ID: 1034309533

View in Genome Browser
Species Human (GRCh38)
Location 7:150074663-150074685
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 2, 1: 0, 2: 0, 3: 10, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034309531_1034309533 -6 Left 1034309531 7:150074646-150074668 CCAAAAAAATTCTTATTGGGCAC No data
Right 1034309533 7:150074663-150074685 GGGCACACTATTCCAAAGGTTGG 0: 2
1: 0
2: 0
3: 10
4: 119
1034309528_1034309533 4 Left 1034309528 7:150074636-150074658 CCTAAGGCATCCAAAAAAATTCT No data
Right 1034309533 7:150074663-150074685 GGGCACACTATTCCAAAGGTTGG 0: 2
1: 0
2: 0
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034309533 Original CRISPR GGGCACACTATTCCAAAGGT TGG Intergenic
902362955 1:15951976-15951998 GGGCACCGTATTCCAAGGGTGGG - Intronic
902369068 1:15994096-15994118 GGGGACACTGTCCCACAGGTTGG - Intergenic
903028449 1:20445844-20445866 ATCCACACAATTCCAAAGGTGGG + Intergenic
907272754 1:53300417-53300439 GGGCCCACAACACCAAAGGTAGG + Intronic
908176973 1:61565632-61565654 GGGCACACCAGTGCAAGGGTTGG + Intergenic
909024123 1:70463385-70463407 GGGCACACTGTTGCAAGGGTAGG - Intergenic
909471190 1:76030312-76030334 GGACATACTAGTCCAAAGTTAGG + Intergenic
923061892 1:230483426-230483448 GGACACACTACTCCAAAGTACGG + Intergenic
923172300 1:231429130-231429152 GGGCACAGTGATGCAAAGGTTGG + Intergenic
924706961 1:246509674-246509696 GGGGACACTGTTCCACAGGTTGG + Intergenic
1067705909 10:48606295-48606317 GGGCACACTGTTCCCTAGGGAGG - Intronic
1072883279 10:99249306-99249328 GGGCACACTGATGCAAGGGTTGG - Intergenic
1078732035 11:13983532-13983554 GGGCACACTAAGACAAAAGTGGG + Intronic
1079891504 11:26061118-26061140 GGGGACACTTTCCCAAAAGTTGG - Intergenic
1080062430 11:27971254-27971276 GGGCAGACATTCCCAAAGGTGGG - Intergenic
1080136144 11:28857333-28857355 GGGCACACTGCTGCAAGGGTGGG + Intergenic
1083885869 11:65573285-65573307 GGGCCCACTATTCCAGGGGGCGG + Intronic
1085904403 11:80742890-80742912 GGACACACTATCCCAAAATTTGG + Intergenic
1086424135 11:86667638-86667660 GAGCACACTATTACAATGGCTGG - Intronic
1089820952 11:121225833-121225855 GGGCACACTGGTACAAGGGTGGG + Intergenic
1090756289 11:129794717-129794739 GGGCACACTAATGCAAGGGGTGG + Intergenic
1096778801 12:53980123-53980145 GGACAGACTTCTCCAAAGGTAGG + Intergenic
1098205954 12:68109854-68109876 GGGCAGAGAATTCCAAATGTGGG - Intergenic
1099587208 12:84533498-84533520 GGCCACACTGTTGCAAAGGGTGG - Intergenic
1100888627 12:99099892-99099914 GGGCCCCCTATTCAAAAGGCAGG - Intronic
1107288804 13:38828136-38828158 TGGCACAATATTCCAAAGGCAGG + Intronic
1110118238 13:71846613-71846635 GGCCAGACTCTTCCATAGGTAGG + Intronic
1111566649 13:90026045-90026067 GAGCACAGTATTCAATAGGTAGG - Intergenic
1112709662 13:102112898-102112920 GGGTTCAGTATTCCAAAGATTGG + Intronic
1113791256 13:113029632-113029654 GGGGACCCTCTTCCCAAGGTGGG + Intronic
1116454147 14:45098864-45098886 GGACACACTCTTCTAAAAGTTGG - Intronic
1119895274 14:78214672-78214694 AGGCACACTACTCCAGAGGTGGG + Intergenic
1120407175 14:84104098-84104120 GGGCACACTTTTGCAAAGGGTGG - Intergenic
1202833427 14_GL000009v2_random:59713-59735 TGGCACACCATTGCAGAGGTGGG + Intergenic
1126512852 15:49500405-49500427 GGGCACACTGGTGCAAAGGATGG - Intronic
1126513097 15:49502382-49502404 GGGCACACTGGTGCAAAGGATGG - Intronic
1137008929 16:35304447-35304469 GGGCACACTATCCAACAGTTGGG - Intergenic
1144226602 17:13155363-13155385 GGGCAGATCATTCAAAAGGTTGG - Intergenic
1144842430 17:18195807-18195829 TGGGACTCTATTCAAAAGGTAGG - Intronic
1149140645 17:53428837-53428859 GGGCACACTAGTGCAAAGGGTGG - Intergenic
1153914240 18:9731969-9731991 GTGCACACATTTGCAAAGGTAGG + Intronic
1160489161 18:79322381-79322403 CGGCACACCATCCCAAATGTGGG + Intronic
1167428701 19:49442540-49442562 GGGGACACAACTCCAACGGTGGG - Intergenic
925518428 2:4711014-4711036 GGGTCCACTATTCCAAATGGAGG + Intergenic
926653331 2:15370610-15370632 GGGCACACTGATGCAAAGGGTGG - Intronic
928055829 2:28053438-28053460 GGGCATACTTTTCTAAAAGTAGG + Intronic
929743964 2:44636169-44636191 GGGCACACTATCCAAAAAGCTGG + Intronic
930980820 2:57524029-57524051 GGACACACTCGTGCAAAGGTGGG - Intergenic
932755500 2:74405793-74405815 GGTAACACTATTACAAAGTTGGG + Intergenic
934015837 2:87881069-87881091 GGGCACACTAGTGCAAGGGGTGG + Intergenic
934015842 2:87881090-87881112 GGGCACACTAGTGCAAGGGGTGG + Intergenic
934015847 2:87881111-87881133 GGGCACACTAGTGCAAGGGGTGG + Intergenic
935931614 2:108133011-108133033 GGGCACACTGCTGCAAAGGGTGG + Intergenic
938974091 2:136458957-136458979 GGGCACACTGGTCCAAGGGGTGG + Intergenic
939445926 2:142310214-142310236 GGGCACACTGATGCAAAGGGTGG + Intergenic
939476828 2:142697554-142697576 GGGAACACTGTTACCAAGGTAGG - Intergenic
939784585 2:146494125-146494147 GGGCACACTGATGCAAAGGGTGG + Intergenic
940097412 2:149993331-149993353 GGACACACTATTCCAAAATATGG - Intergenic
940473830 2:154134602-154134624 GTGCAAAATATTCCAAAGTTTGG - Intronic
942441900 2:176045457-176045479 GGGCACACAATGCCAATGTTAGG + Intergenic
942496446 2:176545108-176545130 GGGGTCACTGTTCCAAATGTTGG + Intergenic
942624670 2:177887133-177887155 GGGCAAACTATTAGACAGGTAGG + Intronic
943427307 2:187752487-187752509 GGTCACACTAATGCAAAGGTGGG + Intergenic
944878719 2:203989304-203989326 GGCCACACTATCCCAAAATTTGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
1171284685 20:23927241-23927263 GGGGACACTAGTCGAAGGGTAGG - Intergenic
1172874344 20:38155198-38155220 GGGCACCCTATTCCTGATGTGGG + Intronic
1173488888 20:43462749-43462771 GGGCACTATATTCCTAAGGTTGG - Exonic
1178218201 21:30625105-30625127 GGGCACACTGGTCCAAGGGGTGG + Intergenic
954806105 3:53221806-53221828 GGGCACACTATTCTGGATGTCGG - Intergenic
955054642 3:55444696-55444718 GGGCACCCTATTCCAGGGGAGGG - Intergenic
956572480 3:70712353-70712375 GGGCACACTGATGCAAGGGTGGG + Intergenic
958469448 3:94498978-94499000 GGGCACACTGATGCAAAGGGTGG - Intergenic
959214744 3:103437321-103437343 GGGCACACTGATGCAAAGGGTGG + Intergenic
959332416 3:105022983-105023005 GGACAGACTATTTCAAAGGAGGG + Intergenic
960542020 3:118871747-118871769 GGGCACACTAATGCAAGGGGTGG - Intergenic
963181749 3:142364227-142364249 GGTCTCACTATCCCAAAAGTAGG - Intronic
965865372 3:173199071-173199093 GGGCACACTGGTGCAAGGGTTGG + Intergenic
972422198 4:38898730-38898752 GGAAAGACTATTCCAAAGGAAGG + Intronic
972847216 4:43004590-43004612 GGGCACACTGATGCAAAGGGTGG - Intronic
975435219 4:74343921-74343943 GGGCACACTGTTGCAAGGGGTGG + Intergenic
978162035 4:105560250-105560272 GGGAACAAAATTACAAAGGTAGG + Intronic
978344928 4:107756864-107756886 GGCCACACTAATGCAAAGGGTGG - Intergenic
979298278 4:119057209-119057231 TGGCCCACTTTTGCAAAGGTGGG + Intronic
979507572 4:121515218-121515240 GGGCACACTGGTACAAAGGGTGG - Intergenic
980641476 4:135585772-135585794 GGTCACACTGATGCAAAGGTGGG - Intergenic
980830728 4:138127222-138127244 GGGCACACTGGTACAAAGGGTGG - Intergenic
984436659 4:179718571-179718593 GGGCACACTGATGCAAAGGGTGG + Intergenic
1202766594 4_GL000008v2_random:153852-153874 TGGCACACCATTGCAGAGGTGGG - Intergenic
987585062 5:19843782-19843804 GGGCACACAGATGCAAAGGTTGG - Intronic
987881399 5:23750442-23750464 GGACACACTGTTGCAAAGGGTGG + Intergenic
988009663 5:25465444-25465466 GGGCACACTGATGCAAGGGTGGG - Intergenic
988162929 5:27544323-27544345 GGTCACACTGACCCAAAGGTGGG - Intergenic
988310265 5:29548235-29548257 GGGCACACTGATGCAAGGGTTGG + Intergenic
988671336 5:33385209-33385231 GGGCACACTGGTGCAAAGGATGG + Intergenic
989577387 5:43000810-43000832 GGGCCCAGGATTCCAAAGGCGGG - Intergenic
992457109 5:76926004-76926026 GGGCACATAGTTTCAAAGGTTGG + Intergenic
993443003 5:87979089-87979111 GGCCACACTGATCCAAAGGGTGG - Intergenic
994549208 5:101209008-101209030 GGGCACACTAGTGCAAGGGGTGG - Intergenic
994878839 5:105460621-105460643 GGGCACACTGATGCAAAGGGTGG + Intergenic
1002723202 5:181278274-181278296 GGGCACACTTGTGCAAGGGTGGG - Intergenic
1005175446 6:23039691-23039713 GGGCACCCAATTGCCAAGGTTGG + Intergenic
1005417171 6:25612361-25612383 GGGCATGCTAGTCCAAAGGGAGG - Intronic
1011587779 6:88945168-88945190 GGCCACTCTATCCGAAAGGTAGG + Intronic
1012617316 6:101293074-101293096 GGGCACACTAATGCAAGGGGTGG + Intergenic
1020587554 7:10088135-10088157 GGACACACTGTTCCAAAAGATGG + Intergenic
1020668176 7:11073446-11073468 GGGCACACTAGTACAATGGGTGG + Intronic
1022955359 7:35375275-35375297 TGGCACCCTATTCCAAAAGCTGG + Intergenic
1029964207 7:104721608-104721630 GGACAAACTACTCCTAAGGTAGG + Intronic
1034193850 7:149230846-149230868 TGGCACTGTATCCCAAAGGTTGG + Intergenic
1034309533 7:150074663-150074685 GGGCACACTATTCCAAAGGTTGG + Intergenic
1034797325 7:154025978-154026000 GGGCACACTATTCCAAAGGTTGG - Intronic
1040291547 8:46128085-46128107 AGGCACCCTGTTCCAACGGTTGG + Intergenic
1040304306 8:46204075-46204097 AGGCACACTTTTCCAAAGCCTGG - Intergenic
1040340139 8:46436294-46436316 GGGCACACTGCTCCAAAGCCTGG + Intergenic
1042098182 8:65242330-65242352 AGGAACACTATTCCACAGTTGGG - Intergenic
1042267452 8:66923960-66923982 GGGCACAAAATTCCAAATGGTGG + Intergenic
1056206153 9:84321370-84321392 GGGCACACTAGACCAACAGTGGG + Intronic
1189960818 X:46323387-46323409 GGACACACTACTCCAAAAGATGG - Intergenic
1191999002 X:67127643-67127665 GGCCACACTGTTGCAAAGGGTGG - Intergenic
1193393382 X:80956021-80956043 GGGGAAACTATTCAAAAGGCAGG + Intergenic
1193724747 X:85025723-85025745 GGGCACACTGCTGCAAAGGGTGG + Intronic
1193948138 X:87763923-87763945 GGGCACACTGTTGCAAGGGGTGG + Intergenic
1194119175 X:89938961-89938983 GGGCACACTAGTGCAAGGGGTGG + Intergenic
1195352458 X:104008183-104008205 GGGCACACTATCCCAAAATGAGG + Intergenic
1199119145 X:144030013-144030035 GGGCACACTGGTGCAAAGGGTGG - Intergenic
1199128645 X:144157435-144157457 GGGCACACTAGTGCAAGGGGTGG - Intergenic
1199237809 X:145510780-145510802 GGGCACACTGATGCAAGGGTTGG - Intergenic
1199384644 X:147209026-147209048 GGGCACACTGCTGCAAGGGTTGG - Intergenic
1199585602 X:149412910-149412932 GGGCACACTAGTGCAAAGAGTGG - Intergenic
1200472049 Y:3596520-3596542 GGGCACACTAGTGCAAGGGGTGG + Intergenic