ID: 1034295643

View in Genome Browser
Species Human (GRCh38)
Location 7:149969923-149969945
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 2, 1: 0, 2: 1, 3: 18, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034295643 Original CRISPR CTTGAAATCCCCCAAGGAGC TGG Intergenic
901120111 1:6884508-6884530 CATGAAAGCCTCCAAGGAGGAGG + Intronic
901890233 1:12257004-12257026 CATGGAATTCCTCAAGGAGCTGG + Exonic
902238563 1:15073540-15073562 CTAGAAAGGCCCCAAGCAGCAGG - Intronic
906949208 1:50320783-50320805 TTTGAAGTCCCCGAAGGAGTCGG - Intergenic
907092211 1:51735648-51735670 CTTGGCATCCCCAAAGGATCCGG + Intronic
908488342 1:64617606-64617628 ATTGAATTGCCCCAAGGAACAGG + Intronic
909938903 1:81588141-81588163 CTAGAGCTCCCCAAAGGAGCAGG - Intronic
910610169 1:89133027-89133049 CATGACATCCCCCAGGGTGCTGG - Intronic
915562830 1:156697408-156697430 CCTGAAAGCCTCCTAGGAGCTGG - Intergenic
916207020 1:162325011-162325033 CCTGAAATCCCTCATGGAACTGG - Intronic
916629154 1:166593245-166593267 CCTGAAATCCCACAAAGAGCTGG + Intergenic
920854696 1:209652973-209652995 CTCCAAATGCCCCAAGAAGCTGG - Intergenic
923166933 1:231374403-231374425 ATTGAAATCTCCCATGGAGCAGG - Intronic
923407889 1:233680710-233680732 CTTTATATCCCCCAAGGGGGTGG - Intergenic
924154260 1:241159888-241159910 GATGAAATGACCCAAGGAGCAGG - Intronic
1063665732 10:8059055-8059077 TTTAAAACCCCCCAATGAGCTGG + Intronic
1064581056 10:16793417-16793439 CTTGAGAACCCCCCATGAGCTGG + Intronic
1066226352 10:33387232-33387254 ACTGACATCCCCCAAGCAGCAGG + Intergenic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1069721737 10:70554113-70554135 CTTAAAATGCCCCAAGCATCTGG - Intronic
1072725983 10:97814378-97814400 TTTAAACTTCCCCAAGGAGCAGG + Intergenic
1073146163 10:101283228-101283250 CCTGTCATCCCCCATGGAGCAGG + Intergenic
1074275448 10:111997277-111997299 ATTGAAATCGCCCAACCAGCTGG - Intergenic
1076719687 10:132387616-132387638 CTCCAAATCCACCAAGGAGAGGG - Intergenic
1081882169 11:46462866-46462888 CTTCAAAACTCCCAAGTAGCTGG + Intronic
1085255608 11:75170954-75170976 TGTGAAATCCCCCATGGAGAAGG - Intronic
1089259871 11:117216955-117216977 CAAAAAATCCCCCAAGGAGCTGG + Intronic
1091770414 12:3147664-3147686 CTGAAAATGCCCCAAGGAGCTGG + Intronic
1093779610 12:23120485-23120507 CCTGAATTCCCACAAGGAGCTGG - Intergenic
1094302563 12:28981856-28981878 CTTCAGCTCCCCCAAGTAGCTGG - Intergenic
1096585635 12:52617916-52617938 CTTGAAAGCTCCCCAGGTGCTGG - Intronic
1096922577 12:55103442-55103464 CTTGTAATCCCCCATGGTGGAGG + Intergenic
1097430787 12:59503462-59503484 CTTGTAACCTCCCAAGGAGTCGG - Intergenic
1099357115 12:81651259-81651281 TTTAAGTTCCCCCAAGGAGCTGG + Intronic
1100607366 12:96162677-96162699 CTTGTAAGCCCCCAAGAAGGAGG - Intergenic
1101683619 12:106994506-106994528 TTTGAAAGCCTCCAAGAAGCTGG + Intronic
1102202104 12:111064288-111064310 CCTGAAATCCCACAATTAGCAGG - Intronic
1105948643 13:25210563-25210585 CTTGCAATACCCCAGGGAGGGGG - Intergenic
1108191848 13:47949793-47949815 GTTGAAATTACCCAAGGAGATGG - Intronic
1109654133 13:65367346-65367368 GTTGAAATCTGACAAGGAGCTGG - Intergenic
1116161568 14:41272190-41272212 CTTAAAAGCCCCAAAGGACCTGG + Intergenic
1117533763 14:56685009-56685031 CTTAAAATCCCCAGAGGAGTGGG - Intronic
1117713096 14:58552699-58552721 CTTAAAATCTTCAAAGGAGCTGG + Intergenic
1118753203 14:68821195-68821217 CTGGAATTCCCCCAAGGAGGCGG - Intergenic
1119215873 14:72868678-72868700 ATGGAAAACCTCCAAGGAGCAGG + Intronic
1119745506 14:77040848-77040870 TGTGAAAGCCCCCAGGGAGCAGG - Intergenic
1122251805 14:100445041-100445063 CCTGAAGTCCCCCATGGAACTGG + Intronic
1122677044 14:103424091-103424113 CTTGGCCTCCCCCAAGTAGCTGG - Intronic
1126765988 15:52011658-52011680 CTTGTATTTCCCCTAGGAGCAGG + Intronic
1127878751 15:63136667-63136689 CCTGAACTCCCCCAAAAAGCTGG - Intronic
1128423170 15:67514108-67514130 TCTGAAAACCCCCAAGGAGCAGG - Intergenic
1130690620 15:86078879-86078901 CTCTAAATCCCCCGAGGATCTGG + Intergenic
1130709376 15:86264733-86264755 CTTGAAGTCCACCACAGAGCTGG - Exonic
1131441963 15:92466388-92466410 CTTGAAGTGCCCCGAGGAGCAGG + Exonic
1132985610 16:2765681-2765703 CTAGAACTCCCCCAAGGCACCGG + Exonic
1133072355 16:3254726-3254748 CTTGTTCTCCCCCAGGGAGCTGG + Exonic
1133598860 16:7319668-7319690 CTGGAAATCTACTAAGGAGCTGG - Intronic
1143839323 17:9719281-9719303 CTTGATATCCTCCCAGGAGGAGG + Intronic
1145271144 17:21405575-21405597 GCTGAAATCCCCCACGGAACAGG - Intronic
1145309348 17:21692962-21692984 GCTGAAATCCCCCACGGAACAGG - Intronic
1148544219 17:48504546-48504568 CTTGAATCCCCTCAGGGAGCTGG + Intergenic
1149670971 17:58409768-58409790 CTTCAGCTCCCCCAAGTAGCTGG - Intronic
1152329484 17:79663942-79663964 CTTGAAATCCAGAAAGGACCAGG + Intergenic
1152739722 17:82013612-82013634 CTGGACATCCCCCAGGCAGCAGG - Intronic
1156942096 18:42780267-42780289 CTTGAAATCCTCCTATGAGCTGG - Intronic
1157092780 18:44655752-44655774 CTTGAAAGCCCCCAGATAGCTGG - Intergenic
1158838178 18:61353966-61353988 CTTGCAACCTCCCAAGTAGCTGG - Intronic
1160014948 18:75133421-75133443 CTGGAACTTCCCCAAGGAGAGGG - Intergenic
1162054931 19:8056793-8056815 CTTCAGATTCCCCAAGTAGCTGG + Intronic
1163947131 19:20548689-20548711 CCTTAAATCTCCCAAGTAGCTGG + Intronic
1167438023 19:49491122-49491144 CCTGAAATCTCCCAAGTAGATGG - Intronic
925059600 2:880733-880755 CTTGAGACCCCCCAAGCAGCAGG - Intergenic
925904136 2:8529290-8529312 CTTGAATACCCCCAGGGAGGGGG + Intergenic
931393608 2:61866136-61866158 CTTGAAACCTCCCCAGTAGCTGG + Intergenic
931414172 2:62065051-62065073 CCTGTAATCCCACAAGTAGCTGG - Intronic
933705260 2:85284879-85284901 CTTTAAATCCCCTATGTAGCAGG - Intronic
935727829 2:106039099-106039121 CTTGAATCCATCCAAGGAGCTGG + Intergenic
936931534 2:117794841-117794863 CTTGAAATTCTCCAAGGGGCGGG - Intergenic
937016221 2:118608398-118608420 CTTCAAATCCCCCAAGGACTGGG - Intergenic
937345121 2:121120720-121120742 CTTGCAGCCCCCCAAGGTGCGGG - Intergenic
941025789 2:160454682-160454704 CTAGAACTCCTCTAAGGAGCTGG + Intronic
948262114 2:236612248-236612270 CTGCAAATCCCCCAAGGGCCAGG + Intergenic
1170251511 20:14288723-14288745 CTTGAAATCACCCCAGGTCCAGG + Intronic
1170382275 20:15774506-15774528 GTCCAAATTCCCCAAGGAGCTGG + Intronic
1171241163 20:23568210-23568232 CTTGAATTCCTGGAAGGAGCAGG - Exonic
1171484789 20:25478894-25478916 CTTGAAATCTCAAAAGAAGCTGG + Intronic
1173498899 20:43538380-43538402 CTTGAAGTGCCTCAAGGATCTGG - Intronic
1173835018 20:46119231-46119253 CTGGGAATCCCCCAAGTACCTGG + Intronic
1175248189 20:57593753-57593775 CTTGAAAGGCCCCAAGGGACAGG + Intergenic
1175461107 20:59152557-59152579 GTTGCAATCCCCAAAAGAGCAGG - Intergenic
1180556953 22:16585939-16585961 CTTGAAATGCCCTAAGGTTCAGG + Intergenic
1180762594 22:18221339-18221361 CTCGAAATCCCACCAAGAGCCGG + Intergenic
1180773073 22:18403269-18403291 CTCGAAATCCCACCAAGAGCCGG - Intergenic
1180804430 22:18652818-18652840 CTCGAAATCCCACCAAGAGCCGG - Intergenic
1180806322 22:18716592-18716614 CTCGAAATCCCACCAAGAGCCGG + Intergenic
1181217268 22:21342373-21342395 CTCGAAATCCCACCAAGAGCCGG + Intergenic
1182792168 22:32961929-32961951 CTTGAAGTCCCCCAGGTAACAGG + Intronic
1184608939 22:45590379-45590401 CTTGCAATCCCCCAAGGTGAGGG - Intronic
1203234906 22_KI270731v1_random:144251-144273 CTCGAAATCCCACCAAGAGCCGG - Intergenic
949159346 3:861074-861096 CTTGAGATCCACAGAGGAGCAGG - Intergenic
951613193 3:24515205-24515227 ATTGAATTTCCCCAAGGTGCTGG - Intergenic
951900296 3:27650917-27650939 CTTGAAATGCACCTAGGAGATGG - Intergenic
952174329 3:30844959-30844981 CTTGAAACCCTCTAAGGAGAGGG + Intronic
952726549 3:36592520-36592542 CTTAAAATCCTTCAAGGAGGGGG - Intergenic
954752113 3:52819581-52819603 CTTGAGATCCACCCAGGAGTGGG + Exonic
958538222 3:95432274-95432296 ATTGAATTCTCCCAAAGAGCTGG + Intergenic
961351680 3:126308263-126308285 CTTGACCACCCCCAAGGAGCTGG + Intergenic
967470976 3:189861532-189861554 CTTGAATTCCCAGAAGCAGCTGG + Intronic
969318496 4:6396154-6396176 CTTGTACTCCACCCAGGAGCAGG + Intronic
970787505 4:19816716-19816738 CTTAAAAGTCTCCAAGGAGCTGG - Intergenic
972356485 4:38283775-38283797 CTTAAAATACCGCAGGGAGCTGG - Intergenic
977362213 4:96020481-96020503 CATGAAGTCCTCCAAGGAGAAGG + Intergenic
978708527 4:111747591-111747613 CTTGAATTCCAACAAGGAGAAGG + Intergenic
979558333 4:122076006-122076028 CTGGAAATCCCCAAAGTTGCAGG - Intergenic
979649656 4:123114908-123114930 CTTGAAAGCCCACAAGCACCTGG - Intronic
980315182 4:131190190-131190212 CTTGCAAACCCCCAAAAAGCTGG + Intergenic
986066084 5:4235847-4235869 ATTAAAATCCACCAAGGGGCTGG + Intergenic
986561031 5:9061070-9061092 GGTGAAATCCACCAAGGGGCTGG + Intronic
995586483 5:113653992-113654014 CTTGAAATCCCCAGAGTAGTAGG + Intergenic
996329680 5:122314333-122314355 GAGGAAATCTCCCAAGGAGCAGG + Intronic
997572429 5:134941193-134941215 CATCAAATCCTCCAAGGTGCAGG - Intronic
999278326 5:150347226-150347248 CTTGAAATCCCCCAGGGAGAGGG - Intergenic
1001130622 5:169060677-169060699 GCTGAAATTCCCCCAGGAGCAGG - Intronic
1001366977 5:171151940-171151962 GATGAACTCCCCCAAGGAACTGG + Intronic
1001877247 5:175212404-175212426 CATGATCTCCTCCAAGGAGCAGG - Intergenic
1004333978 6:14747363-14747385 CTTGAATTCCCCCAGGGATACGG + Intergenic
1005078720 6:21935041-21935063 CTTGAAGTCCCTAAAGGAGATGG - Intergenic
1006194469 6:32229936-32229958 CTTAAAATACCCCCAGGAGGAGG + Intergenic
1006447227 6:34086472-34086494 CGAGACATCCTCCAAGGAGCAGG + Intronic
1010245060 6:73654600-73654622 CTTCAGCTCCCCCAAGTAGCTGG + Intergenic
1011310921 6:85978517-85978539 CCTGGAATCCCCCAGGGAGTTGG - Intergenic
1012377200 6:98576817-98576839 CTTGCAAACCCCCAAGTACCTGG + Intergenic
1017294218 6:152775618-152775640 CTGTAAATTCCCCAAGGAGAAGG + Intergenic
1026482322 7:70789907-70789929 CTCGGAATCCCGCAAGGACCTGG + Exonic
1026907480 7:74070863-74070885 CTTGCGATCCCAGAAGGAGCTGG + Intergenic
1026920811 7:74153989-74154011 CTTGACCTCCACCAAGGACCTGG + Intergenic
1028753252 7:94406432-94406454 CTTCAAATCCCTCAAGGATGGGG + Intronic
1029191034 7:98772529-98772551 CTTTGAATCCCCCAAGGACCCGG + Intergenic
1034295643 7:149969923-149969945 CTTGAAATCCCCCAAGGAGCTGG + Intergenic
1034419398 7:150981079-150981101 CCAGAGGTCCCCCAAGGAGCGGG + Intergenic
1034810418 7:154126982-154127004 CTTGAAATCCCCCAAGGAGCTGG - Intronic
1035019732 7:155793879-155793901 CTTGGCCTCCACCAAGGAGCAGG - Intergenic
1036429467 8:8676310-8676332 TTAGAAATCCACCAAGGAGAAGG + Intergenic
1036777174 8:11621361-11621383 TGTGAACGCCCCCAAGGAGCAGG - Intergenic
1041163616 8:55070194-55070216 CTTCAAAGCCCCCACTGAGCTGG + Intergenic
1042439620 8:68810585-68810607 CTTGCAACCCCCCAAACAGCAGG - Intronic
1042547168 8:69961114-69961136 CTCGAAATCCCCCAAAGTGCTGG + Intergenic
1044784110 8:95776667-95776689 CAGGAATTCCCCCAAGGGGCTGG + Intergenic
1046033837 8:108817119-108817141 CCTGAAATCTCCCACAGAGCAGG - Intergenic
1046065249 8:109188728-109188750 CTTGTCATCCCCCTAGGGGCAGG - Intergenic
1046273470 8:111926023-111926045 CCTGAGGTCCCCCAAGAAGCAGG - Intergenic
1047220614 8:122915526-122915548 CATGAAATCCCCAAAGGATCAGG - Intronic
1048412142 8:134186142-134186164 CTACATATCCCCCAAGGAGAGGG - Intergenic
1051405257 9:16730198-16730220 CTTGAAATTCCCCGTGGACCGGG + Intronic
1054798763 9:69325983-69326005 CTTCCAATCTCCCAAAGAGCTGG - Intronic
1055389452 9:75803765-75803787 CTTGTATTTCCCCTAGGAGCAGG + Intergenic
1056698376 9:88879980-88880002 CTTGTCTTCCCACAAGGAGCTGG + Intergenic
1058991116 9:110256116-110256138 CGTGCAATCCCCCGAGGAACAGG + Intronic
1060550453 9:124482504-124482526 CTTGGAGTGCCCCAAGGAGGTGG - Exonic
1061824983 9:133252406-133252428 CTGGAAATCCCCCAGGGAGGCGG + Intronic
1062412108 9:136430815-136430837 CTTGAAAACACCCATGGAGAGGG + Intronic
1188596734 X:31910452-31910474 CTTTAACTCTCCCAAGGAGTGGG + Intronic
1189491106 X:41472482-41472504 CTTGGAATCCCAGAAGCAGCGGG - Intronic
1196482709 X:116168430-116168452 CTTGAACACCCACAAGGAACAGG - Intergenic
1199270239 X:145873760-145873782 TTTGAAATCCCCAAAGTAGAAGG - Intergenic