898025 CAGACTGAGGCTTGGGAGGGAGG - Intronic
954334526 3:49908607-49908629 CAGACTGAATATGGGGGTGGGGG + Intronic
954347718 3:50014170-50014192 CAGAGTGAGGATTGGCAAGGGGG + Intronic
954385307 3:50241039-50241061 CTGCCTGAGGGCAGGGGAGGGGG - Intronic
954452745 3:50580452-50580474 CAGCCTGACCAGAGGGGAGGTGG + Exonic
955003217 3:54946212-54946234 CAGCCTGAAGCTAGGGGTGGAGG - Intronic
955386799 3:58487086-58487108 GAGAGAGAGGAGAGGGGAGGAGG + Intergenic
955592341 3:60551472-60551494 CAGAGAGAGGGTAGGGGAGAGGG + Intronic
956641284 3:71417930-71417952 CAGACTGTGGATAGGAAATGTGG + Intronic
957479302 3:80770777-80770799 CAGGCACAGGATAGGGGACGTGG + Intergenic
958028464 3:88077172-88077194 AAGAATCAGAATAGGGGAGGAGG + Intronic
959498148 3:107074838-107074860 CAGACACAGGATATTGGAGGTGG - Intergenic
959498513 3:107078623-107078645 CAGACTGAGGCTGAGGCAGGAGG - Intergenic
959531790 3:107441575-107441597 GAGAGTGAGGATGGTGGAGGAGG + Intergenic
959846837 3:111042719-111042741 CAGACTAGGGTCAGGGGAGGGGG - Intergenic
960369974 3:116823220-116823242 GAGAGTGAAGAGAGGGGAGGTGG + Intronic
960443739 3:117721605-117721627 GAGACTGAGGATGAGGGAGATGG + Intergenic
961491933 3:127262436-127262458 CAGACTGAGGAGGGGAGAGCAGG - Intergenic
961820527 3:129573497-129573519 CAGAGTGAGGACAGAGGATGGGG + Intronic
962169241 3:133083185-133083207 CAGGCTGAGGAGTGGGGCGGCGG - Intronic
963248708 3:143085277-143085299 CATATTGAGGAAATGGGAGGAGG + Intergenic
963273642 3:143309222-143309244 CAGTCTGAGGCTTGGGAAGGTGG + Intronic
965672967 3:171165722-171165744 GAGACTGAGGATGGGAGGGGAGG - Intronic
965732811 3:171790668-171790690 CAGACAGAGAATAGAGGAAGAGG - Intronic
966933564 3:184691313-184691335 CATTCTGAGCATAGGGCAGGCGG - Intergenic
968652499 4:1765842-1765864 CAGAGTGGGGAGAAGGGAGGAGG + Intergenic
969053773 4:4389171-4389193 CAGACTGAGGACAAGAGAGGAGG - Intronic
970163769 4:13215064-13215086 CAGGTTGAGGATAGAGAAGGGGG - Intergenic
970169426 4:13274996-13275018 CAGACTGAGGAGAGGAGAAGTGG - Intergenic
971394420 4:26215156-26215178 GAGAAGGAGGATAGGGAAGGAGG + Intronic
972098752 4:35383959-35383981 CACACTGAGGAAAGGTAAGGTGG + Intergenic
972200135 4:36704086-36704108 CAGAGTTAGGATTGGGAAGGAGG - Intergenic
973646572 4:52956428-52956450 CAGGCTGAGGGAAGGGCAGGTGG + Intronic
973830631 4:54755694-54755716 GAGATAGAGGAAAGGGGAGGAGG - Intergenic
976258618 4:83124813-83124835 CAGGCAGAGGAGAGGAGAGGAGG + Intronic
976581881 4:86746489-86746511 CAGAATCATGATAGGGGTGGAGG + Intronic
977566872 4:98589457-98589479 CAGACAAAGGAAAGGGAAGGAGG + Intronic
978835532 4:113145542-113145564 CAGACAGAGAGCAGGGGAGGGGG - Intronic
978989238 4:115057423-115057445 AAGAATGAGGAAAGGAGAGGAGG + Intronic
979446119 4:120813982-120814004 AAGACTGAAGATTGGGGATGAGG - Intronic
980947785 4:139339825-139339847 CAGACTGAAGATAGGTGGGTTGG + Intronic
984021590 4:174490176-174490198 TAAACTGAAGTTAGGGGAGGGGG - Exonic
984977467 4:185242374-185242396 CAGACTGACGTTGGGGGTGGGGG - Intronic
985549738 5:526955-526977 CAGTCCGAGGGTAGGGGAGTGGG - Intergenic
985660994 5:1156368-1156390 GAGTCTGGGGATGGGGGAGGTGG - Intergenic
985703498 5:1387408-1387430 CAGGCTGGGGTGAGGGGAGGAGG + Intergenic
986546498 5:8903761-8903783 CTGACTCAGGATAGGAGAGAAGG - Intergenic
987508373 5:18801527-18801549 AAGACTCAGAAGAGGGGAGGGGG - Intergenic
988452593 5:31358196-31358218 TAGACTGAAGATAGTGGAAGAGG - Intergenic
991577021 5:68115253-68115275 CAGACTCAGGCTGGGTGAGGTGG - Intergenic
992074363 5:73177178-73177200 CAGGCTGAGGATGGAGGAGAGGG - Intergenic
992673063 5:79078829-79078851 AAGAGTAAGGATAAGGGAGGAGG + Intronic
993777593 5:92019759-92019781 GAAACTGAAGATAAGGGAGGAGG + Intergenic
995283807 5:110364316-110364338 CACACTGAGGATGGAGGAGGGGG - Intronic
996322117 5:122230510-122230532 CAGATTGGGGGTAGGGGAGGTGG + Intergenic
996343112 5:122459855-122459877 AAGAGTGAGGCTAGGGAAGGGGG - Intronic
996716438 5:126591667-126591689 CACACTGAGGATGGGGGTAGTGG + Intronic
997262170 5:132473744-132473766 CTCACTGAGGTTTGGGGAGGGGG + Intronic
997589175 5:135062472-135062494 GAGTCTGAGGATAGGAGAGGAGG + Intronic
997610547 5:135212864-135212886 CAGGCTGAGGCTGGGGGATGGGG - Intronic
998065057 5:139151228-139151250 TAGACTGAGGACAGAGGAAGGGG + Intronic
998251544 5:140557098-140557120 CAGACGGAGAATGGGGGGGGGGG - Intronic
998773591 5:145573487-145573509 CGGGCAGAGGAAAGGGGAGGGGG - Intronic
998971090 5:147593272-147593294 CAGACTGGGAATAGGGCAGTGGG + Intronic
999173398 5:149614655-149614677 CTGACTGTGGGCAGGGGAGGTGG - Intronic
999242185 5:150134065-150134087 CAGCTTGGGGATAGGGTAGGGGG + Intronic
999969374 5:156843920-156843942 GAGAGTGAGGATGGGGAAGGAGG + Intergenic
1001425273 5:171618516-171618538 CAGCCCCAGGAAAGGGGAGGAGG - Intergenic
1002104906 5:176875229-176875251 CAGGCTAAGGATGGGGGAGTGGG - Intronic
1002586598 5:180252669-180252691 CACACTGAGGACTGGGGAGACGG + Intronic
1002776997 6:336711-336733 AAGATTGAGGATGGTGGAGGGGG + Intronic
1003015834 6:2466830-2466852 CAGGCTGAGGATCGGCCAGGTGG + Intergenic
1003424161 6:5985892-5985914 CAGCCTGAGTATAGGGTAGCAGG + Intergenic
1003452774 6:6251557-6251579 CAGACTGATGATAGACGGGGAGG - Intronic
1006180470 6:32150772-32150794 CAGACTGATGGTAGTGGTGGTGG + Exonic
1006210082 6:32386057-32386079 GAGACTGTGGAAAGGGGAGAGGG + Intergenic
1006391076 6:33759026-33759048 CAGAGGCAGGATGGGGGAGGAGG + Intergenic
1006412164 6:33880295-33880317 GAGAGTGAGGGTAGGGGAGAGGG - Intergenic
1006457952 6:34142797-34142819 CAGACGCAGGTTGGGGGAGGAGG + Intronic
1006741352 6:36311300-36311322 CAGACTGAGGATAAGGGTGTGGG + Intergenic
1007236291 6:40393118-40393140 GAGACAGAGGAGAGGGGAGGAGG + Intronic
1007312643 6:40958795-40958817 CTGCCTGAGCATAGAGGAGGAGG - Intergenic
1007351249 6:41275143-41275165 CAGACTGAGAGAAGAGGAGGAGG + Intronic
1007397462 6:41585918-41585940 CAGGCTGAGGTAAGGGGAGGTGG - Intronic
1007565196 6:42844694-42844716 CAGACTGAGGAGAGAGCAGGAGG + Intronic
1007657747 6:43462151-43462173 CAGAGTGAGCAGAGAGGAGGAGG - Intergenic
1007915540 6:45558208-45558230 CAGATTGAGGATTGGGATGGGGG - Intronic
1008016420 6:46525596-46525618 CAGACTGAGGATGAGGAAGAAGG + Intergenic
1008095804 6:47338098-47338120 GAGACTGGGAGTAGGGGAGGGGG + Intergenic
1010113370 6:72269922-72269944 GGGACTGAGGACAGGGGAGGAGG - Intronic
1010807997 6:80261382-80261404 CAGTCTGTGGCCAGGGGAGGAGG + Intronic
1010910335 6:81547335-81547357 AAGCCAGAGGATGGGGGAGGTGG - Intronic
1011582244 6:88882009-88882031 GTGACTGAGAGTAGGGGAGGTGG - Intronic
1012367861 6:98464192-98464214 CAAACTGGGGAAAAGGGAGGAGG + Intergenic
1012401337 6:98844913-98844935 CAGACTGTGGTTAAGGGGGGCGG - Intergenic
1014016280 6:116533974-116533996 CAGACTATGGATAGTGGAGAAGG - Intronic
1015405652 6:132834306-132834328 CAGAAAGAGGATGAGGGAGGAGG + Intergenic
1016417515 6:143848566-143848588 TGGGCTGAGGATAGGGCAGGTGG + Intronic
1016620339 6:146102166-146102188 CAGATTGAGGATATGGGCAGTGG - Intronic
1017053439 6:150416031-150416053 GAGACTGAGGACATGGGAGGTGG + Intergenic
1017053445 6:150416073-150416095 GAGACTGAGGACATGGGAGGTGG + Intergenic
1018095860 6:160386578-160386600 CAGAGTGAGGGAAGGGGAGTGGG + Intronic
1018151006 6:160939810-160939832 CAGTCTGAGGACATGGCAGGGGG - Intergenic
1018673434 6:166198206-166198228 CAGAGTCAGGATGGTGGAGGAGG - Intergenic
1018693980 6:166375381-166375403 CAAACTGTGGATAAGGGGGGTGG + Intronic
1018900514 6:168049680-168049702 CAGGCTCAGGAGAGGAGAGGAGG + Intergenic
1019848524 7:3529918-3529940 CAGACTCTGGTTAGGGGACGTGG + Intronic
1020318726 7:6925117-6925139 CAGCCTGGGGACAGCGGAGGTGG + Intergenic
1020904554 7:14048951-14048973 GAGAGTGAGGATGGGGAAGGAGG - Intergenic
1022005221 7:26261255-26261277 GAGACCGTGGAAAGGGGAGGGGG - Intergenic
1022728030 7:32998323-32998345 GAGGCTGAGGAAAGGGGAAGTGG + Intronic
1023618759 7:42048429-42048451 CCGAGTGAGGAGCGGGGAGGAGG + Intronic
1024306123 7:47931052-47931074 CAGACTGGGGATTGGAGAAGTGG + Intronic
1025016023 7:55439770-55439792 CTGCCTGAGGATGGAGGAGGCGG + Intronic
1025045623 7:55689696-55689718 GAGGCTGAGGAAAGGGGAAGTGG - Intergenic
1025198864 7:56949908-56949930 GAGAATGAGGAAAGCGGAGGAGG - Intergenic
1025673082 7:63627025-63627047 GAGAATGAGGAAAGCGGAGGAGG + Intergenic
1026136090 7:67662328-67662350 AAGTCTGAGGATGAGGGAGGTGG - Intergenic
1026142249 7:67716303-67716325 CAGACTGAGGCTGGGTGTGGTGG + Intergenic
1026938706 7:74274231-74274253 AAGACAGAGGATATGGGATGGGG - Intergenic
1027230893 7:76271759-76271781 CAGAAGGAGGATTTGGGAGGTGG + Intronic
1029237856 7:99137369-99137391 CACAATGAAGAAAGGGGAGGGGG - Intronic
1029998293 7:105031350-105031372 CCGTCTGAGGATTGGGGGGGTGG + Intronic
1030034951 7:105401047-105401069 GTGACTGAGGAGAGAGGAGGGGG - Intergenic
1031014724 7:116560541-116560563 CAGAAAGAAGATGGGGGAGGAGG + Exonic
1031923663 7:127619362-127619384 CAGTCTGAGGATGCTGGAGGAGG - Intergenic
1032095259 7:128935087-128935109 CAGACTGAGGGTGTGGTAGGAGG - Intergenic
1032585159 7:133139681-133139703 CAGAACTAGGATAGGGGAGCTGG - Intergenic
1033890430 7:146006398-146006420 CAGGGGGAGGATGGGGGAGGAGG - Intergenic
1034034303 7:147802757-147802779 GAGACTGTGGAAAGGGGAGAGGG + Intronic
1034289035 7:149913383-149913405 CAGACTGAGGATAGGGGAGGCGG + Intergenic
1034662036 7:152779466-152779488 CAGACTGAGGATAGGGGAGGCGG - Intronic
1035326001 7:158066467-158066489 CATACTGAGGAGTTGGGAGGTGG - Intronic
1036307293 8:7611528-7611550 CAGTCCCAGGATGGGGGAGGAGG + Intergenic
1036892814 8:12607431-12607453 CAGTCCCAGGATGGGGGAGGAGG - Intergenic
1037702745 8:21289882-21289904 CAGACAGAGAGTAGGAGAGGAGG + Intergenic
1037745011 8:21636276-21636298 CAGACTGGGGCTTGGGGAGCAGG + Intergenic
1037759465 8:21732443-21732465 GAGTCTGCGGAGAGGGGAGGGGG + Intronic
1037824816 8:22154910-22154932 CAGAATGAGGGTGGGGGAGAGGG - Intronic
1038393010 8:27222849-27222871 CAGGATGAGAATATGGGAGGAGG - Intergenic
1038469288 8:27798852-27798874 GGGACTGAGGATGGGAGAGGGGG + Intronic
1039425133 8:37479277-37479299 CAGACTGAGGATGGGGGCCCTGG - Intergenic
1039458070 8:37721065-37721087 CAGTATGAGGATTTGGGAGGTGG - Intergenic
1039579996 8:38657718-38657740 CAGAGTGAGAATGGGGGAAGGGG - Intergenic
1040416592 8:47201173-47201195 CAGACTCAGGGGAGGGGAGCAGG + Intergenic
1042336824 8:67638685-67638707 CAAATTGAGGAAAGGGGACGAGG - Intronic
1042961545 8:74308879-74308901 CACTCTGAGTATGGGGGAGGAGG + Intronic
1043226983 8:77745678-77745700 CAGCCTGAGGTTTGGGGAGGGGG - Intergenic
1043514249 8:80981509-80981531 CAGAGTGAAGATAGGTGAGGAGG - Intronic
1044014158 8:87030837-87030859 GAGAGGGAGGAGAGGGGAGGGGG - Intronic
1044034620 8:87285448-87285470 GAGATTGAGGCTAGGGGCGGTGG + Intronic
1045224833 8:100234425-100234447 CTGCCTGAGGGTAGGGGTGGAGG - Intronic
1045231990 8:100314678-100314700 CAGGCAGAGGAGAGGGGAGGGGG - Intronic
1045258811 8:100553293-100553315 AAGACTGAGGAGAGGGCAGAGGG + Intronic
1047772457 8:128040294-128040316 AAGACTGAGGAAATGGGAAGTGG + Intergenic
1048547668 8:135402779-135402801 CTTGCTGAGGATAGGAGAGGAGG - Intergenic
1049245591 8:141560552-141560574 CAGATGGAGGGCAGGGGAGGAGG + Intergenic
1049501804 8:142971219-142971241 GAGCCTGTGGATGGGGGAGGCGG + Intergenic
1049511382 8:143028430-143028452 GAGGCTGTGGATGGGGGAGGTGG - Intergenic
1050459756 9:5867489-5867511 CAGCTAGAGGATAGGGGAGGTGG + Intergenic
1051238128 9:15023472-15023494 TAAACTGAGGATGGGGGTGGGGG - Intergenic
1051403712 9:16711096-16711118 AAGACTGGGGGGAGGGGAGGAGG - Intronic
1051575095 9:18606139-18606161 ATGACTGAGGAGAGGGGAGGAGG - Intronic
1051764992 9:20513734-20513756 CACACTGAGGAACCGGGAGGAGG + Intronic
1053170836 9:35881287-35881309 AAGACTGAGGCCAGGTGAGGTGG - Intergenic
1055647244 9:78372751-78372773 CAGACAGAGGGTAGGGGAATTGG + Intergenic
1056225355 9:84489784-84489806 AAGACTGAGGACAGTGAAGGAGG - Intergenic
1056711330 9:88994235-88994257 GAGACCGAGGCTGGGGGAGGGGG - Exonic
1056786287 9:89594806-89594828 CAGACCCAGGAAAGGGAAGGAGG - Intergenic
1057739171 9:97697062-97697084 CAGTCTGGGGACCGGGGAGGCGG + Intronic
1057999308 9:99848880-99848902 CAGACTGGGGCCTGGGGAGGTGG + Intronic
1058445791 9:105053776-105053798 CTGAGTGAGGAGATGGGAGGAGG - Intergenic
1058522743 9:105828371-105828393 CTGCTTGAGGAAAGGGGAGGGGG - Intergenic
1059235181 9:112754874-112754896 GAGATTGAGGATGTGGGAGGAGG - Intronic
1060205951 9:121682949-121682971 CTGAATGAGGATGGGGGAAGGGG + Intronic
1061799801 9:133107534-133107556 CAGACTGAGGCGGGGGGATGGGG - Intronic
1062026289 9:134342219-134342241 CAGAGTGAGGGCAGGGGCGGGGG + Intronic
1062048381 9:134434849-134434871 CAGACTGTGGGGCGGGGAGGGGG + Intronic
1062159868 9:135074392-135074414 GAGAGGGAGGAAAGGGGAGGAGG + Intergenic
1062634736 9:137484861-137484883 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1062634748 9:137484894-137484916 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1185648028 X:1628881-1628903 CAGACCGAGGAGAAGAGAGGAGG - Intronic
1187260365 X:17679847-17679869 CAGAATGAAGAAAGGGGGGGGGG + Intronic
1187532142 X:20106754-20106776 CATGCTGAGGCTAGGTGAGGTGG + Intronic
1187765776 X:22640229-22640251 CTCACTGAGTATAGGGCAGGAGG - Intergenic
1188019362 X:25140238-25140260 CAAACTGAGTATAGGGGACATGG + Intergenic
1189768175 X:44393503-44393525 AACACTGGGGGTAGGGGAGGTGG - Intergenic
1190232185 X:48590651-48590673 CAGATTGAGGAGAGGGGGCGAGG + Intronic
1190342222 X:49306315-49306337 CACACTGAGAATAAGGGAGTGGG - Intronic
1191110621 X:56800863-56800885 CAGAAGGCAGATAGGGGAGGGGG - Intergenic
1191774769 X:64801916-64801938 CAGACTGGGGCTATGGGAGGGGG - Intergenic
1192040940 X:67620800-67620822 CAGACTTATGATAGGGGATAAGG + Intronic
1192062098 X:67838422-67838444 CAGCCTGGGGTTAGGGGAGGAGG - Intergenic
1192549322 X:72041568-72041590 CAGCCTCAGGAGAGTGGAGGGGG + Intergenic
1192783773 X:74318933-74318955 CAGACTTTGGATAAGGGAGAAGG - Intergenic
1193178689 X:78427303-78427325 CAGACTCTGGGGAGGGGAGGTGG + Intergenic
1196239874 X:113330915-113330937 CAGAGGGTGGAGAGGGGAGGAGG - Intergenic
1197355659 X:125435588-125435610 CAGACTGAGGCCAGGCGCGGTGG - Intergenic
1198144398 X:133840338-133840360 GTGATTGAGGCTAGGGGAGGGGG + Intronic
1198995296 X:142567191-142567213 CAGACTGGAGTTAGGGGAGGAGG + Intergenic
1199947990 X:152682727-152682749 AAGGCTGAGGGTAGGGCAGGTGG - Intergenic
1199961689 X:152785727-152785749 AAGGCTGAGGGTAGGGCAGGTGG + Intergenic
1199996179 X:153028193-153028215 GAGCCTGAGGAGAGGGGAGGAGG + Intergenic
1201559194 Y:15298097-15298119 TGGATTGGGGATAGGGGAGGAGG + Intergenic