ID: 1034323396

View in Genome Browser
Species Human (GRCh38)
Location 7:150206313-150206335
Sequence GGTTGAACAAGCACTCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034323396_1034323400 -7 Left 1034323396 7:150206313-150206335 CCCCTGGGAGTGCTTGTTCAACC No data
Right 1034323400 7:150206329-150206351 TTCAACCTTGGTCTGTATCTAGG No data
1034323396_1034323402 22 Left 1034323396 7:150206313-150206335 CCCCTGGGAGTGCTTGTTCAACC No data
Right 1034323402 7:150206358-150206380 CAGAGTCCTGTGTTTCAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034323396 Original CRISPR GGTTGAACAAGCACTCCCAG GGG (reversed) Intergenic
No off target data available for this crispr