ID: 1034304516

View in Genome Browser
Species Human (GRCh38)
Location 7:150038696-150038718
Sequence ACACCCACAGTCCTCCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 8, 1: 27, 2: 13, 3: 23, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034304510_1034304516 21 Left 1034304510 7:150038652-150038674 CCCACGTAAGGTCGGAAGATTTG No data
Right 1034304516 7:150038696-150038718 ACACCCACAGTCCTCCAGGTGGG 0: 8
1: 27
2: 13
3: 23
4: 217
1034304511_1034304516 20 Left 1034304511 7:150038653-150038675 CCACGTAAGGTCGGAAGATTTGA No data
Right 1034304516 7:150038696-150038718 ACACCCACAGTCCTCCAGGTGGG 0: 8
1: 27
2: 13
3: 23
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034304516 Original CRISPR ACACCCACAGTCCTCCAGGT GGG Intergenic
902053346 1:13581339-13581361 AAACCCACAGTCCTCAAAGTGGG + Intergenic
902400427 1:16154208-16154230 CCAACCACAGTCCCCCAGGAAGG + Intronic
903940522 1:26927221-26927243 ACAGCCACTGTGCTCCAGCTGGG - Intronic
903981973 1:27195264-27195286 CCACCAGCAGTCCTCCAGGTAGG - Intergenic
904461696 1:30684568-30684590 AGAGCCCAAGTCCTCCAGGTGGG - Intergenic
905205762 1:36342094-36342116 ACACCCTCAGGCCTCAAGGCCGG + Intronic
905663276 1:39744990-39745012 CCACCCACTGTCCTCTAGTTAGG - Intronic
906245036 1:44267469-44267491 ACACCCACAGTCCAGGAGGAGGG + Intronic
908164207 1:61441921-61441943 ACCCCCACCGTCTTCCAGGAAGG + Intronic
908854181 1:68406041-68406063 CCCCCCACAGACCTCCAGGATGG - Intergenic
910251629 1:85203352-85203374 TCTCCCTCAGTCATCCAGGTTGG - Intergenic
911447940 1:98022371-98022393 AGACCCCTAGTCTTCCAGGTGGG + Intergenic
915713556 1:157923897-157923919 ACATCCACAGTCCTCAAAATGGG - Intergenic
916377667 1:164173114-164173136 TCATCCACAGTGCTACAGGTGGG - Intergenic
917089022 1:171333862-171333884 ACACCCACTGCACTCCAGCTTGG - Intronic
919844403 1:201632266-201632288 ACATCCCCAGTGCCCCAGGTTGG - Intronic
920035092 1:203060403-203060425 CCACTCACAGTCCTGGAGGTGGG - Exonic
924558046 1:245134010-245134032 TCACCCACTGCACTCCAGGTAGG - Intergenic
1062919768 10:1271079-1271101 ACAAGCACAGGCCTCCACGTTGG + Intronic
1064137544 10:12763953-12763975 ACCCCCACAGCCCTCCTGTTGGG + Intronic
1064287361 10:14003426-14003448 ACACCCACAGACCCCCAAGCTGG - Intronic
1065417564 10:25504687-25504709 AAAGCCACACTCCTGCAGGTAGG - Intronic
1066354275 10:34666601-34666623 TCACCCTCAGCCCTCCAGGCAGG + Intronic
1069070240 10:63984791-63984813 AAACCCACAATCTTCCAGCTTGG + Intergenic
1069162283 10:65106898-65106920 AAACCCACAATCTTCCAGCTTGG - Intergenic
1069873701 10:71548577-71548599 ACACCCAGAGACCTGCAGGGAGG - Intronic
1072284602 10:93901401-93901423 CCACCCACTGTCCACCACGTTGG - Exonic
1073348669 10:102803264-102803286 TCACCCACCGTCCTGCAGGATGG + Intronic
1075538792 10:123294998-123295020 CCACCCAAAGCCCTCCAGGATGG + Intergenic
1076719469 10:132386928-132386950 ACACCCCCAATCCACCAGGGAGG - Intergenic
1077107689 11:849157-849179 AGACCCAGAGCGCTCCAGGTGGG - Intronic
1077183428 11:1226383-1226405 AGACCCAGAGTCCTCCGTGTGGG + Intronic
1077205786 11:1343427-1343449 ACTCTCACAGTCCTCGAGGCTGG + Intergenic
1078442117 11:11376920-11376942 CCAACCACTGTGCTCCAGGTTGG - Intronic
1078546276 11:12249304-12249326 ACTCCCAGAGCCCTGCAGGTGGG - Intronic
1082988525 11:59187685-59187707 TCACCCACACTCCTGCAGCTGGG - Intronic
1083750553 11:64758511-64758533 TCACCCTCACTCCTCCAGCTGGG - Exonic
1084031791 11:66485388-66485410 ACACCCACAGTCATGCAGGGTGG - Intronic
1084067368 11:66712741-66712763 ATAGCCACAGTACTCCAGCTTGG - Intronic
1085442999 11:76580076-76580098 CCACCCACCAGCCTCCAGGTGGG - Intergenic
1086465175 11:87045573-87045595 ACTCCCTCATTCCTCCAGGTGGG - Intronic
1087152801 11:94873545-94873567 GCACCCCCTGTACTCCAGGTGGG - Exonic
1089305828 11:117525502-117525524 TCACCCACTGCCCTCCAGGCTGG - Intronic
1089395973 11:118136466-118136488 TCCCCCACAGTCTTCCAAGTAGG - Exonic
1091706245 12:2695367-2695389 ACCCCCACATCCCACCAGGTAGG - Intronic
1092538576 12:9406303-9406325 AAACCCACAGTCCTCCAGGTGGG - Intergenic
1092538874 12:9407303-9407325 ATACCCACAGTCCTCCAGGTGGG - Intergenic
1092556552 12:9567616-9567638 AAACCCACAGTCCTCCACTTGGG + Intergenic
1092556865 12:9569185-9569207 ATACCCACAGTCCTCCAGGTGGG + Intergenic
1093194470 12:16113304-16113326 ACACCCATAGTCCACCAAGAGGG + Intergenic
1093256689 12:16876401-16876423 AGAGCCACAGCCTTCCAGGTGGG - Intergenic
1094513952 12:31117415-31117437 ATACCCACAGTCCTCCAGGTGGG - Intergenic
1094514412 12:31118892-31118914 AAACCCCCAGTCCTCCAGGTGGG - Intergenic
1094514919 12:31120537-31120559 ATACCCACAGTCCTCCAGTTGGG - Intergenic
1094515094 12:31121134-31121156 ATACCCAGGGTCCTCCAGGTGGG - Intergenic
1094515537 12:31123022-31123044 ATACCCACAGTCCTCCACTTGGG - Intergenic
1097063645 12:56304190-56304212 ACAGCCACTGTACTCCAGATTGG + Intronic
1100037597 12:90272184-90272206 ATATTCACAGTGCTCCAGGTGGG - Intergenic
1102195801 12:111024348-111024370 ACACCGAGTGTCCACCAGGTGGG + Intergenic
1102244901 12:111349307-111349329 ATACCCACACTCCTACAAGTGGG - Exonic
1102460196 12:113095186-113095208 ATCCCCACAGGCATCCAGGTGGG + Exonic
1102751931 12:115302320-115302342 ACACCCACAGTCCTCTAGTGTGG - Intergenic
1102935998 12:116897580-116897602 ACATGCACTGTCCTCCAGGAAGG + Intergenic
1104023224 12:125007674-125007696 ACCCCCACTGTACTCCAGGCTGG + Intronic
1105286870 13:19011769-19011791 ACACCCAGAGTGCTCCTGATCGG + Intergenic
1106130166 13:26933215-26933237 ACAGCCATTGTCCTGCAGGTAGG + Intergenic
1106287883 13:28334039-28334061 ACAGCCACAGTCCGGCACGTAGG + Exonic
1106675436 13:31953156-31953178 GCGCACACAGGCCTCCAGGTGGG - Intergenic
1107630972 13:42342585-42342607 ACAGCAGCTGTCCTCCAGGTAGG + Intergenic
1107940345 13:45377198-45377220 ATACCCAGAGTCCTCCAGGTGGG + Intergenic
1107941019 13:45379984-45380006 ATACCCACAGTCCTCCAGGTGGG + Intergenic
1107941355 13:45381200-45381222 ATACCCACAGTCCTCCAAGTGGG + Intergenic
1107941955 13:45383218-45383240 ATACCCACAGTCCTCCAGGTGGG + Intergenic
1107942084 13:45383887-45383909 ATACCCACAGTCCTCCAGATGGG + Intergenic
1108053218 13:46464670-46464692 ATACCCACAGTCCTCCAGGTGGG - Intergenic
1108053520 13:46465838-46465860 ATACCCACAGTCCCCCAGGTGGG - Intergenic
1108053943 13:46467668-46467690 ATACCCACAGTCCTCCAAGTGGG - Intergenic
1109537329 13:63738332-63738354 ATACCCACAGTCCTCCAGGTAGG + Intergenic
1109537455 13:63738999-63739021 ATACCCACAGTCCTCCAGGTGGG + Intergenic
1109537774 13:63740226-63740248 ATACCCACAGTCCTCCAGGTGGG + Intergenic
1109537900 13:63740892-63740914 ATACCCACAGTCCTCCAGGTGGG + Intergenic
1109545687 13:63838089-63838111 ATACCCACAGTCCTCCAAGTGGG - Intergenic
1109545922 13:63839077-63839099 ATACCCACAGTCCTCCAGGAGGG - Intergenic
1109546045 13:63839744-63839766 ATACCCACAGTCCTCCAGGTGGG - Intergenic
1109546537 13:63841518-63841540 ATACCCACAGTCCTCCAGGTGGG - Intergenic
1110891672 13:80704783-80704805 ATACCCACAGTCCTCCAGGTGGG - Intergenic
1110892129 13:80706436-80706458 ATACCCACAGTCCTCCAGGTGGG - Intergenic
1111935590 13:94553924-94553946 ACACACACAGTGCTCCAGGCAGG + Intergenic
1112409782 13:99153020-99153042 CCACCCACAGTCCTGTGGGTTGG - Intergenic
1113261789 13:108572908-108572930 ACACCCACAGTCCTCATGCAAGG - Intergenic
1117787013 14:59296608-59296630 ACACACACACTCCTAGAGGTTGG - Intronic
1118036840 14:61877310-61877332 ACTCCCACAGTCCGACAGTTAGG + Intergenic
1120261288 14:82189187-82189209 AAACCCACAGCCTTCCAGCTTGG - Intergenic
1121603325 14:95222416-95222438 ACACTGACGCTCCTCCAGGTTGG + Intronic
1122886673 14:104713378-104713400 CCACCCCCAGCCCTCTAGGTGGG + Intronic
1122938863 14:104972367-104972389 ACACCCACACTCAGCCAGGCAGG + Intronic
1123989811 15:25675049-25675071 ACACCCACAGCCATCCAGCCAGG - Intergenic
1125721336 15:41846540-41846562 ACCCCCACAGCCCTGCAGGTGGG - Intronic
1126175633 15:45732899-45732921 ACACCCTCAGTCCACCAGCCAGG - Intergenic
1127324409 15:57881379-57881401 AGACACACAGTCCCCCAGCTTGG + Intergenic
1129676934 15:77636790-77636812 AGACCCACAGCCCTCCATGATGG + Intronic
1129893057 15:79084602-79084624 CCACCCACTGTCCTCCTCGTGGG + Intronic
1130064917 15:80595306-80595328 CCTCCCAGAGTCCTTCAGGTAGG + Exonic
1130196115 15:81781784-81781806 ACACCTGTAGTTCTCCAGGTGGG - Intergenic
1131881289 15:96865224-96865246 GCACCCACCTGCCTCCAGGTAGG - Intergenic
1132934122 16:2472434-2472456 GCAGCCACCGACCTCCAGGTGGG + Exonic
1133010664 16:2909397-2909419 TCTCCCTCAGTCGTCCAGGTTGG - Intergenic
1134028387 16:10972215-10972237 AGGCCCACAGTCCTGCAGTTGGG + Intronic
1134390060 16:13811267-13811289 ACACCCACAGCACTCCAGCCTGG + Intergenic
1134785660 16:16940518-16940540 ACTCCCACAGTCCTACAAGATGG + Intergenic
1137017256 16:35390347-35390369 ATAAACACAGTCCTCCATGTGGG + Intergenic
1138549521 16:57739957-57739979 ACAGACAGAGCCCTCCAGGTAGG + Intronic
1140474708 16:75234193-75234215 ACACACACACTCCCCCAGGCTGG + Intronic
1142042408 16:87903017-87903039 ACAGCCTCAGTCTTCCTGGTGGG + Intronic
1203143242 16_KI270728v1_random:1782783-1782805 ACACTCAATGTCCTCCATGTGGG - Intergenic
1144435193 17:15233707-15233729 AGACACACAGTCCTTAAGGTAGG - Intronic
1145250934 17:21296672-21296694 ACTCCCACAGCCCTACAGGGAGG - Intronic
1145252615 17:21304742-21304764 ACCCCCACAGTGCCCCAGTTGGG + Intronic
1145323950 17:21783167-21783189 ACCCCCACAGTGCCCCAGTTGGG - Intergenic
1146404552 17:32525989-32526011 AGACCAAGAGTCTTCCAGGTGGG - Intronic
1146739193 17:35266633-35266655 ACTGCCACAGTCCCCCAGGGAGG + Exonic
1148602974 17:48908296-48908318 CCACCTACGGTCCTCCAGGACGG - Intergenic
1149505504 17:57190537-57190559 AAACCCACAGGCCACCAGGATGG - Intergenic
1150284083 17:63945767-63945789 ACACACACAGCCCAGCAGGTCGG - Intronic
1150284914 17:63949166-63949188 ACACCCACACTCCTGCACGTTGG + Intronic
1151670864 17:75571086-75571108 CCACTCACTGTCCTTCAGGTAGG - Exonic
1152235044 17:79134293-79134315 CCAACCACATTCCACCAGGTGGG - Intronic
1152876768 17:82790782-82790804 ACATCCACTGGCCTCCTGGTTGG + Intronic
1153576067 18:6523162-6523184 TCACCCACAGACCACCTGGTGGG + Intronic
1156294716 18:35778940-35778962 ACACCCATAGTTCTCCATGATGG - Intergenic
1157754656 18:50207022-50207044 ACAGCCACCGTACTCCAGGCTGG - Intergenic
1158718313 18:59900064-59900086 ACACGAACAGTCCTGCAGGCAGG - Exonic
1159619734 18:70623423-70623445 ACACCTCCAGTGCTCCAGATGGG + Intergenic
1161220965 19:3117976-3117998 ACACCCACTGTCCTCCCGCCTGG + Intronic
1162557014 19:11393415-11393437 TCTCCCTCTGTCCTCCAGGTTGG + Intronic
1163783960 19:19264933-19264955 TCACCGACAGCCCCCCAGGTAGG + Intronic
1164974351 19:32560671-32560693 AGACCCACAGTCCTCCAGAGAGG - Intergenic
1165075722 19:33278953-33278975 ACTCCCACTCACCTCCAGGTTGG + Intergenic
1166696172 19:44852647-44852669 ACAACTGCAGTCCTCCAGGTGGG + Intronic
1166743936 19:45130967-45130989 ACAGACACAGTCATCCAAGTGGG - Intronic
1167089983 19:47337233-47337255 ACACCCACAGTCATGGAGGCCGG + Intronic
1167350610 19:48971903-48971925 CAAGCCACTGTCCTCCAGGTTGG - Intronic
1168695119 19:58399935-58399957 ACACCCCCACTCCCCTAGGTTGG - Intergenic
925037961 2:706341-706363 TCACCCACAGACCTTCAGGTGGG - Intergenic
927049870 2:19316865-19316887 ACACCCACTGTACTCCAGCCTGG - Intergenic
927793183 2:26026881-26026903 ACACCCACAGTCTTCCTGCAGGG - Intergenic
929051164 2:37838204-37838226 ACACCCACCCTCCCCCAGGCTGG - Intergenic
932277872 2:70464940-70464962 ACTGCCACAGTCAGCCAGGTTGG - Intronic
933598364 2:84305212-84305234 ACACCCCCTGACCTCCAGGGAGG + Intergenic
934687661 2:96333670-96333692 ACACACACACTCCTCTAGCTAGG - Intergenic
937353628 2:121184641-121184663 TTCCCCACAGGCCTCCAGGTGGG - Intergenic
938107069 2:128539702-128539724 ACACCCTCAGTCTTCCAGACTGG + Intergenic
940129815 2:150368676-150368698 GCACCTACAGTCTTCCAGGGTGG - Intergenic
944182791 2:196913894-196913916 ACACCTGCTGTCCTCCAGGCTGG + Intronic
944443546 2:199766401-199766423 ACACCCACTGTCCTTCAGCATGG + Intronic
947622877 2:231602310-231602332 AGGCCCAGAGTCCTCCAGGAAGG + Intergenic
948227279 2:236320941-236320963 AAACCCAAAGTCCTCCTGGAAGG - Intergenic
1170394507 20:15911521-15911543 ACACCTCCAGTCTTCGAGGTGGG - Intronic
1170940471 20:20844389-20844411 TCGCCCACAGCCCTCCAGCTAGG + Intergenic
1172440321 20:34960871-34960893 ACCCCCACAGTCATCCTGGGAGG + Intergenic
1172775321 20:37403636-37403658 AGACCCACAGAGCTCCAGGAGGG - Exonic
1173199934 20:40946928-40946950 TCAGCCACAGGCTTCCAGGTGGG + Intergenic
1175543053 20:59760168-59760190 ACACCCACACTCATCATGGTTGG - Intronic
1177419568 21:20838844-20838866 AAACCCACAGTCTTCCAGCGTGG - Intergenic
1180045650 21:45303892-45303914 TCTCCCACAGTCCTGCAGGGTGG - Intergenic
1180153711 21:45966792-45966814 AGACCCACAGTCAGCAAGGTGGG - Intergenic
1181431342 22:22883501-22883523 ACACCCAGGGACCTCCAGCTTGG - Intronic
1182226885 22:28805673-28805695 AAACCCACAGCCTTCCAGCTTGG + Intergenic
1183709197 22:39492473-39492495 GCACCCACCCTCCTGCAGGTGGG + Intergenic
1183980248 22:41535452-41535474 ACATCCCTAGACCTCCAGGTGGG - Intronic
1184407725 22:44309374-44309396 CCACCAACAGTCCTGCGGGTAGG + Intronic
1184893076 22:47391339-47391361 ACACCCACTGACCACCAGGCGGG + Intergenic
1185241546 22:49750030-49750052 CCACCCACAGGGCTCCAGGCAGG + Intergenic
949883243 3:8677201-8677223 ATACCCACAGTCCTCCAGGTGGG - Intronic
949883871 3:8679700-8679722 ATACCCACAGTCCTCCAGGTGGG - Intronic
949884384 3:8681886-8681908 AAACCCACAGTCCTCCAGGTGGG - Intronic
949894665 3:8760295-8760317 ACACCCACAGACCTCTGGGAGGG - Intronic
953565329 3:44027446-44027468 ACACCTGCTGTGCTCCAGGTCGG - Intergenic
954484582 3:50836161-50836183 ACAGCCACCGTCCTCCAGAATGG - Intronic
954936127 3:54328738-54328760 ACACCCACATTCCTCTCTGTGGG - Intronic
958917685 3:100067829-100067851 ATACCCAGAGTCCTCCTGGGTGG - Intronic
960037468 3:113116383-113116405 ACTCCCAAAGCCCGCCAGGTTGG + Intergenic
961733361 3:128984056-128984078 ACACCCACTGGGCACCAGGTGGG + Intronic
962431926 3:135327944-135327966 GCAAACACAGCCCTCCAGGTGGG - Intergenic
963696127 3:148567624-148567646 ACCCCTACAGTCCTGCATGTAGG + Intergenic
964299320 3:155270899-155270921 ACAGCCACAGTCCTAAAGGCTGG - Intergenic
964347719 3:155771081-155771103 ACACACACTGTCCTCCAGCCTGG - Intronic
965093520 3:164192992-164193014 AGCCCCACAGTCCCACAGGTTGG + Intergenic
966833654 3:184032535-184032557 TCACCCACATGGCTCCAGGTTGG + Intronic
968505871 4:971281-971303 ACACTCATTGTCCTCCAGGATGG - Intronic
968665007 4:1816207-1816229 ACACCCACAGTGTTGTAGGTGGG - Intronic
968812081 4:2804661-2804683 ACCCCCACTGTCCTTAAGGTTGG + Intronic
969521129 4:7678335-7678357 ACACCCACCGTCCACCAGCTGGG + Intronic
969521202 4:7678700-7678722 ACACCCACCATCCACCAGCTGGG + Intronic
969987300 4:11225509-11225531 TCACCCACACTCCTGCAGCTGGG + Intergenic
972288920 4:37672880-37672902 ACACTGACAGTCCTCCAGACTGG + Intronic
973676958 4:53273861-53273883 ACACCCACAGACTGCCAAGTGGG - Exonic
973797287 4:54440690-54440712 ACAAACACAGTCCTCCAATTAGG - Intergenic
976128499 4:81858556-81858578 AAACCCACAGTCTTCCAGCATGG + Intronic
976977340 4:91181069-91181091 AAACCCACAGTCTTCCAGCATGG + Intronic
977016888 4:91701880-91701902 AAACCCACAATCTTCCAGGGTGG + Intergenic
977956796 4:103037089-103037111 ACACCCACAGTCATTCAGATAGG - Intronic
980613746 4:135192424-135192446 ACACCCACAGTTATACAGGTTGG + Intergenic
983900837 4:173132082-173132104 AGAACCACAGTCCCCCGGGTGGG + Intergenic
986599142 5:9453884-9453906 ACTTACACAGTCCTTCAGGTTGG - Intronic
989952179 5:50312457-50312479 ACACACTCTGTCATCCAGGTGGG + Intergenic
991128230 5:63091180-63091202 ACACCAACAGACCTGCAGCTGGG + Intergenic
997274585 5:132574061-132574083 ACAGCCACTGTCCTCCAGACTGG - Intronic
997516423 5:134493068-134493090 TCACCAAGAGTCATCCAGGTTGG + Intergenic
1001307040 5:170582768-170582790 ACACCCACAGTCCTACAAATTGG + Intronic
1002635899 5:180608649-180608671 ACACACACTCTCCTCCAGGTTGG - Intronic
1002915140 6:1522954-1522976 ACAGCCACTGTGCTCCAGCTGGG + Intergenic
1003189452 6:3861449-3861471 AAACCCACAGTCCTCCCTGGTGG - Intergenic
1003232866 6:4270544-4270566 ACACTCACAGCCCTCAAGGATGG + Intergenic
1006334718 6:33414626-33414648 TCAGTCACAGTCTTCCAGGTGGG - Intronic
1007486202 6:42182429-42182451 ACACACACACACATCCAGGTGGG - Intergenic
1009640712 6:66331653-66331675 AAACCCACAATCTTCCAGCTTGG + Intergenic
1010244074 6:73646715-73646737 TCACCCACTGTACTCCAGCTTGG - Intronic
1014069220 6:117161868-117161890 ACTGCCACAGTAGTCCAGGTGGG - Intergenic
1015044187 6:128759538-128759560 ACTCCCACAGTCTCCCAGGTTGG + Intergenic
1015240406 6:131016512-131016534 ACACACACACTCCACCAGGCTGG + Intronic
1015947445 6:138517171-138517193 ACACCAACAGTCCAGGAGGTAGG + Intronic
1017626043 6:156349755-156349777 CCACTCAAAGTCCTCCAGTTGGG + Intergenic
1020030504 7:4929441-4929463 CCACCCACCTTCCTCAAGGTGGG + Intronic
1020810067 7:12840393-12840415 ACTCCAACAGTCCTGCAGCTTGG + Intergenic
1023033760 7:36112585-36112607 TCACACACAGCCCTGCAGGTAGG + Intergenic
1029610934 7:101626263-101626285 ACACCTACGGACCTCCAGGCAGG + Intronic
1033249441 7:139746224-139746246 ACACCCACTGTCCCCCAGCCGGG + Intronic
1034303127 7:150033493-150033515 ATATCCACAGTACTCCAGGTGGG + Intergenic
1034303433 7:150034713-150034735 ATACCCACAGTCCTCCAGGTGGG + Intergenic
1034303550 7:150035101-150035123 AAACCCACAGTCCTCCAGGTAGG + Intergenic
1034303717 7:150035649-150035671 ACACTCGCAGTCCTCCAGGTGGG + Intergenic
1034303998 7:150036800-150036822 ACACCCACAGTCCTCCAGGTGGG + Intergenic
1034304144 7:150037269-150037291 ACACCCACAGTCCTCCAGGTGGG + Intergenic
1034304262 7:150037658-150037680 ACACCCACAGTCCTCCAGGTGGG + Intergenic
1034304516 7:150038696-150038718 ACACCCACAGTCCTCCAGGTGGG + Intergenic
1034304631 7:150039087-150039109 ACACCCACAGTCCTCCAGGTGGG + Intergenic
1034304804 7:150039634-150039656 ACACCCACAGTCCTCCAGGTGGG + Intergenic
1034305205 7:150041444-150041466 AAACCCACAGTCCTCCAGGTGGG + Intergenic
1034305380 7:150041995-150042017 ACACCCACAGTCCTCCAGGTGGG + Intergenic
1034308322 7:150064520-150064542 ACACCCACTGTACTCCAGCCTGG + Intergenic
1034798531 7:154036151-154036173 ACACCCACTGTACTCCAGCCTGG - Intronic
1034801150 7:154057428-154057450 ATACCCACAGTCCTCCAGGTGGG - Intronic
1034801462 7:154058656-154058678 CCACCCGCAGTCCTCCAGGTGGG - Intronic
1034801685 7:154059366-154059388 ATACCCACAGTCCTCCAGGTGGG - Intronic
1034801968 7:154060505-154060527 ACACCCGCAGTCCTCCAGGTGGG - Intronic
1034802104 7:154060972-154060994 ATACCCACAGTCCTCCAGGTGGG - Intronic
1034802418 7:154062194-154062216 ACACCCGCAGTCCTCCAGGTGGG - Intronic
1034802649 7:154062906-154062928 ACACCCACAGTCCTCCAGGTGGG - Intronic
1034802923 7:154063775-154063797 ATATCCACAGTCCTCCAGGTGGG - Intronic
1034901885 7:154913028-154913050 AAACCCACTTTCCTCCAGCTTGG - Intergenic
1034980496 7:155473018-155473040 GCACACACAGTCCCCCAGGCAGG + Intergenic
1036678855 8:10855824-10855846 ACACACACCTTCCACCAGGTAGG - Intergenic
1036751221 8:11444633-11444655 GCACCCACAGGCTTCCAGGACGG - Exonic
1036956828 8:13197115-13197137 ACATCCTCAGACCCCCAGGTAGG - Intronic
1037768111 8:21784118-21784140 ACACCCACAGTGCCTCAGGAGGG + Intronic
1038183225 8:25248407-25248429 ACACCGACAGTCCTGCCGGGTGG + Intronic
1041082403 8:54226097-54226119 ATACCCACAGCCCTCCAGCCTGG - Intergenic
1047493261 8:125391051-125391073 CCACCCTCACTCCTCCAGGGAGG - Intergenic
1048643925 8:136396428-136396450 GCACCCACAATTGTCCAGGTGGG + Intergenic
1049358803 8:142202093-142202115 GCACCCACAGTCCTGGAGCTTGG - Intergenic
1049621631 8:143600863-143600885 AGACCTACAGTCCTTCTGGTTGG + Exonic
1049678317 8:143903320-143903342 ACACGCACAGGGCTCCAGGGTGG + Intergenic
1049786150 8:144451795-144451817 ACACCCACAGACGCCCAGGCTGG - Intronic
1052528940 9:29656833-29656855 ACACCCTCAGTCCTGCTGCTGGG + Intergenic
1052538466 9:29777264-29777286 ACACCCTCAGTCCTGCTGCTGGG + Intergenic
1052705373 9:31988410-31988432 ACAGCCACTGTCCTCCAGAATGG - Intergenic
1053736858 9:41107589-41107611 ATACCCACAGTCCTCCAGGTCGG - Intergenic
1054691514 9:68323808-68323830 ATACCCACAGCCCTCCAGGTCGG + Intergenic
1056462684 9:86823609-86823631 CCTCCCCCAGTCTTCCAGGTCGG - Intergenic
1056475195 9:86946390-86946412 GCAGTCACAGTCCTCCAGGGCGG + Exonic
1057155669 9:92837012-92837034 GCACACACAGGCCTCCAGCTGGG + Intergenic
1057178636 9:93017226-93017248 CCACTCACAGTGCTCCAGCTTGG + Intronic
1057805904 9:98219919-98219941 ACAGCCACAGGCCTCCCAGTGGG + Intronic
1060056158 9:120415006-120415028 ACATGTACAGTCCTCCAGGAAGG + Intronic
1060232515 9:121836245-121836267 TCACTCAGAGTCCTCCAGGCTGG + Intronic
1060421532 9:123472809-123472831 CCAGCCACGGTTCTCCAGGTAGG + Intronic
1060937296 9:127522860-127522882 ACACCCTCAGGCTCCCAGGTTGG + Intronic
1061329142 9:129881313-129881335 GCCCCCACATCCCTCCAGGTGGG - Exonic
1062430966 9:136526702-136526724 TCTCCCACAGTCCTCCACGTTGG - Intronic
1062623449 9:137432899-137432921 ACACCCACAGACCACCTGCTGGG + Intronic
1185550033 X:975631-975653 TCTCCCACAGTCCTGCAGGCTGG + Intergenic
1185628279 X:1497830-1497852 ACACCCACAGGCCTCCAAGCCGG - Intronic
1187304418 X:18082549-18082571 AAACAAACAGTCCTCCTGGTGGG - Intergenic
1190381900 X:49847264-49847286 TAACCTACAGTCCTCCAGCTAGG - Intergenic
1196759933 X:119191836-119191858 GCTGCCACAGTCATCCAGGTGGG + Intergenic
1197165108 X:123368501-123368523 CCACCCACAGTTCACCATGTCGG - Intronic
1201369929 Y:13252630-13252652 AAACCCACAGTCGTCCAGCATGG - Intronic