ID: 1034304512

View in Genome Browser
Species Human (GRCh38)
Location 7:150038666-150038688
Sequence GAAGATTTGAACTTTCTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 12, 1: 6, 2: 3, 3: 30, 4: 272}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034304504_1034304512 24 Left 1034304504 7:150038619-150038641 CCGAGCTGCGTTCGGACCCGTCG No data
Right 1034304512 7:150038666-150038688 GAAGATTTGAACTTTCTACTTGG 0: 12
1: 6
2: 3
3: 30
4: 272
1034304507_1034304512 7 Left 1034304507 7:150038636-150038658 CCGTCGGATCGTAAATCCCACGT No data
Right 1034304512 7:150038666-150038688 GAAGATTTGAACTTTCTACTTGG 0: 12
1: 6
2: 3
3: 30
4: 272
1034304506_1034304512 8 Left 1034304506 7:150038635-150038657 CCCGTCGGATCGTAAATCCCACG No data
Right 1034304512 7:150038666-150038688 GAAGATTTGAACTTTCTACTTGG 0: 12
1: 6
2: 3
3: 30
4: 272
1034304510_1034304512 -9 Left 1034304510 7:150038652-150038674 CCCACGTAAGGTCGGAAGATTTG No data
Right 1034304512 7:150038666-150038688 GAAGATTTGAACTTTCTACTTGG 0: 12
1: 6
2: 3
3: 30
4: 272
1034304511_1034304512 -10 Left 1034304511 7:150038653-150038675 CCACGTAAGGTCGGAAGATTTGA No data
Right 1034304512 7:150038666-150038688 GAAGATTTGAACTTTCTACTTGG 0: 12
1: 6
2: 3
3: 30
4: 272
1034304503_1034304512 25 Left 1034304503 7:150038618-150038640 CCCGAGCTGCGTTCGGACCCGTC No data
Right 1034304512 7:150038666-150038688 GAAGATTTGAACTTTCTACTTGG 0: 12
1: 6
2: 3
3: 30
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034304512 Original CRISPR GAAGATTTGAACTTTCTACT TGG Intergenic
900075143 1:808932-808954 GAAGAATAGAACTTTTTATTAGG - Intergenic
901178365 1:7321669-7321691 GATGGTGTGAACTCTCTACTGGG - Intronic
901502680 1:9663151-9663173 GAGCATTTGCACTTTCCACTGGG + Intronic
902593203 1:17489761-17489783 GAAAATTTGATGTTTCTCCTGGG + Intergenic
903585490 1:24412514-24412536 TCAGAGTTGAACTTTCTACTGGG - Intronic
903707952 1:25300858-25300880 GAAGCTCTGAACTTTCTCCAAGG + Intronic
903719253 1:25392208-25392230 GAAGCTCTGAACTTTCTCCAAGG - Intronic
904821832 1:33250289-33250311 GAACACATGCACTTTCTACTTGG - Intergenic
909111062 1:71478278-71478300 GAAGTTTTGCACTTGCTATTGGG - Intronic
911973510 1:104464769-104464791 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
913065251 1:115246683-115246705 GATGATTCAAACTTCCTACTAGG - Intergenic
913930339 1:124953026-124953048 GAAGATTTGAAACTTCTTTTTGG - Intergenic
915219981 1:154366960-154366982 GTAGGTATGAAGTTTCTACTTGG + Intergenic
918339416 1:183555664-183555686 GAATATTTGTACTTACTCCTTGG + Intronic
918647351 1:186919394-186919416 GCAGATATGAGCTTTCTTCTTGG + Intronic
920359831 1:205407034-205407056 GAAGATTTGAACTTGGGACTGGG + Intronic
920565715 1:206971034-206971056 GAAGAGTTGCCCTTTCTAATTGG - Intergenic
921747094 1:218751683-218751705 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
922270982 1:224033831-224033853 GAAGAATAGAACTTTTTATTAGG - Intergenic
924933727 1:248750837-248750859 GAAGGTTGGATCTTTCTACTGGG - Intronic
1063260971 10:4389146-4389168 GAAGAGTTGAATTTTCCACGTGG - Intergenic
1063741486 10:8826656-8826678 GATGATTTCTACTTTCTTCTAGG + Intergenic
1064397387 10:14992718-14992740 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1064815785 10:19260441-19260463 GCATATTTGAAATTTCAACTGGG + Intronic
1065906064 10:30253352-30253374 TAAGATTTTATCTTTGTACTTGG + Intergenic
1066313281 10:34218951-34218973 GATGATTTGAACTATTTATTCGG - Intronic
1068075899 10:52253407-52253429 GAAGATTTGCACTATCAGCTTGG - Intronic
1069160001 10:65081987-65082009 GACAATATGAATTTTCTACTTGG + Intergenic
1069875184 10:71558448-71558470 TAAGTTTTTAAATTTCTACTGGG + Intronic
1071111676 10:82164805-82164827 GGACATGTGAACTTTCAACTTGG + Intronic
1072088352 10:92102335-92102357 GAAGATTTTCTATTTCTACTTGG - Intronic
1072331584 10:94359094-94359116 GAAGAATTGTAAGTTCTACTAGG - Intronic
1073974828 10:109088406-109088428 GAATATTTGATCTTTGTACGTGG - Intergenic
1074130915 10:110574403-110574425 AAAAATTTGAACTTTTTAGTTGG + Intronic
1075542720 10:123329090-123329112 GAAGATTTGAACTTAGGTCTTGG - Intergenic
1079212572 11:18476147-18476169 GCAGTTTTAAACTTTCCACTAGG - Intronic
1082323465 11:51106954-51106976 CAAGAATTGAACTTTCCTCTTGG + Intergenic
1082464802 11:53156454-53156476 CAAGAATTGAACTTTCCTCTTGG + Intergenic
1082481749 11:53401520-53401542 CAAGAATTGAACTTTCCTCTTGG + Intergenic
1084227873 11:67728694-67728716 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1084807355 11:71588171-71588193 GCAGATCTGAGCTTTCTTCTTGG - Intronic
1084811374 11:71613720-71613742 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
1084847290 11:71910636-71910658 GCAGATCTGAGCTTTCTTCTTGG - Intronic
1085060994 11:73446918-73446940 GAAGTTTGGAACTTTATCCTTGG - Intronic
1086217266 11:84398909-84398931 GCAGATTTTAATTTTCTATTTGG + Intronic
1087221533 11:95551470-95551492 CAAGATTTTATATTTCTACTTGG + Intergenic
1090810084 11:130231460-130231482 GAAAATCTAAAGTTTCTACTTGG + Exonic
1091074050 11:132598000-132598022 GAAGATATGACCTTTTAACTGGG - Intronic
1092432553 12:8420945-8420967 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1092538580 12:9406333-9406355 GAAGATCTGAGCTTTCTTCTTGG - Intergenic
1092538878 12:9407333-9407355 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
1092556549 12:9567586-9567608 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1092556861 12:9569155-9569177 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1093347564 12:18057522-18057544 CAAGATTTGTACCTTCTCCTAGG - Intergenic
1094513958 12:31117445-31117467 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
1094514923 12:31120567-31120589 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
1094515100 12:31121164-31121186 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
1094515540 12:31123052-31123074 GTAGATCTGAGCTTTCTTCTTGG - Intergenic
1096075506 12:48801351-48801373 GAAGATTTTCAATTACTACTGGG + Intergenic
1097533068 12:60830102-60830124 AAAGTTTTGAACTTTCTCTTAGG + Intergenic
1097558822 12:61174997-61175019 AAAGATTTGTACTTTCTTTTTGG - Intergenic
1097781427 12:63710332-63710354 GAACATTTGTATTTTCTCCTGGG - Intergenic
1098175337 12:67784370-67784392 GAACCTCTGAACTTTCTATTTGG - Intergenic
1098456810 12:70683709-70683731 GTAGATTTTAACTTTCTAGTGGG - Intronic
1098528073 12:71509746-71509768 GAAGATTTTAAAATACTACTTGG - Intronic
1098625355 12:72659496-72659518 GAAGATATAAACTTTGTAATAGG + Intronic
1098748485 12:74268028-74268050 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
1100222830 12:92524392-92524414 TAAGATTTTATCTTTATACTGGG - Intergenic
1100265783 12:92974572-92974594 CAAGATTTGTAGCTTCTACTTGG - Intergenic
1104292762 12:127484538-127484560 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
1105487260 13:20847808-20847830 TAAGATTTGTATTTTATACTGGG - Intronic
1106206582 13:27602236-27602258 TAAGATTTGCACATTTTACTTGG - Intronic
1107490669 13:40877675-40877697 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1107544327 13:41422507-41422529 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1107940341 13:45377168-45377190 GCAGATTTGAGCTTTCTTCTTGG + Intergenic
1107940759 13:45378624-45378646 GCAGATTTGAGCTTTCTTCTTGG + Intergenic
1107940886 13:45379288-45379310 GCAGATTTGAGCTTTCTTCTTGG + Intergenic
1107941015 13:45379954-45379976 GCAGATTTGAGCTTTCTTCTTGG + Intergenic
1107941352 13:45381170-45381192 GCAGATTTGAGCTTTCTTCTTGG + Intergenic
1107941951 13:45383188-45383210 GCAGATTGGAGCTTTCTTCTTGG + Intergenic
1107942081 13:45383857-45383879 GCAGATTTGAGCTTTTTTCTTGG + Intergenic
1108053222 13:46464700-46464722 GCAGATTTGAGCTTTCTTCTTGG - Intergenic
1108053524 13:46465868-46465890 GCAGATTTGAGCTTTCTTCTTGG - Intergenic
1108053672 13:46466634-46466656 GCAGATTTGAGCTTTCTTCTTGG - Intergenic
1108053946 13:46467698-46467720 GCAGATTTGAGCTTTCTTCTTGG - Intergenic
1108196089 13:47996773-47996795 GAAGATTTGAAGTTTGTTTTTGG - Intronic
1109439692 13:62353014-62353036 AAAGATAGGAACTTTCTGCTGGG - Intergenic
1109537326 13:63738302-63738324 GCAGATTTGAGCTTTCTTCTTGG + Intergenic
1109537451 13:63738969-63738991 GCAGATTTGAGCTTTCTTCTTGG + Intergenic
1109537769 13:63740196-63740218 GCAGATTTGAGCTTTCTCCTTGG + Intergenic
1109537896 13:63740863-63740885 GCAGATTTGAGCTTTCTTCTTGG + Intergenic
1109545690 13:63838119-63838141 GCAGATTTGAGCTTTCTTCTTGG - Intergenic
1109545926 13:63839106-63839128 GCAGATTTGAGCTTTCTTCTTGG - Intergenic
1109546049 13:63839774-63839796 GCAGATTTGAGCTTTCTTCTTGG - Intergenic
1109546542 13:63841548-63841570 GCAGATTTGAGCTTTCTGCCTGG - Intergenic
1109546911 13:63843273-63843295 GCAGATTTGAGCTTTCTTCTTGG - Intergenic
1109802856 13:67400911-67400933 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
1110388796 13:74947083-74947105 GCAGATTTGATCTTGTTACTGGG - Intergenic
1110686877 13:78385922-78385944 AATGATTTGAACATTTTACTGGG + Intergenic
1110891676 13:80704813-80704835 ACAGATTTGAGCTTTCTTCTTGG - Intergenic
1110892133 13:80706466-80706488 GCAGATTTGAGCTTTCTTCTTGG - Intergenic
1111114852 13:83761900-83761922 GCAGTTATAAACTTTCTACTTGG + Intergenic
1111793031 13:92882911-92882933 TAAAAGCTGAACTTTCTACTAGG - Intergenic
1113146938 13:107217978-107218000 GGAGCTTTGAACATTCTCCTGGG - Intronic
1114568328 14:23648360-23648382 GGAGATTTGAACCAGCTACTGGG + Intergenic
1114790765 14:25655605-25655627 GAACATTTCAACTTTCTATGGGG + Intergenic
1116078889 14:40147466-40147488 TAAGATTTCAACTTTCAATTTGG - Intergenic
1116367937 14:44091941-44091963 AAAGAATTGCACTTTATACTTGG + Intergenic
1117466588 14:56000387-56000409 CAGGGTTTGAACTTTCTCCTTGG + Intergenic
1119930825 14:78544482-78544504 GGAGAGTTGAACTTTATAATCGG + Intronic
1121508323 14:94493310-94493332 GAGGATTTGGAGTTTCTTCTCGG + Intronic
1123214043 14:106790039-106790061 GAACATTTGAAATTTGTTCTTGG + Intergenic
1125092720 15:35812978-35813000 GAAGATTTAATCTTCCTATTTGG - Intergenic
1125782886 15:42286450-42286472 CAGAATTTGAACTTTGTACTTGG + Intronic
1126008510 15:44281153-44281175 AAAGATCTGAATTTTCAACTGGG + Intergenic
1126931526 15:53657580-53657602 TAAGATTATAACTTTCTTCTTGG - Intronic
1127096462 15:55516132-55516154 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1127166439 15:56248715-56248737 TAAGATATCAAATTTCTACTTGG - Intronic
1129984888 15:79909903-79909925 GAAGTTCTGAACTTTTAACTTGG - Intronic
1129984891 15:79909958-79909980 GAAGTTCTGAACTTTTAACTTGG - Intronic
1129984894 15:79910013-79910035 GAAGTTCTGAACTTTTAACTTGG - Intronic
1130799501 15:87247215-87247237 GAAGATTTTAATATTCTATTGGG + Intergenic
1131432465 15:92397631-92397653 GAAGATTTTAGCTTACAACTTGG - Intronic
1139766279 16:69232945-69232967 GAAGATCTCAAATTACTACTGGG - Intronic
1140219532 16:73033563-73033585 GCAGATTTGAACTTTTCACCCGG + Intronic
1140699127 16:77565075-77565097 GGACATTTTAACTTTCAACTTGG - Intergenic
1144473558 17:15564882-15564904 CAAGGCTTGAACTTTCTAATGGG + Intergenic
1144637240 17:16918124-16918146 GGAGATTTGAAGTTTCAAGTGGG + Intergenic
1144922964 17:18779929-18779951 CAAGGCTTGAACTTTCTAATGGG - Intergenic
1146407484 17:32551909-32551931 GGAGATTTGAACATGCTTCTAGG - Intronic
1149385333 17:56137442-56137464 GTAGATTGGAAGTTTCTACGAGG - Intronic
1152054707 17:78015608-78015630 GAAGATTTAAATGTACTACTTGG + Intronic
1157039944 18:44027128-44027150 AAAGATTTGCACTTTCCAGTTGG - Intergenic
1157057094 18:44243012-44243034 GAAGAGTTGAATTTACTTCTTGG + Intergenic
1158063968 18:53382459-53382481 GAATATATGAACTTTGAACTAGG - Intronic
1158292088 18:55954125-55954147 GCAGATCTGAGATTTCTACTTGG - Intergenic
1162673326 19:12277319-12277341 AAAAATTGTAACTTTCTACTGGG + Intronic
1164083350 19:21879649-21879671 GATGATTTGACCCTTCTACCTGG + Intergenic
1164314479 19:24074875-24074897 GATGATGTGAATTTTCTGCTAGG + Intronic
1164480901 19:28610198-28610220 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
925513810 2:4657627-4657649 GAAGAGTTGAAGTTTTTACAAGG + Intergenic
928060296 2:28105572-28105594 GAAGATTTGAACTTTTCTCAAGG - Intronic
928872936 2:36002496-36002518 GAAGATGTGTACTTTTTAATTGG - Intergenic
929371411 2:41228290-41228312 TCATATTTGAACTTTCTTCTGGG - Intergenic
930594830 2:53374593-53374615 GAAGTTTTACATTTTCTACTAGG + Intergenic
931630139 2:64291071-64291093 GATGTTTTGAACATTCTTCTGGG - Intergenic
931698532 2:64890261-64890283 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
932349777 2:71022556-71022578 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
933289999 2:80427287-80427309 ACAGATTTGAAATTTCTTCTTGG - Intronic
935832241 2:107012231-107012253 GAAGATTTGCATTATCTTCTGGG + Intergenic
937776321 2:125780738-125780760 GGAGATGTGAACTTAATACTTGG - Intergenic
939713269 2:145550406-145550428 GAAGTTTTCTAATTTCTACTAGG + Intergenic
940869365 2:158847336-158847358 GCAGATCTGAGCTTTCTTCTTGG - Intronic
940872037 2:158868331-158868353 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
942202727 2:173588246-173588268 GAACATTTTAACTTTCAAATGGG - Intergenic
942828481 2:180209893-180209915 GAACATCTTAACTGTCTACTAGG + Intergenic
943127540 2:183813851-183813873 GGAGATTTGATCTTTTTACTAGG + Intergenic
947777646 2:232726651-232726673 GAGGATTTGAGATTTCTACTAGG + Intronic
949082579 2:242115852-242115874 GAAGAATAGAACTTTTTATTAGG + Intergenic
1168910350 20:1442142-1442164 GGAGTTTTGTACTTTCTAATGGG - Exonic
1169056649 20:2627532-2627554 TAAGATTTCCACTTTCTGCTTGG + Intronic
1171317100 20:24204940-24204962 GGAGCCTTGAACTTTCTGCTGGG + Intergenic
1176387501 21:6146088-6146110 GAAGATTCGAGCTTTCAGCTGGG - Intergenic
1178146030 21:29740892-29740914 GAATATTTCAGCTATCTACTTGG - Intronic
1178492821 21:33064222-33064244 GAAGATTTGCATGTTCAACTCGG + Intergenic
1179735971 21:43392160-43392182 GAAGATTCGAGCTTTCAGCTGGG + Intergenic
1180756009 22:18161699-18161721 GAAGATTTAAAATTTCTCCCAGG + Intronic
1180757507 22:18172871-18172893 CAAGATTAGAACTTTCCCCTGGG - Intronic
1181074269 22:20364577-20364599 CAAGATTAGAACTTTCCCCTGGG + Intronic
1181075759 22:20375704-20375726 GAAGATTTAAAATTTCTCCCAGG - Intronic
1182395989 22:30036305-30036327 TAAGAGGTGAACTTCCTACTTGG - Intergenic
949157959 3:850083-850105 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
949822467 3:8130858-8130880 GAAGATTTGACTTTTTTACATGG + Intergenic
949879839 3:8652606-8652628 GAAGATTTGGACTTTATCCTAGG - Intronic
949882892 3:8675512-8675534 GCAGATCTGAGCTTTCTTCTTGG - Intronic
951029342 3:17863694-17863716 GAAGATTTTGTCTTTCAACTTGG - Intronic
951102267 3:18703024-18703046 GAAGATTTTATCTTGCAACTTGG + Intergenic
951166151 3:19486928-19486950 GCAGATCTGAGCTTTCTTCTTGG + Intronic
951644825 3:24878322-24878344 GAAGTTTTCATCTTTCTGCTTGG + Intergenic
954073934 3:48162984-48163006 CAAAATTTGAAATTTCTGCTGGG + Intronic
956739124 3:72261161-72261183 CAAGATTTCATCATTCTACTTGG - Intergenic
957076346 3:75605947-75605969 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
957406125 3:79776549-79776571 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
961272097 3:125697001-125697023 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
961274956 3:125719234-125719256 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
961876548 3:130027797-130027819 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
962060041 3:131916206-131916228 TAAGATTTGATCTTTCTACTTGG - Intronic
962574316 3:136742101-136742123 GGATATTTTAACTTTCTTCTTGG + Intronic
967798102 3:193621223-193621245 AAAGATTTGTCCTTTCTAATAGG + Intronic
969019796 4:4132241-4132263 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
969024503 4:4162644-4162666 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
969025409 4:4168592-4168614 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
969729318 4:8944519-8944541 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
969734062 4:8975172-8975194 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
969785491 4:9454053-9454075 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
969788902 4:9478460-9478482 GAAGATCTGAGCTTTCTTCTTGG - Intergenic
969793641 4:9509229-9509251 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
969826543 4:9762593-9762615 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
970515143 4:16821690-16821712 GAATATTTGAATTTTATCCTTGG + Intronic
970990750 4:22210309-22210331 GGAGGTTTGAACTTCCCACTGGG + Intergenic
971628994 4:28964180-28964202 GAAGACTTGCAATTTCTACTTGG + Intergenic
972077342 4:35104240-35104262 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
972688889 4:41377530-41377552 GAAGATGTGAACATTCTCCCTGG + Intronic
973271591 4:48268234-48268256 GAAGATGTGAAAATTCTAGTTGG + Intronic
974326692 4:60423259-60423281 CATGATTTGACCTTTCGACTTGG - Intergenic
974651624 4:64760635-64760657 GATGATTAAAACTTTCTTCTAGG - Intergenic
975788380 4:77919576-77919598 AAAGAATGGAACTTTCCACTAGG + Intronic
976703512 4:87997013-87997035 GAAAATTTCAACTTATTACTTGG + Intergenic
976970163 4:91094039-91094061 GCAGATCTGAGCTTTCTTCTTGG + Intronic
977087572 4:92622106-92622128 AAAGATTTGAAAATGCTACTGGG + Intronic
980779995 4:137482017-137482039 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
981164522 4:141541630-141541652 GAAGATTTGAAGTCTTTACAGGG - Intergenic
981237311 4:142434442-142434464 GAAACATTGAACTTTCTACCGGG + Intronic
981396576 4:144256588-144256610 GAATATTGCAACTTTTTACTAGG + Intergenic
981457750 4:144975044-144975066 GATGATTGGAGCTTCCTACTCGG + Intronic
982240617 4:153296015-153296037 GACGATTTGATCTTTCGAGTGGG + Exonic
986858406 5:11899364-11899386 AAAGTTTTGTAATTTCTACTGGG + Intronic
987582762 5:19817662-19817684 CAACATTTGATCATTCTACTAGG + Intronic
987701333 5:21403425-21403447 TGAGATTTAAACTTTCTAGTTGG - Intergenic
989643646 5:43605936-43605958 GAAAATTTGTTCCTTCTACTTGG - Intronic
991335515 5:65542333-65542355 AAAGATTTGAATTTTGAACTCGG - Intronic
993320337 5:86462323-86462345 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
993328292 5:86568041-86568063 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
993559869 5:89392642-89392664 GAAGAAATGAACTTTCTTGTGGG - Intergenic
994841001 5:104924550-104924572 GAAACTTTGAACTTTTGACTTGG + Intergenic
995212545 5:109557127-109557149 GCAAATTTGAAGTTTTTACTGGG + Intergenic
995473685 5:112527616-112527638 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
998336928 5:141381514-141381536 GAAGATTTGAATTGCATACTAGG + Intronic
998900401 5:146847250-146847272 GAAGATTTGAACTTTATCCTGGG - Intronic
999451543 5:151681986-151682008 GAACATCTGTACTTTCTCCTAGG + Intronic
1001965602 5:175907893-175907915 GAAGATTTGAACTCCATACAAGG + Intergenic
1002251347 5:177931302-177931324 GAAGATTTGAACTCCATACAAGG - Intergenic
1002408317 5:179053693-179053715 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1004965626 6:20847615-20847637 GGAGATTTTCACTTTCTACATGG - Intronic
1008804487 6:55411197-55411219 GTATATGTGAATTTTCTACTAGG + Intergenic
1010678765 6:78775057-78775079 GAATATTTGAACTTGATACAAGG + Intergenic
1011565207 6:88665900-88665922 GCAGATCTGAGCTTTCTTCTTGG - Intronic
1011864266 6:91802880-91802902 AAAGATTTCAACAATCTACTTGG - Intergenic
1012611843 6:101228179-101228201 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1013754120 6:113441069-113441091 GAAGATATGGTCTTTCTGCTTGG - Intergenic
1013973712 6:116051186-116051208 GAACGTTTGAACTTTATACTAGG - Intronic
1014546901 6:122745515-122745537 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1014803794 6:125806694-125806716 GAAGAATTGACCCTTGTACTTGG + Intronic
1020307196 7:6844278-6844300 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1020311672 7:6873115-6873137 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1022194757 7:28054049-28054071 GAAGATGGGAAGTTTATACTTGG - Intronic
1022771131 7:33474000-33474022 GAAGATTTTAAATATCTATTTGG + Intronic
1022940024 7:35226446-35226468 GAACATTTGTATTTTCTCCTGGG - Intronic
1023846349 7:44123174-44123196 GAATTTTTTAACTTTCTAGTAGG - Exonic
1024839773 7:53572820-53572842 TAAGATTTAAATTTTCTATTGGG - Intergenic
1026868835 7:73838683-73838705 GAAGACAGGAACTTTCTACTGGG - Intronic
1028068760 7:86422558-86422580 TAAGATTAAAACTTTCTATTTGG + Intergenic
1028679460 7:93508800-93508822 GGAGATTTGGAATTTATACTTGG + Intronic
1029078334 7:97953215-97953237 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1030053416 7:105560049-105560071 GAGGATTTTAACTTTCTAAAAGG + Intronic
1031204028 7:118730475-118730497 GAAGGTTTTTACTTTATACTTGG + Intergenic
1034303123 7:150033463-150033485 GAAGATTTGAACTTTCTTCTAGG + Intergenic
1034303429 7:150034683-150034705 GAAGATTTGAACTTTCTACTTGG + Intergenic
1034303547 7:150035071-150035093 GAAGATTTGAACTTTCTACTTGG + Intergenic
1034303714 7:150035619-150035641 GAAGATTTGAACTTTCTACTTGG + Intergenic
1034303994 7:150036770-150036792 GAAGATTTGAACTTTCTAATTGG + Intergenic
1034304141 7:150037239-150037261 GAAGATTTGAACTTTCTACTTGG + Intergenic
1034304259 7:150037628-150037650 GAAGATTTGAACTTTCTACTTGG + Intergenic
1034304512 7:150038666-150038688 GAAGATTTGAACTTTCTACTTGG + Intergenic
1034304628 7:150039057-150039079 GAAGATTTGAACTTTCTACTTGG + Intergenic
1034304801 7:150039604-150039626 GAAGATTTGAACTTTCTACTTGG + Intergenic
1034305201 7:150041414-150041436 GAAGATTTGAACGTTCTACTTGG + Intergenic
1034305377 7:150041965-150041987 GAAGATTTGAACTTTCTACTTGG + Intergenic
1034801467 7:154058686-154058708 GAAGATTTGAACTTTCTACTTGG - Intronic
1034801689 7:154059396-154059418 GAAGATTTGATCTTTCTACTTGG - Intronic
1034801972 7:154060535-154060557 GAAGATTTGAACTTTCTACTTGG - Intronic
1034802108 7:154061002-154061024 GAAGATTTGAACTCTCTACTTGG - Intronic
1034802422 7:154062224-154062246 GAAGATTTGAACTTTCTACTTGG - Intronic
1034802653 7:154062936-154062958 GAAGATTTGAAATTTCTACCTGG - Intronic
1034802927 7:154063805-154063827 GAAGATTTGAACTTTCTTCTAGG - Intronic
1035540504 8:432555-432577 GAAGAATAGAACTTTTTATTAGG + Intronic
1036262206 8:7249862-7249884 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1036314245 8:7708401-7708423 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1036355234 8:8037688-8037710 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
1036598164 8:10232618-10232640 GAAAATTTGAACTTTCTTTAAGG + Intronic
1036816775 8:11908328-11908350 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1036833497 8:12039860-12039882 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1036855343 8:12286425-12286447 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1036906144 8:12709910-12709932 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1037058866 8:14481678-14481700 TAACATTTGAATTTTATACTAGG + Intronic
1039278231 8:35955240-35955262 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
1039508331 8:38068778-38068800 GAACATTTGAATTTTATTCTCGG + Intergenic
1044634663 8:94310415-94310437 GAAGAATTGTTCTTTCCACTTGG - Intergenic
1045497802 8:102722852-102722874 GTAGATTTGAACTTGCCTCTAGG - Intergenic
1046211109 8:111077872-111077894 AAATATTTTAATTTTCTACTAGG - Intergenic
1046702244 8:117414587-117414609 GAAGGTTTGCACTTTCCCCTAGG + Intergenic
1047945344 8:129871078-129871100 GATGATTTCCACTTTCTCCTAGG + Intronic
1050762671 9:9091772-9091794 GAAGAATTGAACTTTCAGGTTGG + Intronic
1053736861 9:41107619-41107641 GCAGATCTGAATTTTCTTCTTGG - Intergenic
1054691511 9:68323778-68323800 GCAGATCTGAATTTTCTTCTTGG + Intergenic
1055104245 9:72495968-72495990 GAAAGTTTTAATTTTCTACTTGG + Intergenic
1055780350 9:79814665-79814687 GAAGATTTTAATACTCTACTTGG - Intergenic
1056917335 9:90757112-90757134 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1057251915 9:93510140-93510162 GAAGAATCCAATTTTCTACTTGG - Intronic
1058527111 9:105870335-105870357 GAAGATTTGTTCGTTCTAATTGG - Intergenic
1185909812 X:3971139-3971161 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
1186574857 X:10753987-10754009 AAGGATTTGAATTTTTTACTTGG - Intronic
1187860125 X:23673852-23673874 CGAGATTAGAACTGTCTACTTGG + Intronic
1189308037 X:40002049-40002071 AAAGAGTTGCACTTTCTATTGGG - Intergenic
1190425993 X:50334983-50335005 GCAGATCTGAGCTTTCTTCTTGG + Intronic
1195234028 X:102879354-102879376 AGAGATTTTAACTTTCAACTAGG + Intergenic
1196321492 X:114345707-114345729 CAAGATTTAAACTGTCTACATGG + Intergenic
1198969932 X:142268905-142268927 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
1200394227 X:155973950-155973972 GCAGATCTGAGCTTTCTTCTTGG + Intergenic
1200825269 Y:7632008-7632030 GATTACTTGAAATTTCTACTTGG + Intergenic
1200881310 Y:8215074-8215096 GATTATTTGAAATTTCTATTTGG + Intergenic
1200983735 Y:9285490-9285512 TCAGATTTGAGCTTTCTTCTTGG + Intergenic
1201554969 Y:15257993-15258015 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
1201646598 Y:16240111-16240133 AAATATTTGCAGTTTCTACTGGG + Intergenic
1201656215 Y:16345206-16345228 AAATATTTGCAGTTTCTACTGGG - Intergenic
1201696816 Y:16835217-16835239 GCAGATCTGAGCTTTCTTCTTGG - Intergenic
1201704421 Y:16920271-16920293 GAATGTTTGAACTTTCTTCAAGG - Intergenic
1202234787 Y:22699078-22699100 GATTACTTGAAATTTCTACTTGG - Intergenic
1202263062 Y:22989969-22989991 CCAAATCTGAACTTTCTACTGGG - Intronic
1202308372 Y:23497090-23497112 GATTACTTGAAATTTCTACTTGG + Intergenic
1202416052 Y:24623710-24623732 CCAAATCTGAACTTTCTACTGGG - Intronic
1202454735 Y:25046376-25046398 CCAAATCTGAACTTTCTACTGGG + Intronic
1202562429 Y:26173496-26173518 GATTACTTGAAATTTCTACTTGG - Intergenic