ID: 1034310522

View in Genome Browser
Species Human (GRCh38)
Location 7:150083786-150083808
Sequence GAGAGAAAACAGCAGTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034310522_1034310524 -10 Left 1034310522 7:150083786-150083808 CCTCCATACTGCTGTTTTCTCTC No data
Right 1034310524 7:150083799-150083821 GTTTTCTCTCAGTTCACTAATGG 0: 2
1: 1
2: 0
3: 11
4: 191
1034310522_1034310527 20 Left 1034310522 7:150083786-150083808 CCTCCATACTGCTGTTTTCTCTC No data
Right 1034310527 7:150083829-150083851 TGAAGTGGCCTTTATTGGAGAGG No data
1034310522_1034310526 15 Left 1034310522 7:150083786-150083808 CCTCCATACTGCTGTTTTCTCTC No data
Right 1034310526 7:150083824-150083846 CAAAATGAAGTGGCCTTTATTGG No data
1034310522_1034310525 5 Left 1034310522 7:150083786-150083808 CCTCCATACTGCTGTTTTCTCTC No data
Right 1034310525 7:150083814-150083836 ACTAATGGCTCAAAATGAAGTGG 0: 2
1: 0
2: 0
3: 23
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034310522 Original CRISPR GAGAGAAAACAGCAGTATGG AGG (reversed) Intergenic
No off target data available for this crispr