ID: 1034304510

View in Genome Browser
Species Human (GRCh38)
Location 7:150038652-150038674
Sequence CAAATCTTCCGACCTTACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034304510_1034304515 20 Left 1034304510 7:150038652-150038674 CCCACGTAAGGTCGGAAGATTTG No data
Right 1034304515 7:150038695-150038717 AACACCCACAGTCCTCCAGGTGG 0: 8
1: 20
2: 19
3: 15
4: 181
1034304510_1034304514 17 Left 1034304510 7:150038652-150038674 CCCACGTAAGGTCGGAAGATTTG No data
Right 1034304514 7:150038692-150038714 CCTAACACCCACAGTCCTCCAGG No data
1034304510_1034304519 29 Left 1034304510 7:150038652-150038674 CCCACGTAAGGTCGGAAGATTTG No data
Right 1034304519 7:150038704-150038726 AGTCCTCCAGGTGGGTCCTAAGG 0: 31
1: 17
2: 4
3: 9
4: 138
1034304510_1034304512 -9 Left 1034304510 7:150038652-150038674 CCCACGTAAGGTCGGAAGATTTG No data
Right 1034304512 7:150038666-150038688 GAAGATTTGAACTTTCTACTTGG 0: 12
1: 6
2: 3
3: 30
4: 272
1034304510_1034304516 21 Left 1034304510 7:150038652-150038674 CCCACGTAAGGTCGGAAGATTTG No data
Right 1034304516 7:150038696-150038718 ACACCCACAGTCCTCCAGGTGGG 0: 8
1: 27
2: 13
3: 23
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034304510 Original CRISPR CAAATCTTCCGACCTTACGT GGG (reversed) Intergenic
No off target data available for this crispr