ID: 1034291234

View in Genome Browser
Species Human (GRCh38)
Location 7:149933254-149933276
Sequence CTATGGGGATGGTGGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034291234_1034291244 26 Left 1034291234 7:149933254-149933276 CCATCTCCCCACCATCCCCATAG No data
Right 1034291244 7:149933303-149933325 CATCATTGCACTAGCAAATCTGG 0: 2
1: 0
2: 0
3: 7
4: 103
1034291234_1034291243 0 Left 1034291234 7:149933254-149933276 CCATCTCCCCACCATCCCCATAG No data
Right 1034291243 7:149933277-149933299 GAAAAATAATTTGCTGTATAAGG 0: 2
1: 0
2: 6
3: 63
4: 698

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034291234 Original CRISPR CTATGGGGATGGTGGGGAGA TGG (reversed) Intergenic
No off target data available for this crispr