ID: 1034314285

View in Genome Browser
Species Human (GRCh38)
Location 7:150115720-150115742
Sequence CTCAGTCAGCACTGTGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034314280_1034314285 30 Left 1034314280 7:150115667-150115689 CCACTCTCATTGGAAAATAGAAA No data
Right 1034314285 7:150115720-150115742 CTCAGTCAGCACTGTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034314285 Original CRISPR CTCAGTCAGCACTGTGAGCA GGG Intergenic
No off target data available for this crispr