ID: 1034312801

View in Genome Browser
Species Human (GRCh38)
Location 7:150104260-150104282
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034312795_1034312801 25 Left 1034312795 7:150104212-150104234 CCATGTCTATCTGCTAGGATGGC No data
Right 1034312801 7:150104260-150104282 ACTATGAGATTGAACCTTGAAGG 0: 2
1: 0
2: 0
3: 9
4: 103
1034312799_1034312801 3 Left 1034312799 7:150104234-150104256 CCAGAGGAGGTTTTCCTGAGGAA No data
Right 1034312801 7:150104260-150104282 ACTATGAGATTGAACCTTGAAGG 0: 2
1: 0
2: 0
3: 9
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034312801 Original CRISPR ACTATGAGATTGAACCTTGA AGG Intergenic
902707551 1:18216150-18216172 ACCATCACATTGAACCTGGAAGG + Intronic
911414423 1:97553727-97553749 TCCATGAGATTGCATCTTGATGG + Intronic
918662928 1:187112414-187112436 ATTATTAAATTGAATCTTGAAGG + Intergenic
919702967 1:200650333-200650355 ATTTTGAGATTGAACTTTCAGGG - Intronic
1064413676 10:15130202-15130224 ACTAGAAGAGTGAACCTGGAAGG - Exonic
1066177142 10:32920070-32920092 AATTTCAAATTGAACCTTGAAGG + Exonic
1066304579 10:34128209-34128231 ACCATGAGTTTGAACTTTGAGGG + Intronic
1069143569 10:64860192-64860214 CTCATGAGATTGAATCTTGAAGG + Intergenic
1069548233 10:69344001-69344023 ACCCAGAGATTGAACCCTGAGGG + Intronic
1071461568 10:85901883-85901905 CCTATGAGATTTAACATTTATGG - Intronic
1071831630 10:89378059-89378081 ACTCTGTGGATGAACCTTGAAGG + Exonic
1073879404 10:107962529-107962551 ACAATGTGATCGAACCTTGAGGG + Intergenic
1081269170 11:41063515-41063537 CCTCTGAGGTTGAACTTTGAAGG + Intronic
1085234494 11:75003201-75003223 AATTTGAGATGGAACCTTAAAGG - Intronic
1088182176 11:107125510-107125532 ACTAGGAGATAGAAACTAGAAGG + Intergenic
1088190225 11:107220304-107220326 ACTGTGACATTGACACTTGAGGG + Intergenic
1088325925 11:108601563-108601585 ACTTTGAAATTACACCTTGAAGG - Intergenic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1094229625 12:28088000-28088022 ACTAAGCAATTAAACCTTGATGG + Intergenic
1097376632 12:58851199-58851221 AAGATGAGTTTGTACCTTGAAGG - Intergenic
1099933641 12:89100941-89100963 ACAATGAAATTAAACCTTCATGG + Intergenic
1100690148 12:97030968-97030990 TCTATGAGATAGATACTTGAAGG - Intergenic
1106657725 13:31764465-31764487 ACTATGAGGTTGAAAGTTGAAGG - Intronic
1106966054 13:35069912-35069934 ACTCTCAGATTTAAACTTGAAGG - Exonic
1107751642 13:43573721-43573743 ACTATGGGTTTGAATCTTTAAGG - Intronic
1107869152 13:44731100-44731122 ACCATGTGATTGAACATTCAAGG - Intergenic
1109441228 13:62378054-62378076 ATAATGATATTGAATCTTGATGG - Intergenic
1110572050 13:77015322-77015344 ACTATGATCATTAACCTTGAAGG - Intronic
1114074789 14:19154138-19154160 ACTCTTAGATTTAAACTTGAAGG - Intergenic
1114087478 14:19245837-19245859 ACTCTTAGATTTAAACTTGAAGG + Intergenic
1114884198 14:26827332-26827354 ACTATGAGACAGAACCTGGTTGG - Intergenic
1116423277 14:44759223-44759245 ACAATGTGAATGAACCTGGAGGG + Intergenic
1118265734 14:64293686-64293708 ACTTTCTGATTGAACTTTGAGGG - Intronic
1120245864 14:82005591-82005613 ACTATATGGATGAACCTTGAAGG - Intergenic
1121088830 14:91167352-91167374 TCTCTGAGATAGCACCTTGAGGG - Exonic
1121877454 14:97466437-97466459 AACATGAGTTTGAACTTTGAGGG + Intergenic
1126367914 15:47915164-47915186 AGTATGAGATTGAAGCCTGCTGG + Intergenic
1130217158 15:81983246-81983268 ATTTTGAAATTGCACCTTGAAGG + Intergenic
1133454897 16:5933478-5933500 ACAAGGAGATTCAACCCTGACGG - Intergenic
1133986017 16:10668722-10668744 GCTATGAATTTTAACCTTGAAGG - Intronic
1135816995 16:25643760-25643782 ACTAAGACATAGAAGCTTGAAGG + Intergenic
1142723198 17:1791594-1791616 ACAATGAAAGTGAACCTTGCTGG + Intronic
1146520550 17:33522259-33522281 AATATGATATTGAATCTTAAAGG + Intronic
1149396851 17:56253982-56254004 ACTGTGAGATGGAACATTCAAGG + Intronic
1153270479 18:3316218-3316240 ACTTTGAGGATGAACTTTGAGGG + Intergenic
1156776143 18:40791609-40791631 ACTATGATATTTAATCTTTATGG - Intergenic
1159197354 18:65134960-65134982 ACTATTAGATTAAATTTTGAAGG - Intergenic
1167381113 19:49138550-49138572 CCTTTGAGTTTGAACCTTTAGGG - Intronic
931432354 2:62218302-62218324 ACGATGACATTTAACCTTGATGG + Intronic
932488973 2:72106388-72106410 ACCATGAGTTTGAACTTAGAGGG - Intergenic
932973373 2:76572952-76572974 AATATGAGATTGAATTTAGAGGG + Intergenic
936399110 2:112152418-112152440 ACTTTGAGTTTGAACCCTGCTGG - Intronic
938127083 2:128682412-128682434 ACACTGAGATGGAACCTGGAGGG + Intergenic
938489116 2:131750637-131750659 ACTCTCAGATTTAAACTTGAAGG - Exonic
939174625 2:138735199-138735221 ACTATGAGACTGATTCTTGTAGG + Intronic
940239687 2:151549521-151549543 TCTATCAGGTTGAACCTTGAGGG + Intronic
941238609 2:163008944-163008966 TTTATGAGATTGAGCCTTGTCGG - Intergenic
1169746194 20:8945543-8945565 ACTAGGAAATTCAACCCTGAAGG + Intronic
1180290438 22:10847072-10847094 ACTCTTAGATTTAAACTTGAAGG - Intergenic
1180493237 22:15876493-15876515 ACTCTTAGATTTAAACTTGAAGG - Intergenic
1182847683 22:33445207-33445229 ATTTTGAGATGGGACCTTGAAGG - Intronic
1183045717 22:35218028-35218050 ACAATGAGATTGAACCTCAATGG - Intergenic
1185198576 22:49488695-49488717 AATATGAGATTGAGGCTTAAGGG + Intronic
956696458 3:71922952-71922974 ACCATGAGAATGACCCTTTATGG - Intergenic
958417952 3:93898609-93898631 CCTATAAGATTGAACATTTAGGG - Intronic
958613517 3:96459194-96459216 ATTCTAAGATTGAACCATGAAGG + Intergenic
959663511 3:108896014-108896036 AAAATGTGAATGAACCTTGAGGG + Intergenic
960460228 3:117925191-117925213 ACTAGGATAATGAACCATGAGGG - Intergenic
964251923 3:154727874-154727896 ACTATGAGAATGATTCCTGAAGG - Intergenic
970196383 4:13554715-13554737 ACAATATGAATGAACCTTGAGGG - Intergenic
975223234 4:71838561-71838583 ACTAAGACATTGAACCCTGTGGG + Intergenic
975493749 4:75015641-75015663 AATATGAGAATGAACCTGGTAGG + Intronic
976354127 4:84096087-84096109 GCTATGAGATTGAGCCAAGAAGG + Intergenic
982216189 4:153084582-153084604 ACTCTGAGATTAAACCCTGAGGG - Intergenic
987957798 5:24763230-24763252 GCTCTGAGACTGAAGCTTGAGGG - Intergenic
990736515 5:58869215-58869237 GCCATGAGAATGAACCATGATGG + Intergenic
996780075 5:127175909-127175931 ACTGTGAGATTTATGCTTGAAGG + Intergenic
997921230 5:137981238-137981260 ACTATTAGATTAAAACTTCATGG - Intronic
1001801937 5:174552082-174552104 ACTATGAGAGCGAACCCAGATGG - Intergenic
1007836044 6:44674555-44674577 CCTATGGGATTGCACCTTTATGG + Intergenic
1007963799 6:45985305-45985327 TATATGAGATTAAACCCTGAAGG - Intronic
1010093559 6:72012496-72012518 ATTATGAAGTTGAAACTTGAAGG + Intronic
1010888986 6:81282378-81282400 AGTAATAGATTGAACATTGATGG + Intergenic
1012313098 6:97752513-97752535 ACTATAACATTGAACTTTAAGGG + Intergenic
1014906271 6:127032559-127032581 AATATGAAATTGAACCTGCAGGG - Intergenic
1016707870 6:147134315-147134337 ACAATGGGGATGAACCTTGAGGG + Intergenic
1016714510 6:147208991-147209013 AATATGAGATTGAAGAATGAAGG + Intronic
1018773750 6:166995509-166995531 TCTATAAAATTGAGCCTTGAAGG - Intergenic
1024876041 7:54024945-54024967 ACTATGAGATTTACGCTTTAAGG + Intergenic
1026473566 7:70714946-70714968 ACCATGAGATAAAAGCTTGACGG - Intronic
1027160064 7:75795912-75795934 ACGCTGAGAATGAACCTTCAGGG + Intergenic
1030149093 7:106385014-106385036 ACTATGAGACTGTACTGTGAGGG - Intergenic
1034312801 7:150104260-150104282 ACTATGAGATTGAACCTTGAAGG + Intergenic
1034794057 7:153996405-153996427 ACTATGAGATTGAACCTTGAAGG - Intronic
1037002798 8:13741087-13741109 ACTATGAGATGAAACCTGTAGGG - Intergenic
1038537516 8:28364332-28364354 CCTATGTTAGTGAACCTTGATGG + Intronic
1043359464 8:79454412-79454434 ACTTTGGGATTGAACGTTTAAGG + Intergenic
1043668944 8:82856561-82856583 TCTATGATAGTGAACCATGATGG - Intergenic
1044527014 8:93263696-93263718 ATTAGGAGATTGAACCTTCCAGG + Intergenic
1045663425 8:104461641-104461663 AAAATGAGTTTGAAACTTGAAGG + Intronic
1045716529 8:105053584-105053606 TCTCTGAGATTAAACCTTGTTGG + Intronic
1046603497 8:116344943-116344965 ACTATGAGATTGAAATGTGATGG + Intergenic
1050146939 9:2578578-2578600 AGTAAGAGCTGGAACCTTGAAGG + Intergenic
1050823346 9:9912102-9912124 ACTATAAAATAAAACCTTGATGG + Intronic
1055701822 9:78952753-78952775 ATTATGAGATTGTAGCTGGACGG - Intergenic
1203626149 Un_KI270750v1:25200-25222 ATTAAGAGCTGGAACCTTGAGGG - Intergenic
1186155396 X:6720353-6720375 ACAATGTGAATGAACCTGGAGGG + Intergenic
1187060791 X:15785367-15785389 ACAATGTGGATGAACCTTGAAGG + Exonic
1188426364 X:30051946-30051968 GCAATGAAATTGAACCCTGAAGG - Intergenic
1192805313 X:74503528-74503550 ACTATGAGATTGGAACATCAGGG - Intronic
1193902557 X:87200215-87200237 ATTTTGAGGCTGAACCTTGAGGG - Intergenic
1194630449 X:96276183-96276205 CCTATGAGATTTATGCTTGAAGG - Intergenic
1195480971 X:105344505-105344527 ACAATGATATTGAACATTTATGG - Intronic
1201917810 Y:19201523-19201545 AATATAAGAGTGAACATTGAGGG - Intergenic