ID: 1034304515

View in Genome Browser
Species Human (GRCh38)
Location 7:150038695-150038717
Sequence AACACCCACAGTCCTCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 8, 1: 20, 2: 19, 3: 15, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034304510_1034304515 20 Left 1034304510 7:150038652-150038674 CCCACGTAAGGTCGGAAGATTTG No data
Right 1034304515 7:150038695-150038717 AACACCCACAGTCCTCCAGGTGG 0: 8
1: 20
2: 19
3: 15
4: 181
1034304511_1034304515 19 Left 1034304511 7:150038653-150038675 CCACGTAAGGTCGGAAGATTTGA No data
Right 1034304515 7:150038695-150038717 AACACCCACAGTCCTCCAGGTGG 0: 8
1: 20
2: 19
3: 15
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034304515 Original CRISPR AACACCCACAGTCCTCCAGG TGG Intergenic
900742709 1:4340360-4340382 AACACCCACTGAGCTCCAGCTGG - Intergenic
902053345 1:13581338-13581360 TAAACCCACAGTCCTCAAAGTGG + Intergenic
902132928 1:14279556-14279578 AAAACCCACAGTCATACAAGTGG + Intergenic
903123473 1:21232134-21232156 AACCCCTATAGTCCACCAGGGGG + Intronic
903846879 1:26284105-26284127 AACTCCCCCAGCCCTCCTGGGGG - Intronic
904010706 1:27388592-27388614 AATACCTGCAGTTCTCCAGGTGG - Intergenic
905108639 1:35578530-35578552 ACCACCCACTCTCCTCCAGAGGG - Intronic
906245035 1:44267468-44267490 AACACCCACAGTCCAGGAGGAGG + Intronic
906544084 1:46609322-46609344 CACACCCACATTCCTCCAATAGG + Exonic
907386505 1:54129078-54129100 TCCACCCACAGTCCTCCACATGG - Intergenic
909578912 1:77209524-77209546 AAGACCCACAGTCTTTCTGGAGG + Intronic
911447939 1:98022370-98022392 AAGACCCCTAGTCTTCCAGGTGG + Intergenic
912394911 1:109335089-109335111 AACACCCACACTATTCCTGGAGG - Intronic
913257293 1:116965028-116965050 AAAACCCAGAGTCCTCTAAGTGG + Intronic
915524824 1:156469089-156469111 CATCCCCACAGTCCTCCTGGAGG - Intronic
916471725 1:165130035-165130057 AACACCCTCAGTCACCCTGGAGG + Intergenic
916747775 1:167697666-167697688 ACCCCCCACAGTCCCCCTGGAGG + Exonic
918076011 1:181172089-181172111 AACAGTGACAGTCCTTCAGGTGG - Intergenic
919737077 1:200959430-200959452 AACACCCACAGTATTCCACTGGG - Intergenic
922893117 1:229076936-229076958 AGCACCCACAGCCATCCAGAAGG + Intergenic
923520074 1:234728550-234728572 AACACCCAGCGCCCTGCAGGAGG - Intergenic
1063863460 10:10338448-10338470 AAAACCCACAGACATCTAGGTGG - Intergenic
1070011982 10:72484419-72484441 AAAATCCTCAGTCATCCAGGAGG + Intronic
1071166342 10:82811797-82811819 TTCACCAGCAGTCCTCCAGGGGG + Intronic
1071463471 10:85919842-85919864 AATACCAACAGTGCTACAGGGGG + Intronic
1074019782 10:109570586-109570608 AAGACCCTCTGTCCTCCATGAGG + Intergenic
1074143520 10:110697410-110697432 AGCACCCTCAGTCATGCAGGAGG - Intronic
1074584067 10:114749648-114749670 AAAAGCCAAAGTCCTCAAGGTGG + Intergenic
1075715913 10:124555269-124555291 CACAGCCACAGGCCTGCAGGAGG + Intronic
1076249338 10:128972824-128972846 AACTCCCACTGGTCTCCAGGAGG + Intergenic
1076463283 10:130660855-130660877 AGCACCCACAGGCCTCCTGCAGG - Intergenic
1076667581 10:132101927-132101949 ACCTCCCACAGTCCTCCCTGGGG - Intergenic
1078546277 11:12249305-12249327 AACTCCCAGAGCCCTGCAGGTGG - Intronic
1080832921 11:35913076-35913098 ATCACCTAAAGTCCTACAGGGGG - Intergenic
1083714017 11:64565430-64565452 AGCACCCGCAGGCCTCAAGGGGG + Intronic
1084415899 11:69032850-69032872 TAGAGCCACAGTCCTCCCGGAGG + Intergenic
1085443001 11:76580077-76580099 ACCACCCACCAGCCTCCAGGTGG - Intergenic
1085763199 11:79260007-79260029 ACCACCCACAGCCCTCCAGGTGG - Intronic
1086465176 11:87045574-87045596 GACTCCCTCATTCCTCCAGGTGG - Intronic
1092538577 12:9406304-9406326 AAAACCCACAGTCCTCCAGGTGG - Intergenic
1092538875 12:9407304-9407326 AATACCCACAGTCCTCCAGGTGG - Intergenic
1092556551 12:9567615-9567637 AAAACCCACAGTCCTCCACTTGG + Intergenic
1092556864 12:9569184-9569206 AATACCCACAGTCCTCCAGGTGG + Intergenic
1093194469 12:16113303-16113325 CACACCCATAGTCCACCAAGAGG + Intergenic
1093256690 12:16876402-16876424 AAGAGCCACAGCCTTCCAGGTGG - Intergenic
1094513953 12:31117416-31117438 CATACCCACAGTCCTCCAGGTGG - Intergenic
1094514413 12:31118893-31118915 AAAACCCCCAGTCCTCCAGGTGG - Intergenic
1094514920 12:31120538-31120560 AATACCCACAGTCCTCCAGTTGG - Intergenic
1094515095 12:31121135-31121157 AATACCCAGGGTCCTCCAGGTGG - Intergenic
1094515538 12:31123023-31123045 AATACCCACAGTCCTCCACTTGG - Intergenic
1096485518 12:51978211-51978233 AATTCCCACAGTCAGCCAGGAGG - Intronic
1096520318 12:52181232-52181254 CACACCCACTCCCCTCCAGGAGG + Intronic
1097348471 12:58521515-58521537 AATCCCCAAAGTCTTCCAGGAGG + Intergenic
1100659767 12:96684213-96684235 AACATCCACATTTCTCCAAGTGG + Intronic
1102244902 12:111349308-111349330 AATACCCACACTCCTACAAGTGG - Exonic
1106333588 13:28762916-28762938 GACACCCACAGCCTTCCATGGGG + Intergenic
1106675437 13:31953157-31953179 AGCGCACACAGGCCTCCAGGTGG - Intergenic
1107940344 13:45377197-45377219 AATACCCAGAGTCCTCCAGGTGG + Intergenic
1107941018 13:45379983-45380005 AATACCCACAGTCCTCCAGGTGG + Intergenic
1107941354 13:45381199-45381221 AATACCCACAGTCCTCCAAGTGG + Intergenic
1107941954 13:45383217-45383239 AATACCCACAGTCCTCCAGGTGG + Intergenic
1107942083 13:45383886-45383908 AATACCCACAGTCCTCCAGATGG + Intergenic
1108053219 13:46464671-46464693 AATACCCACAGTCCTCCAGGTGG - Intergenic
1108053521 13:46465839-46465861 AATACCCACAGTCCCCCAGGTGG - Intergenic
1108053944 13:46467669-46467691 AATACCCACAGTCCTCCAAGTGG - Intergenic
1109406863 13:61911625-61911647 AACACTCAAAGTACTCCAGGAGG + Intergenic
1109537454 13:63738998-63739020 AATACCCACAGTCCTCCAGGTGG + Intergenic
1109537773 13:63740225-63740247 AATACCCACAGTCCTCCAGGTGG + Intergenic
1109537899 13:63740891-63740913 TATACCCACAGTCCTCCAGGTGG + Intergenic
1109545688 13:63838090-63838112 AATACCCACAGTCCTCCAAGTGG - Intergenic
1109545923 13:63839078-63839100 TATACCCACAGTCCTCCAGGAGG - Intergenic
1109546046 13:63839745-63839767 AATACCCACAGTCCTCCAGGTGG - Intergenic
1109546538 13:63841519-63841541 AATACCCACAGTCCTCCAGGTGG - Intergenic
1110891673 13:80704784-80704806 AATACCCACAGTCCTCCAGGTGG - Intergenic
1110892130 13:80706437-80706459 GATACCCACAGTCCTCCAGGTGG - Intergenic
1111889083 13:94059450-94059472 AACACCCACAGCCAGCCTGGAGG + Intronic
1112078272 13:95936666-95936688 AACACCCACTGTCCTCGATTAGG - Intronic
1121026551 14:90620564-90620586 ACCCCCCACAGTCCTCCATGGGG - Intronic
1121373328 14:93381316-93381338 AGCACCCACACTCCTTCTGGGGG - Intronic
1121474048 14:94178026-94178048 AAATCCCACATTCCCCCAGGAGG - Intronic
1121522781 14:94597918-94597940 AGAAGCCACAGTGCTCCAGGAGG - Intronic
1122886671 14:104713377-104713399 ACCACCCCCAGCCCTCTAGGTGG + Intronic
1124156811 15:27233169-27233191 CACAGCCCCTGTCCTCCAGGAGG - Intronic
1125721337 15:41846541-41846563 CACCCCCACAGCCCTGCAGGTGG - Intronic
1126787736 15:52191798-52191820 CACACACACAGTCCTCCAACGGG + Intergenic
1129236186 15:74225106-74225128 CACACACACACGCCTCCAGGAGG - Intergenic
1129893055 15:79084601-79084623 ACCACCCACTGTCCTCCTCGTGG + Intronic
1132958095 16:2607031-2607053 CACAGCCACAGTCCTGCTGGAGG - Intergenic
1132970569 16:2686279-2686301 CACAGCCACAGTCCTGCTGGAGG - Intronic
1134028386 16:10972214-10972236 AAGGCCCACAGTCCTGCAGTTGG + Intronic
1134669983 16:16047707-16047729 CACACCCTCAGTCCTTCAGTGGG + Intronic
1136938128 16:34495022-34495044 TAAAACCACAGTCATCCAGGGGG + Intergenic
1136961687 16:34853535-34853557 TAAAACCACAGTCATCCAGGGGG - Intergenic
1137017255 16:35390346-35390368 AATAAACACAGTCCTCCATGTGG + Intergenic
1137396862 16:48122246-48122268 AACACCCACAGCCGTGCAGGTGG - Intronic
1137554696 16:49463240-49463262 AACAGCCAAAGGCCTCCAGAGGG + Intergenic
1141291810 16:82724846-82724868 TACACCCTCAGTCTTCCAGTTGG + Intronic
1142042407 16:87903016-87903038 AACAGCCTCAGTCTTCCTGGTGG + Intronic
1145765899 17:27457847-27457869 AACATCCCCAGACCTGCAGGAGG - Intronic
1145836285 17:27956603-27956625 AACTCCCACAGTCATCAAGTAGG + Intergenic
1147660623 17:42115156-42115178 AACCCTCACAGTGCCCCAGGAGG - Intronic
1151437166 17:74104940-74104962 GACAGCCACAGTCATCCTGGAGG - Intergenic
1151811742 17:76447589-76447611 AACCCCGGCCGTCCTCCAGGAGG - Intronic
1151928305 17:77214609-77214631 ACCACCCACTGTCCTGCAGTGGG + Intronic
1152893381 17:82895629-82895651 AACTCCCACCTTCCTCCAGCGGG - Intronic
1157538353 18:48478451-48478473 TACACCCACAAGTCTCCAGGTGG - Intergenic
1159894818 18:73986106-73986128 AACACACACAGTTCCCCAGATGG + Intergenic
1160191205 18:76715237-76715259 AACACCCGCCGTTCTCGAGGCGG + Intergenic
1162788705 19:13052075-13052097 AACGCCCTCAGGCATCCAGGTGG + Intronic
1163834172 19:19563207-19563229 TCCTCCCACAGTCCTCTAGGAGG + Intronic
1164427187 19:28152029-28152051 AACAGCCACAGCCCTGCAGCTGG + Intergenic
1166657698 19:44624123-44624145 ATAATCCACAGTCCGCCAGGTGG - Intronic
1166696171 19:44852646-44852668 GACAACTGCAGTCCTCCAGGTGG + Intronic
1166743937 19:45130968-45130990 AACAGACACAGTCATCCAAGTGG - Intronic
1166918876 19:46214590-46214612 ATCACCCACATTCCACCAAGAGG + Intergenic
1166921853 19:46233729-46233751 ATCACCCACATTCCACCAAGAGG + Intergenic
1167621661 19:50564182-50564204 ACAACCCACAGTTATCCAGGGGG + Intronic
1167648410 19:50717826-50717848 AACACCCCCAGTCCTCAGAGTGG - Intronic
925037962 2:706342-706364 GTCACCCACAGACCTTCAGGTGG - Intergenic
925043087 2:748840-748862 AACACACACAGCTCTCCATGCGG - Intergenic
926153691 2:10438810-10438832 ACCAGGCACCGTCCTCCAGGAGG - Intergenic
926226887 2:10973106-10973128 AACAGCCAAAGTCCTCCCTGTGG - Intergenic
927793184 2:26026882-26026904 CACACCCACAGTCTTCCTGCAGG - Intergenic
932144853 2:69307775-69307797 AGAACCCACAGTTCTCCAGGTGG - Intergenic
933512348 2:83257020-83257042 GACAAACACAGTCCTCCTGGAGG - Intergenic
933632743 2:84675149-84675171 AAGACACACAGTGCTCCATGAGG - Intronic
933907341 2:86907903-86907925 AATGTCCACAGTGCTCCAGGAGG + Intergenic
933908587 2:86917565-86917587 AATGTCCACAGTGCTCCAGGAGG + Intronic
936364779 2:111843503-111843525 AATGTCCACAGTGCTCCAGGAGG - Exonic
939526336 2:143299698-143299720 AACACTCACAGTCCTTAATGAGG + Intronic
940275772 2:151939120-151939142 AGCACCCACAGTGCTTCAAGAGG + Intronic
944899929 2:204203865-204203887 AGCACCCACTGTGCGCCAGGTGG + Intergenic
946082156 2:217130383-217130405 CCCACCCTCCGTCCTCCAGGAGG - Intergenic
946415503 2:219537999-219538021 CACCCCCACGGTCCCCCAGGAGG + Exonic
948426996 2:237894689-237894711 AACTGCCACAGTGCACCAGGAGG - Intronic
948676517 2:239600273-239600295 ATCACCCACAATCCTCCAGCAGG - Intergenic
1170370022 20:15638514-15638536 AAGACCAATAGTCCTCCTGGAGG + Intronic
1170397232 20:15939864-15939886 ACCACTCACAGTCATCCATGAGG - Intronic
1172775322 20:37403637-37403659 GAGACCCACAGAGCTCCAGGAGG - Exonic
1175932785 20:62500810-62500832 AACACCCACACTAGTGCAGGAGG - Intergenic
1176052092 20:63125214-63125236 GACACCCACAGTCCTGAAGGAGG - Intergenic
1178265323 21:31137692-31137714 TACACCCAAAGTCATCCGGGCGG - Intronic
1179320634 21:40287771-40287793 ACCACGCACAGTCCCCCAGAGGG - Intronic
1179607994 21:42530693-42530715 TAACCCCACTGTCCTCCAGGGGG + Intronic
1180153712 21:45966793-45966815 AAGACCCACAGTCAGCAAGGTGG - Intergenic
1180230083 21:46421923-46421945 CCCACCCACAGCTCTCCAGGGGG - Intronic
1181821004 22:25475643-25475665 AACAGACACAGTCATCCACGTGG + Intergenic
1182349667 22:29692214-29692236 GAGAGCCACAGTCCTCCAGAAGG - Intronic
1182892382 22:33829802-33829824 AAAACCAACAGTGATCCAGGGGG + Intronic
1183406611 22:37633335-37633357 AGCCCCCACAGTCCCTCAGGGGG - Exonic
1183540441 22:38426666-38426688 AACCCCCACCTTCCTCCAGAAGG + Exonic
1183978842 22:41528133-41528155 AAGGCCCCCAGTTCTCCAGGTGG + Exonic
1184408129 22:44311721-44311743 ATGCCCCACTGTCCTCCAGGGGG + Intronic
1184610372 22:45599427-45599449 AGCACCCCCAGTTCTCCATGGGG - Intronic
1184855557 22:47144617-47144639 AACACCGACGCGCCTCCAGGTGG - Intronic
1184893075 22:47391338-47391360 CACACCCACTGACCACCAGGCGG + Intergenic
1185394409 22:50579354-50579376 AGCAGCCACACTCTTCCAGGAGG - Intronic
949883244 3:8677202-8677224 AATACCCACAGTCCTCCAGGTGG - Intronic
949883872 3:8679701-8679723 AATACCCACAGTCCTCCAGGTGG - Intronic
949884385 3:8681887-8681909 AAAACCCACAGTCCTCCAGGTGG - Intronic
949894666 3:8760296-8760318 TACACCCACAGACCTCTGGGAGG - Intronic
953499075 3:43415417-43415439 AACACCCACCCTGCTCCTGGTGG + Intronic
954708573 3:52493944-52493966 CACACCCACAGTCTTCCTGGGGG - Intergenic
957146843 3:76435312-76435334 AACACCCTCATTCCTACAGAAGG + Intronic
960947016 3:122973870-122973892 AAGACTCACAGCCCTCCAGAAGG - Intronic
961110279 3:124277674-124277696 CACACCCACACTCCTCCTGCAGG - Intronic
962431927 3:135327945-135327967 AGCAAACACAGCCCTCCAGGTGG - Intergenic
968286240 3:197510407-197510429 AAACACCACTGTCCTCCAGGGGG - Exonic
968357952 3:198122902-198122924 AACAACCAGGGGCCTCCAGGTGG - Intergenic
969521128 4:7678334-7678356 GACACCCACCGTCCACCAGCTGG + Intronic
970442066 4:16089612-16089634 AACAACCACAATGGTCCAGGTGG - Intergenic
973676959 4:53273862-53273884 AACACCCACAGACTGCCAAGTGG - Exonic
974508607 4:62808076-62808098 AATACCCCCAGGCCTCCAGAGGG - Intergenic
977258375 4:94765868-94765890 AACTCCCACAGTTAACCAGGAGG - Intronic
978892776 4:113849880-113849902 AATACACACTGTCCTCCTGGTGG - Intergenic
981289609 4:143058944-143058966 AACACACACAGGCCTACAAGAGG - Intergenic
982131117 4:152229440-152229462 AACTCCCACAGTGCTGCAGGTGG - Intergenic
985003345 4:185506866-185506888 CACACCCACACTCCTCCACTTGG + Intronic
990393740 5:55355158-55355180 CACACCCACTGTCCTCCACAAGG - Intronic
991128229 5:63091179-63091201 AACACCAACAGACCTGCAGCTGG + Intergenic
998424016 5:142012218-142012240 ACCACCCACAGACCACGAGGAGG + Exonic
1001875979 5:175201081-175201103 AACCCCCAAAGTCATCCATGAGG - Intergenic
1002915139 6:1522953-1522975 AACAGCCACTGTGCTCCAGCTGG + Intergenic
1008234443 6:49026891-49026913 AAGACCCACCCTCCTCCAGTTGG + Intergenic
1011752134 6:90463954-90463976 AAATTCCACAGTCCACCAGGAGG + Intergenic
1013455171 6:110323680-110323702 AACACCAAGAGACCTCCAGGAGG + Intronic
1014069221 6:117161869-117161891 AACTGCCACAGTAGTCCAGGTGG - Intergenic
1014741496 6:125152895-125152917 AACTCCCAAAGTCATTCAGGAGG - Intronic
1014925801 6:127267838-127267860 AAGACCCACACTCCTTCAGACGG - Intronic
1018851491 6:167643720-167643742 AAAACCCAAATGCCTCCAGGTGG + Intergenic
1019142029 6:169954407-169954429 ATCATCCTCAGTACTCCAGGAGG + Intergenic
1019451940 7:1103437-1103459 AAAACACACAGTCCTCTTGGAGG + Intronic
1019927439 7:4202604-4202626 AACATTCACCGTCCGCCAGGCGG - Intronic
1020117254 7:5482648-5482670 ACCAACCACAGTCCCCCAGCGGG + Intronic
1021263940 7:18495793-18495815 AAAACCCTCAGTCCTGCAAGTGG - Intronic
1021655823 7:22872686-22872708 AATACCAACAGTCCGGCAGGAGG - Intergenic
1021804035 7:24337403-24337425 ACCAGCCACAGTCATCCTGGTGG - Intergenic
1024377528 7:48656316-48656338 AAGACCCAGCATCCTCCAGGTGG + Intergenic
1033249440 7:139746223-139746245 GACACCCACTGTCCCCCAGCCGG + Intronic
1034303126 7:150033492-150033514 AATATCCACAGTACTCCAGGTGG + Intergenic
1034303432 7:150034712-150034734 AATACCCACAGTCCTCCAGGTGG + Intergenic
1034303716 7:150035648-150035670 AACACTCGCAGTCCTCCAGGTGG + Intergenic
1034303997 7:150036799-150036821 AACACCCACAGTCCTCCAGGTGG + Intergenic
1034304143 7:150037268-150037290 AACACCCACAGTCCTCCAGGTGG + Intergenic
1034304261 7:150037657-150037679 AACACCCACAGTCCTCCAGGTGG + Intergenic
1034304515 7:150038695-150038717 AACACCCACAGTCCTCCAGGTGG + Intergenic
1034304630 7:150039086-150039108 AACACCCACAGTCCTCCAGGTGG + Intergenic
1034304803 7:150039633-150039655 AACACCCACAGTCCTCCAGGTGG + Intergenic
1034305061 7:150040697-150040719 CATACCCACAGTCCTCCAGGTGG + Intergenic
1034305204 7:150041443-150041465 AAAACCCACAGTCCTCCAGGTGG + Intergenic
1034305379 7:150041994-150042016 AACACCCACAGTCCTCCAGGTGG + Intergenic
1034305693 7:150043221-150043243 CATACCCACAGTCCTCCAGGTGG + Intergenic
1034801151 7:154057429-154057451 CATACCCACAGTCCTCCAGGTGG - Intronic
1034801464 7:154058657-154058679 ACCACCCGCAGTCCTCCAGGTGG - Intronic
1034801686 7:154059367-154059389 AATACCCACAGTCCTCCAGGTGG - Intronic
1034801969 7:154060506-154060528 AACACCCGCAGTCCTCCAGGTGG - Intronic
1034802105 7:154060973-154060995 AATACCCACAGTCCTCCAGGTGG - Intronic
1034802419 7:154062195-154062217 AACACCCGCAGTCCTCCAGGTGG - Intronic
1034802650 7:154062907-154062929 AACACCCACAGTCCTCCAGGTGG - Intronic
1034802924 7:154063776-154063798 AATATCCACAGTCCTCCAGGTGG - Intronic
1037768110 8:21784117-21784139 CACACCCACAGTGCCTCAGGAGG + Intronic
1037964436 8:23123053-23123075 CACACCCACAGTGCCGCAGGGGG - Intergenic
1038009508 8:23463672-23463694 AACACCCACACACAGCCAGGAGG - Intergenic
1042153127 8:65811367-65811389 AACAAACACAGCCCTCCAGGGGG + Intronic
1044608784 8:94071917-94071939 AACTTCCACAGACCTCCAAGAGG - Intergenic
1046949064 8:120002939-120002961 AACACACACAGTCACCAAGGGGG - Intronic
1048643924 8:136396427-136396449 AGCACCCACAATTGTCCAGGTGG + Intergenic
1051669897 9:19499043-19499065 AACAACCACAGTCTTCAAGATGG + Intergenic
1055158345 9:73093573-73093595 ATCACCCACAGTCATACAGCTGG - Intergenic
1057155668 9:92837011-92837033 AGCACACACAGGCCTCCAGCTGG + Intergenic
1059451636 9:114374538-114374560 AACACCGACAGTGCAGCAGGGGG - Intronic
1061329143 9:129881314-129881336 AGCCCCCACATCCCTCCAGGTGG - Exonic
1061889383 9:133609530-133609552 GGCACCCCCAGGCCTCCAGGAGG - Intergenic
1062197492 9:135282351-135282373 AGCACACAGAGTCCCCCAGGAGG + Intergenic
1062623448 9:137432898-137432920 AACACCCACAGACCACCTGCTGG + Intronic
1187304419 X:18082550-18082572 AAAACAAACAGTCCTCCTGGTGG - Intergenic
1187466642 X:19533329-19533351 TTCACACACAGTCCTCTAGGTGG - Intergenic
1187970474 X:24653536-24653558 AACTCCCAGAGTCCCCCAGTGGG + Intronic
1194892252 X:99394637-99394659 GACACCCACTGTCCTGAAGGGGG - Intergenic
1197165951 X:123377854-123377876 GACACCCACAGTAGTCAAGGTGG - Intronic
1199673432 X:150165453-150165475 AAGACCCACAGTCCTCATGTTGG + Intergenic
1199989699 X:152979458-152979480 AAAAGCCAGAGTCCTCAAGGTGG + Intergenic
1200218813 X:154380606-154380628 AACACCCAGAGCCATTCAGGAGG + Intronic