ID: 1034304514

View in Genome Browser
Species Human (GRCh38)
Location 7:150038692-150038714
Sequence CCTAACACCCACAGTCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034304510_1034304514 17 Left 1034304510 7:150038652-150038674 CCCACGTAAGGTCGGAAGATTTG No data
Right 1034304514 7:150038692-150038714 CCTAACACCCACAGTCCTCCAGG No data
1034304511_1034304514 16 Left 1034304511 7:150038653-150038675 CCACGTAAGGTCGGAAGATTTGA No data
Right 1034304514 7:150038692-150038714 CCTAACACCCACAGTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034304514 Original CRISPR CCTAACACCCACAGTCCTCC AGG Intergenic
No off target data available for this crispr