ID: 1034301849

View in Genome Browser
Species Human (GRCh38)
Location 7:150023040-150023062
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034301849_1034301856 12 Left 1034301849 7:150023040-150023062 CCACCCTATTTCCCCGAAGGTTA No data
Right 1034301856 7:150023075-150023097 GTTGAGTATATATGTTCTCCAGG 0: 2
1: 0
2: 0
3: 10
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034301849 Original CRISPR TAACCTTCGGGGAAATAGGG TGG (reversed) Intergenic
No off target data available for this crispr